File: last-tutorial.html

package info (click to toggle)
last-align 490-1
links: PTS, VCS
area: main
in suites: jessie, jessie-kfreebsd
size: 2,196 kB
ctags: 2,317
sloc: cpp: 20,908; python: 1,636; ansic: 1,466; makefile: 365; sh: 107
file content (713 lines) | stat: -rw-r--r-- 23,514 bytes
<?xml version="1.0" encoding="utf-8" ?>
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
<meta name="generator" content="Docutils 0.6: http://docutils.sourceforge.net/" />
<title>LAST Tutorial</title>
<style type="text/css">

/*
:Author: David Goodger (goodger@python.org)
:Id: $Id: html4css1.css 7056 2011-06-17 10:50:48Z milde $
:Copyright: This stylesheet has been placed in the public domain.

Default cascading style sheet for the HTML output of Docutils.

See http://docutils.sf.net/docs/howto/html-stylesheets.html for how to
customize this style sheet.
*/

/* used to remove borders from tables and images */
.borderless, table.borderless td, table.borderless th {
  border: 0 }

table.borderless td, table.borderless th {
  /* Override padding for "table.docutils td" with "! important".
     The right padding separates the table cells. */
  padding: 0 0.5em 0 0 ! important }

.first {
  /* Override more specific margin styles with "! important". */
  margin-top: 0 ! important }

.last, .with-subtitle {
  margin-bottom: 0 ! important }

.hidden {
  display: none }

a.toc-backref {
  text-decoration: none ;
  color: black }

blockquote.epigraph {
  margin: 2em 5em ; }

dl.docutils dd {
  margin-bottom: 0.5em }

object[type="image/svg+xml"], object[type="application/x-shockwave-flash"] {
  overflow: hidden;
}

/* Uncomment (and remove this text!) to get bold-faced definition list terms
dl.docutils dt {
  font-weight: bold }
*/

div.abstract {
  margin: 2em 5em }

div.abstract p.topic-title {
  font-weight: bold ;
  text-align: center }

div.admonition, div.attention, div.caution, div.danger, div.error,
div.hint, div.important, div.note, div.tip, div.warning {
  margin: 2em ;
  border: medium outset ;
  padding: 1em }

div.admonition p.admonition-title, div.hint p.admonition-title,
div.important p.admonition-title, div.note p.admonition-title,
div.tip p.admonition-title {
  font-weight: bold ;
  font-family: sans-serif }

div.attention p.admonition-title, div.caution p.admonition-title,
div.danger p.admonition-title, div.error p.admonition-title,
div.warning p.admonition-title {
  color: red ;
  font-weight: bold ;
  font-family: sans-serif }

/* Uncomment (and remove this text!) to get reduced vertical space in
   compound paragraphs.
div.compound .compound-first, div.compound .compound-middle {
  margin-bottom: 0.5em }

div.compound .compound-last, div.compound .compound-middle {
  margin-top: 0.5em }
*/

div.dedication {
  margin: 2em 5em ;
  text-align: center ;
  font-style: italic }

div.dedication p.topic-title {
  font-weight: bold ;
  font-style: normal }

div.figure {
  margin-left: 2em ;
  margin-right: 2em }

div.footer, div.header {
  clear: both;
  font-size: smaller }

div.line-block {
  display: block ;
  margin-top: 1em ;
  margin-bottom: 1em }

div.line-block div.line-block {
  margin-top: 0 ;
  margin-bottom: 0 ;
  margin-left: 1.5em }

div.sidebar {
  margin: 0 0 0.5em 1em ;
  border: medium outset ;
  padding: 1em ;
  background-color: #ffffee ;
  width: 40% ;
  float: right ;
  clear: right }

