File: aligner_seed_policy.h

package info (click to toggle)
hisat2 2.1.0-2
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, buster, sid
  • size: 13,756 kB
  • sloc: cpp: 86,309; python: 12,230; sh: 2,171; perl: 936; makefile: 375
file content (234 lines) | stat: -rw-r--r-- 8,383 bytes parent folder | download | duplicates (2)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
/*
 * Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
 *
 * This file is part of Bowtie 2.
 *
 * Bowtie 2 is free software: you can redistribute it and/or modify
 * it under the terms of the GNU General Public License as published by
 * the Free Software Foundation, either version 3 of the License, or
 * (at your option) any later version.
 *
 * Bowtie 2 is distributed in the hope that it will be useful,
 * but WITHOUT ANY WARRANTY; without even the implied warranty of
 * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
 * GNU General Public License for more details.
 *
 * You should have received a copy of the GNU General Public License
 * along with Bowtie 2.  If not, see <http://www.gnu.org/licenses/>.
 */

#ifndef ALIGNER_SEED_POLICY_H_
#define ALIGNER_SEED_POLICY_H_

#include "scoring.h"
#include "simple_func.h"

#define DEFAULT_SEEDMMS 0
#define DEFAULT_SEEDLEN 22

#define DEFAULT_IVAL SIMPLE_FUNC_SQRT
#define DEFAULT_IVAL_A 1.15f
#define DEFAULT_IVAL_B 0.0f

#define DEFAULT_UNGAPPED_HITS 6

/**
 * Encapsulates the set of all parameters that affect what the
 * SeedAligner does with reads.
 */
class SeedAlignmentPolicy {

public:

