1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178
|
#!/usr/bin/perl -w
#
# Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
#
# This file is part of Bowtie 2.
#
# Bowtie 2 is free software: you can redistribute it and/or modify
# it under the terms of the GNU General Public License as published by
# the Free Software Foundation, either version 3 of the License, or
# (at your option) any later version.
#
# Bowtie 2 is distributed in the hope that it will be useful,
# but WITHOUT ANY WARRANTY; without even the implied warranty of
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
# GNU General Public License for more details.
#
# You should have received a copy of the GNU General Public License
# along with Bowtie 2. If not, see <http://www.gnu.org/licenses/>.
#
package Read;
use strict;
use Carp;
use FindBin qw($Bin);
use lib $Bin;
use DNA;
use Test;
sub new {
my ($class, $name, $seq, $qual, $color, $fw, $orig) = @_;
$name = "noname" unless defined($name);
return bless {
_name => $name,
_seq => $seq || croak("No sequence"),
_qual => $qual || croak("No qualities"),
_color => $color || 0,
_fw => $fw || croak("No orientation"),
_orig => $orig || croak("No original read string")
}, $class;
}
sub name { return $_[0]->{_name} }
sub seq { return $_[0]->{_seq} }
sub qual { return $_[0]->{_qual} }
sub color { return $_[0]->{_color} }
sub fw { return $_[0]->{_fw} }
sub orig { return $_[0]->{_orig} }
sub len { return length($_[0]->seq()) }
##
# Obtain a character from the read.
#
sub at {
my ($self, $off, $ori) = @_;
my ($c, $q) = "";
if($ori eq "RtL") {
$c = uc substr($self->seq(), -$off-1, 1);
$q = substr($self->qual(), -$off-1, 1);
} else {
$c = uc substr($self->seq(), $off, 1);
$q = substr($self->qual(), $off, 1);
}
length($c) == 1 || die;
return ($c, $q);
}
##
# Load a set of FASTQ reads into the given reads array.
#
sub fromFastq {
my ($fh, $color, $reads) = @_;
$reads = [] unless defined($reads);
while(<$fh>) {
my $l1 = $_;
my $l2 = <$fh>; defined($l2) || croak("Name line followed by EOF");
my $l3 = <$fh>; defined($l3) || croak("Sequence line followed by EOF");
my $l4 = <$fh>; defined($l4) || croak("Name2 line followed by EOF");
my $orig = "$l1$l2$l3$l4";
chomp($l1); chomp($l2); chomp($l3); chomp($l4);
push @{$reads}, Read->new(substr($l1, 1), $l2, $l4, $color, "FW", $orig);
}
return $reads;
}
##
# Load a set of FASTQ reads into the given reads array.
#
sub fromFastqs {
my ($fqs, $color, $reads) = @_;
$reads = [] unless defined($reads);
for my $f (@$fqs) {
my $fqfh;
open($fqfh, $f =~ /\.gz$/ ? "gzip -dc $f |" : "$f") || croak("Could not open $f for reading");
fromFastq($fqfh, $color, $reads);
close($fqfh);
}
return $reads;
}
##
# Load a set of FASTA reads into the given reads array.
#
sub fromFasta {
my ($fh, $color, $reads) = @_;
$reads = [] unless defined($reads);
while(<$fh>) {
my $l1 = $_;
my $l2 = <$fh>; defined($l2) || croak("Name line followed by EOF");
my $orig = "$l1$l2";
chomp($l1); chomp($l2);
my $qual = "I" x length($l2);
push @{$reads}, Read->new(substr($l1, 1), $l2, $qual, $color, "FW", $orig);
}
return $reads;
}
##
# Load a set of FASTA reads into the given reads array.
#
sub fromFastas {
my ($fas, $color, $reads) = @_;
$reads = [] unless defined($reads);
for my $f (@$fas) {
my $fafh;
open($fafh, $f =~ /\.gz$/ ? "gzip -dc $f |" : "$f") || croak("Could not open $f for reading");
fromFasta($fafh, $color, $reads);
close($fafh);
}
return $reads;
}
##
# Load a set of FASTA reads into the given reads array.
#
sub fromStrings {
my ($strs, $color, $reads) = @_;
$reads = [] unless defined($reads);
my $idx = 0;
for my $str (@$strs) {
my $qual = "I" x length($str);
push @{$reads}, new Read($idx, $str, $qual, $color, "FW", $str);
$idx++;
}
return $reads;
}
sub test1 {
my $r = new Read("blah", "TTACGAACCACAACGTATCG", "I"x20, 0, "FW", "?");
my ($c, $q) = $r->at(0, "LtR");
($c eq "T" && $q eq "I") || croak("Expected (T, I), got ($c, $q)\n");
($c, $q) = $r->at(0, "RtL");
($c eq "G" && $q eq "I") || croak("Expected (G, I), got ($c, $q)\n");
($c, $q) = $r->at(1, "LtR");
($c eq "T" && $q eq "I") || croak("Expected (T, I), got ($c, $q)\n");
($c, $q) = $r->at(1, "RtL");
($c eq "C" && $q eq "I") || croak("Expected (C, I), got ($c, $q)\n");
return 1;
}
sub test2 {
my $rs = fromStrings(["ACGATGCTACG", "TGACGATGCTAG"], 0);
$rs->[0]->seq() eq "ACGATGCTACG" || croak($rs->[0]->seq());
$rs->[0]->qual() eq "IIIIIIIIIII" || croak($rs->[0]->qual());
$rs->[0]->name() eq "0" || croak($rs->[0]->name());
$rs->[1]->seq() eq "TGACGATGCTAG" || croak($rs->[1]->seq());
$rs->[1]->qual() eq "IIIIIIIIIIII" || croak($rs->[1]->qual());
$rs->[1]->name() eq "1" || croak($rs->[1]->name());
return 1;
}
if($0 =~ /Read\.pm$/) {
print "Running unit tests\n";
# Run unit tests
print "Test \"test1\"..."; test1(); print "PASSED\n";
print "Test \"test2\"..."; test2(); print "PASSED\n";
}
1;
|