div.sidebar p.rubric {
  font-family: sans-serif ;
  font-size: medium }

div.system-messages {
  margin: 5em }

div.system-messages h1 {
  color: red }

div.system-message {
  border: medium outset ;
  padding: 1em }

div.system-message p.system-message-title {
  color: red ;
  font-weight: bold }

div.topic {
  margin: 2em }

h1.section-subtitle, h2.section-subtitle, h3.section-subtitle,
h4.section-subtitle, h5.section-subtitle, h6.section-subtitle {
  margin-top: 0.4em }

h1.title {
  text-align: center }

h2.subtitle {
  text-align: center }

hr.docutils {
  width: 75% }

img.align-left, .figure.align-left, object.align-left {
  clear: left ;
  float: left ;
  margin-right: 1em }

img.align-right, .figure.align-right, object.align-right {
  clear: right ;
  float: right ;
  margin-left: 1em }

img.align-center, .figure.align-center, object.align-center {
  display: block;
  margin-left: auto;
  margin-right: auto;
}

.align-left {
  text-align: left }

.align-center {
  clear: both ;
  text-align: center }

.align-right {
  text-align: right }

/* reset inner alignment in figures */
div.align-right {
  text-align: inherit }

/* div.align-center * { */
/*   text-align: left } */

ol.simple, ul.simple {
  margin-bottom: 1em }

ol.arabic {
  list-style: decimal }

ol.loweralpha {
  list-style: lower-alpha }

ol.upperalpha {
  list-style: upper-alpha }

ol.lowerroman {
  list-style: lower-roman }

ol.upperroman {
  list-style: upper-roman }

p.attribution {
  text-align: right ;
  margin-left: 50% }

p.caption {
  font-style: italic }

p.credits {
  font-style: italic ;
  font-size: smaller }

p.label {
  white-space: nowrap }

p.rubric {
  font-weight: bold ;
  font-size: larger ;
  color: maroon ;
  text-align: center }

p.sidebar-title {
  font-family: sans-serif ;
  font-weight: bold ;
  font-size: larger }

p.sidebar-subtitle {
  font-family: sans-serif ;
  font-weight: bold }

p.topic-title {
  font-weight: bold }

pre.address {
  margin-bottom: 0 ;
  margin-top: 0 ;
  font: inherit }

pre.literal-block, pre.doctest-block, pre.math {
  margin-left: 2em ;
  margin-right: 2em }

span.classifier {
  font-family: sans-serif ;
  font-style: oblique }

span.classifier-delimiter {
  font-family: sans-serif ;
  font-weight: bold }

span.interpreted {
  font-family: sans-serif }

span.option {
  white-space: nowrap }

span.pre {
  white-space: pre }

span.problematic {
  color: red }

span.section-subtitle {
  /* font-size relative to parent (h1..h6 element) */
  font-size: 80% }

table.citation {
  border-left: solid 1px gray;
  margin-left: 1px }

table.docinfo {
  margin: 2em 4em }

table.docutils {
  margin-top: 0.5em ;
  margin-bottom: 0.5em }

table.footnote {
  border-left: solid 1px black;
  margin-left: 1px }

table.docutils td, table.docutils th,
table.docinfo td, table.docinfo th {
  padding-left: 0.5em ;
  padding-right: 0.5em ;
  vertical-align: top }

table.docutils th.field-name, table.docinfo th.docinfo-name {
  font-weight: bold ;
  text-align: left ;
  white-space: nowrap ;
  padding-left: 0 }

h1 tt.docutils, h2 tt.docutils, h3 tt.docutils,
h4 tt.docutils, h5 tt.docutils, h6 tt.docutils {
  font-size: 100% }

ul.auto-toc {
  list-style-type: none }
/* Style sheet for LAST HTML documents */
h1 { color: navy }
h2 { color: teal }
div.document { margin-left: auto; margin-right: auto; max-width: 40em }
li { margin-bottom: 1ex }

</style>
</head>
<body>
<div class="document" id="last-tutorial">
<h1 class="title">LAST Tutorial</h1>