	/**
	 * Parse alignment policy when provided in this format:
	 * <lab>=<val>;<lab>=<val>;<lab>=<val>...
	 *
	 * And label=value possibilities are:
	 *
	 * Bonus for a match
	 * -----------------
	 *
	 * MA=xx (default: MA=0, or MA=2 if --local is set)
	 *
	 *    xx = Each position where equal read and reference characters match up
	 *         in the alignment contriubtes this amount to the total score.
	 *
	 * Penalty for a mismatch
	 * ----------------------
	 *
	 * MMP={Cxx|Q|RQ} (default: MMP=C6)
	 *
	 *   Cxx = Each mismatch costs xx.  If MMP=Cxx is specified, quality
	 *         values are ignored when assessing penalities for mismatches.
	 *   Q   = Each mismatch incurs a penalty equal to the mismatched base's
	 *         value.
	 *   R   = Each mismatch incurs a penalty equal to the mismatched base's
	 *         rounded quality value.  Qualities are rounded off to the
	 *         nearest 10, and qualities greater than 30 are rounded to 30.
	 *
	 * Penalty for position with N (in either read or reference)
	 * ---------------------------------------------------------
	 *
	 * NP={Cxx|Q|RQ} (default: NP=C1)
	 *
	 *   Cxx = Each alignment position with an N in either the read or the
	 *         reference costs xx.  If NP=Cxx is specified, quality values are
	 *         ignored when assessing penalities for Ns.
	 *   Q   = Each alignment position with an N in either the read or the
	 *         reference incurs a penalty equal to the read base's quality
	 *         value.
	 *   R   = Each alignment position with an N in either the read or the
	 *         reference incurs a penalty equal to the read base's rounded
	 *         quality value.  Qualities are rounded off to the nearest 10,
	 *         and qualities greater than 30 are rounded to 30.
	 *
	 * Penalty for a read gap
	 * ----------------------
	 *
	 * RDG=xx,yy (default: RDG=5,3)
	 *
	 *   xx    = Read gap open penalty.
	 *   yy    = Read gap extension penalty.
	 *
	 * Total cost incurred by a read gap = xx + (yy * gap length)
	 *
	 * Penalty for a reference gap
	 * ---------------------------
	 *
	 * RFG=xx,yy (default: RFG=5,3)
	 *
	 *   xx    = Reference gap open penalty.
	 *   yy    = Reference gap extension penalty.
	 *
	 * Total cost incurred by a reference gap = xx + (yy * gap length)
	 *
	 * Minimum score for valid alignment
	 * ---------------------------------
	 *
	 * MIN=xx,yy (defaults: MIN=-0.6,-0.6, or MIN=0.0,0.66 if --local is set)
	 *
	 *   xx,yy = For a read of length N, the total score must be at least
	 *           xx + (read length * yy) for the alignment to be valid.  The
	 *           total score is the sum of all negative penalties (from
	 *           mismatches and gaps) and all positive bonuses.  The minimum
	 *           can be negative (and is by default in global alignment mode).
	 *
	 * N ceiling
	 * ---------
	 *
	 * NCEIL=xx,yy (default: NCEIL=0.0,0.15)
	 *
	 *   xx,yy = For a read of length N, the number of alignment
	 *           positions with an N in either the read or the
	 *           reference cannot exceed
	 *           ceiling = xx + (read length * yy).  If the ceiling is
	 *           exceeded, the alignment is considered invalid.
	 *
	 * Seeds
	 * -----
	 *
	 * SEED=mm,len,ival (default: SEED=0,22)
	 *
	 *   mm   = Maximum number of mismatches allowed within a seed.
	 *          Must be >= 0 and <= 2.  Note that 2-mismatch mode is
	 *          not fully sensitive; i.e. some 2-mismatch seed
	 *          alignments may be missed.
	 *   len  = Length of seed.
	 *   ival = Interval between seeds.  If not specified, seed
	 *          interval is determined by IVAL.
	 *
	 * Seed interval
	 * -------------
	 *
	 * IVAL={L|S|C},xx,yy (default: IVAL=S,1.0,0.0)
	 *
	 *   L  = let interval between seeds be a linear function of the
	 *        read length.  xx and yy are the constant and linear
	 *        coefficients respectively.  In other words, the interval
	 *        equals a * len + b, where len is the read length.
	 *        Intervals less than 1 are rounded up to 1.
	 *   S  = let interval between seeds be a function of the sqaure
	 *        root of the  read length.  xx and yy are the
	 *        coefficients.  In other words, the interval equals
	 *        a * sqrt(len) + b, where len is the read length.
	 *        Intervals less than 1 are rounded up to 1.
	 *   C  = Like S but uses cube root of length instead of square
	 *        root.
	 *
	 * Example 1:
	 *
	 *  SEED=1,10,5 and read sequence is TGCTATCGTACGATCGTAC:
	 *
	 *  The following seeds are extracted from the forward
	 *  representation of the read and aligned to the reference
	 *  allowing up to 1 mismatch:
	 *
	 *  Read:    TGCTATCGTACGATCGTACA
	 *
	 *  Seed 1+: TGCTATCGTA
	 *  Seed 2+:      TCGTACGATC
	 *  Seed 3+:           CGATCGTACA
	 *
	 *  ...and the following are extracted from the reverse-complement
	 *  representation of the read and align to the reference allowing
	 *  up to 1 mismatch:
	 *
	 *  Seed 1-: TACGATAGCA
	 *  Seed 2-:      GATCGTACGA
	 *  Seed 3-:           TGTACGATCG
	 *
	 * Example 2:
	 *
	 *  SEED=1,20,20 and read sequence is TGCTATCGTACGATC.  The seed
	 *  length is 20 but the read is only 15 characters long.  In this
	 *  case, Bowtie2 automatically shrinks the seed length to be equal
	 *  to the read length.
	 *
	 *  Read:    TGCTATCGTACGATC
	 *
	 *  Seed 1+: TGCTATCGTACGATC
	 *  Seed 1-: GATCGTACGATAGCA
	 *
	 * Example 3:
	 *
	 *  SEED=1,10,10 and read sequence is TGCTATCGTACGATC.  Only one seed
	 *  fits on the read; a second seed would overhang the end of the read
	 *  by 5 positions.  In this case, Bowtie2 extracts one seed.
	 *
	 *  Read:    TGCTATCGTACGATC
	 *
	 *  Seed 1+: TGCTATCGTA
	 *  Seed 1-: TACGATAGCA
	 */
	static void parseString(
                            const       std::string& s,
                            bool        local,
                            bool        noisyHpolymer,
                            bool        ignoreQuals,
                            int&        bonusMatchType,
                            int&        bonusMatch,
                            int&        penMmcType,
                            int&        penMmcMax,
                            int&        penMmcMin,
                            int&        penScMax,
                            int&        penScMin,
                            int&        penNType,
                            int&        penN,
                            int&        penRdExConst,
                            int&        penRfExConst,
                            int&        penRdExLinear,
                            int&        penRfExLinear,
                            SimpleFunc& costMin,
                            SimpleFunc& nCeil,
                            bool&       nCatPair,
                            int&        multiseedMms,
                            int&        multiseedLen,
                            SimpleFunc& multiseedIval,
                            size_t&     failStreak,
                            size_t&     seedRounds,
                            SimpleFunc* penCanIntronLen = NULL,
                            SimpleFunc* penNoncanIntronLen = NULL);
};

#endif /*ndef ALIGNER_SEED_POLICY_H_*/