<p>LAST finds similar regions between sequences, and aligns them.</p>
<div class="section" id="example-1-compare-the-human-and-fugu-mitochondrial-genomes">
<h2>Example 1: Compare the human and fugu mitochondrial genomes</h2>
<p>For our first example, we wish to find and align similar regions
between the human and fugu mitochondrial genomes.  You can find these
sequences in the examples directory: humanMito.fa and fuguMito.fa.  We
can compare them like this:</p>
<pre class="literal-block">
lastdb -c humdb humanMito.fa
lastal humdb fuguMito.fa &gt; myalns.maf
</pre>
<p>The lastdb command creates several files whose names begin with
&quot;humdb&quot;.  The lastal command then compares fuguMito.fa to the humdb
files, and writes the alignments to a file called &quot;myalns.maf&quot;.</p>
<p>The -c option causes lowercase letters to be soft-masked.  Lowercase
is often used to indicate repetitive regions, and soft-masking avoids
getting uninteresting repetitive alignments.</p>
</div>
<div class="section" id="understanding-the-output">
<h2>Understanding the output</h2>
<p>The output has very long lines, so you need to view it without
line-wrapping.  For example, with a Unix/Linux/MacOsX command line,
you can use:</p>
<pre class="literal-block">
less -S myalns.maf
</pre>
<p>Each alignment looks like this:</p>
<pre class="literal-block">
a score=85
s humanMito 1742 289 + 16571 AGTATAGGCGATAGAAATTGAAACCTGGCGCAAT...
s fuguMito  1182 300 + 16447 AGTATAGGAGATAGAAAAGGAA-CTAGGAGCTAT...
</pre>
<p>The score is a measure of how strong the similarity is.  Lines
starting with &quot;s&quot; contain: the sequence name, the start coordinate of
the alignment, the number of bases spanned by the alignment, the
strand, the sequence length, and the aligned bases.</p>
<p>The start coordinates are zero-based.  This means that, if the
alignment begins right at the start of a sequence, the coordinate is
0.  If the strand is &quot;-&quot;, the start coordinate is in the reverse
strand.</p>
<p>This alignment format is called MAF (multiple alignment format), and
it is described in the UCSC Genome FAQ.  You can convert it to several
other formats using maf-convert (see <a class="reference external" href="maf-convert.html">maf-convert.html</a>).</p>
</div>
<div class="section" id="example-2-compare-vertebrate-proteins-to-invertebrate-proteins">
<h2>Example 2: Compare vertebrate proteins to invertebrate proteins</h2>
<p>Use the lastdb -p option to indicate that the sequences are proteins:</p>
<pre class="literal-block">
lastdb -p -c invdb invertebrate.fa
lastal invdb vertebrate.fa
</pre>
</div>
<div class="section" id="example-3-compare-dna-sequences-to-protein-sequences">
<h2>Example 3: Compare DNA sequences to protein sequences</h2>
<p>Here we use the -F15 option, to specify translated alignment with a
score penalty of 15 for frameshifts:</p>
<pre class="literal-block">
lastdb -p -c protdb proteins.fa
lastal -F15 protdb dnas.fa
</pre>
</div>
<div class="section" id="example-4-calculate-e-values-of-alignment-scores">
<h2>Example 4: Calculate E-values of alignment scores</h2>
<p>lastal reports alignments whose score is at least some minimum value,
e.g. 40.  If this value is too high we may miss meaningful alignments,
but if it is too low we may find meaningless alignments.</p>
<p>To solve this dilemma, it is useful to know what alignment scores are
likely between completely random sequences.  For example, let us find
what alignment scores are likely between two random sequences with the
same lengths and base frequencies as the human and fugu mitochondrial
genomes:</p>
<pre class="literal-block">
lastdb -x humdb humanMito.fa
lastdb -x fugdb fuguMito.fa
lastex humdb.prj fugdb.prj
</pre>
<p>The lastdb commands count bases, and write them in files called
humdb.prj and fugdb.prj.  The -x option tells it to only count bases
and skip its usual preparation steps.  The lastex command prints a
table of scores and expected numbers of alignments.  Here is an
abbreviated version:</p>
<pre class="literal-block">
Score      Expected number of alignments
39         8.44e-11
22         0.00805
20         0.0699
12         398
</pre>
<p>This tells us, for example, that there will be on average 398
alignments of score 12 or more between random sequences with these
lengths and base frequencies.  Also, 22 is the minimum score such that
the average number of alignments is no more than 0.01.</p>
<p>Finally, we can find alignments with score at least 22 like this:</p>
<pre class="literal-block">
lastdb -c humdb humanMito.fa
lastal -e22 humdb fuguMito.fa &gt; myalns.maf
</pre>
</div>
<div class="section" id="example-5-align-human-dna-reads-to-the-human-genome">
<h2>Example 5: Align human DNA reads to the human genome</h2>
<p>Suppose we have DNA reads in a file called reads.fastq, in
fastq-sanger format.  We can align them to the human genome like
this:</p>
<pre class="literal-block">
lastdb -m1111110 humandb human/chr*.fa
lastal -Q1 -e120 humandb reads.fastq | last-split &gt; myalns.maf
</pre>
<p>This will use about 15 gigabytes of memory.</p>
<ul class="simple">
<li>The funny-looking -m1111110 option makes it better at finding short,
strong alignments.  (The default settings are tuned for long, weak
alignments.)</li>
<li>The -Q1 option indicates that the reads are in fastq-sanger format.
(It also changes the scoring scheme: more on this below.)</li>
<li>The -e120 option requests alignments with score &gt;= 120.  This is
intentionally a somewhat low score (high E-value): last-split then
discards low-confidence alignments, but it uses them to estimate the
ambiguity of high-confidence alignments.</li>
<li>last-split reads the alignments produced by lastal, and looks for a
unique best alignment for each part of each read.  It allows
different parts of one read to match different parts of the genome.
It has several useful options, please see <a class="reference external" href="last-split.html">last-split.html</a>.</li>
</ul>
<p>If you have paired reads, there are two options:</p>
<ol class="arabic simple">
<li>Use last-pair-probs (see <a class="reference external" href="last-pair-probs.html">last-pair-probs.html</a>).</li>
<li>Ignore the pairing information, and align the reads individually
(using last-split as above).  This may be useful because
last-pair-probs does not currently allow different parts of one
read to match different parts of the genome, though it does allow
the two reads in a pair to match (e.g.) different chromosomes.</li>
</ol>
</div>
<div class="section" id="fastq-format-confusion">
<h2>Fastq format confusion</h2>
<p>Unfortunately, there is more than one fastq format (see
<a class="reference external" href="http://nar.oxfordjournals.org/content/38/6/1767.long">http://nar.oxfordjournals.org/content/38/6/1767.long</a>).  Recently
(2013) fastq-sanger seems to be dominant, but if you have another
variant you need to change the -Q option (see <a class="reference external" href="lastal.txt">lastal.txt</a>).</p>
</div>
<div class="section" id="alignment-scoring-schemes">
<h2>Alignment scoring schemes</h2>
<p>The default DNA scoring scheme used by lastal is tuned for finding
long, weak alignments.  It is:</p>
<pre class="literal-block">
match score = 1,  mismatch cost = 1,  gap cost = 7 + 1 * (gap length)
</pre>
<p>However, if you use option -Q1, it uses a different scoring scheme
tuned for finding short, strong alignments:</p>
<pre class="literal-block">
match score = 6,  mismatch cost = 18,  gap cost = 21 + 9 * (gap length)
</pre>
<p>In the next two examples, we set the scoring scheme by hand.</p>
</div>
<div class="section" id="example-6-align-human-fasta-reads-to-the-human-genome">
<h2>Example 6: Align human fasta reads to the human genome</h2>
<p>Suppose we have DNA reads in fasta format (without quality data)
instead of fastq.  We need to omit the -Q option, but we wish to use
the same scoring scheme as -Q1:</p>
<pre class="literal-block">
lastdb -m1111110 humandb human/chr*.fa
lastal -r6 -q18 -a21 -b9 -e120 humandb reads.fa | last-split &gt; myalns.maf
</pre>
</div>
<div class="section" id="example-7-align-aardvark-fastq-reads-to-the-human-genome">
<h2>Example 7: Align aardvark fastq reads to the human genome</h2>
<p>In this case we need to use the -Q option, but we wish to find weak
alignments:</p>
<pre class="literal-block">
lastdb -c humandb human/chr*.fa
lastal -Q1 -r5 -q5 -a35 -b5 humandb reads.fastq &gt; myalns.maf
</pre>
<p>This example uses a scaled version of the default alignment scores
(1:1:7:1 -&gt; 5:5:35:5).  The reason for this is to put them on roughly
the same scale as the fastq quality scores.</p>
<p>lastal uses the quality scores to modify the alignment scores, and
then rounds the modified scores to integers.  By using scaled
alignment scores, we reduce the information loss caused by rounding.</p>
</div>
<div class="section" id="very-short-reads">
<h2>Very short reads</h2>
<p>WARNING!  The standard score parameters do not align very short reads.
This is because the match score is 6 and the score threshold is 120,
so at least 20 high-quality matches are required (or a greater number
of low-quality matches).  In addition, last-split discards
low-confidence alignments.  To align very short reads, reduce lastal's
score threshold (-e) or increase last-split's error threshold (-m).</p>
<p>If the score threshold is too low, you will get meaningless, random
alignments.</p>
</div>
<div class="section" id="trading-speed-for-sensitivity">
<h2>Trading speed for sensitivity</h2>
<p>You can make LAST more sensitive, at the expense of speed, by
increasing lastal's m parameter.  The default value is 10.  So -m100
makes it more slow and sensitive, and -m1000 makes it much more slow
and sensitive.</p>
</div>
<div class="section" id="example-8-compare-the-cat-and-mouse-genomes">
<h2>Example 8: Compare the cat and mouse genomes</h2>
<p>If you have ~50 GB of memory and don't mind waiting a few days, this
is a good way to compare such genomes:</p>
<pre class="literal-block">
lastdb -c -uMAM8 mousedb mouse/chr*.fa
lastal -e40 -m100 mousedb cat/chr*.fa | last-split &gt; myalns.maf
</pre>
<p>This looks for a unique best alignment for each part of each cat
chromosome.  Omitting -m100 makes it faster but somewhat less
sensitive.  Omitting -uMAM8 reduces the memory use to ~10 GB and makes
it faster but considerably less sensitive.</p>
</div>
<div class="section" id="example-9-compare-the-human-and-chimp-genomes">
<h2>Example 9: Compare the human and chimp genomes</h2>
<p>For strongly similar genomes (e.g. 99% identity), something like this
is more appropriate:</p>
<pre class="literal-block">
lastdb -c -m1111110 human human.fa
lastal -q3 -e35 human chimp.fa | last-split &gt; myalns.maf
</pre>
</div>
<div class="section" id="going-faster-by-using-multiple-cpus">
<h2>Going faster by using multiple CPUs</h2>
<p>If you have more than one query sequence, you can go faster by
aligning them in parallel.  This can be done with parallel-fasta and
parallel-fastq (which accompany LAST, but require GNU parallel to be
installed: <a class="reference external" href="http://www.gnu.org/software/parallel/">http://www.gnu.org/software/parallel/</a>).  These commands
read sequence data, split it into blocks (with a whole number of
sequences per block), and run the blocks in parallel through any
command or pipeline you specify, using all your CPU cores.  Here are
some examples.</p>
<p>Instead of this:</p>
<pre class="literal-block">
lastal mydb queries.fa &gt; myalns.maf
</pre>
<p>try this:</p>
<pre class="literal-block">
parallel-fasta &quot;lastal mydb&quot; &lt; queries.fa &gt; myalns.maf
</pre>
<p>Instead of this:</p>
<pre class="literal-block">
lastal -Q1 -e120 db q.fastq | last-split &gt; out.maf
</pre>
<p>try this:</p>
<pre class="literal-block">
parallel-fastq &quot;lastal -Q1 -e120 db | last-split&quot; &lt; q.fastq &gt; out.maf
</pre>
<p>Instead of this:</p>
<pre class="literal-block">
zcat queries.fa.gz | lastal mydb &gt; myalns.maf
</pre>
<p>try this:</p>
<pre class="literal-block">
zcat queries.fa.gz | parallel-fasta &quot;lastal mydb&quot; &gt; myalns.maf
</pre>
<p>Notes:</p>
<ul class="simple">
<li>parallel-fasta and parallel-fastq simply execute GNU parallel with a
few options for fasta or fastq: you can specify other GNU parallel
options to control the number of simultaneous jobs, use remote
computers, get the output in the same order as the input, etc.</li>
<li>parallel-fastq assumes that each fastq record is 4 lines, so there
should be no line wrapping or blank lines.</li>
</ul>
</div>
<div class="section" id="example-10-ambiguity-of-alignment-columns">
<h2>Example 10: Ambiguity of alignment columns</h2>
<p>Consider this alignment:</p>
<pre class="literal-block">
TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
|||||||| ||||||  |  ||  | |  |    || ||||||   |||||||||||
TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG
</pre>
<p>The middle section has such weak similarity that its precise alignment
cannot be confidently inferred.</p>
<p>It is sometimes useful to estimate the ambiguity of each column in an
alignment.  We can do that using lastal option -j4:</p>
<pre class="literal-block">
lastdb -c humdb humanMito.fa
lastal -j4 humdb fuguMito.fa &gt; myalns.maf
</pre>
<p>The output looks like this:</p>
<pre class="literal-block">
a score=17
s seqX 0 57 + 57 TGAAGTTAAAGGTATATGAATTCCAATTCTTAACCCCCCTATTAAACGAATATCTTG
s seqY 0 51 + 51 TGAAGTTAGAGGTAT--GGTTTTGAGTAGT----CCTCCTATTTTTCGAATATCTTG
p                %*.14442011.(%##&quot;%$$$$###&quot;&quot;!!!&quot;&quot;&quot;&quot;&amp;'(*,340.,,.~~~~~~~~~~~
</pre>
<p>The &quot;p&quot; line indicates the probability that each column is wrongly
aligned, using a compact code (the same as fastq-sanger format):</p>
<blockquote>
<table border="1" class="docutils">
<colgroup>
<col width="13%" />
<col width="37%" />
<col width="13%" />
<col width="37%" />
</colgroup>
<tbody valign="top">
<tr><td>Symbol</td>
<td>Error probability</td>
<td>Symbol</td>
<td>Error probability</td>
</tr>
<tr><td><tt class="docutils literal">!</tt></td>
<td>0.79 -- 1</td>
<td><tt class="docutils literal">0</tt></td>
<td>0.025 -- 0.032</td>
</tr>
<tr><td><tt class="docutils literal">&quot;</tt></td>
<td>0.63 -- 0.79</td>
<td><tt class="docutils literal">1</tt></td>
<td>0.02  -- 0.025</td>
</tr>
<tr><td><tt class="docutils literal">#</tt></td>
<td>0.5  -- 0.63</td>
<td><tt class="docutils literal">2</tt></td>
<td>0.016 -- 0.02</td>
</tr>
<tr><td><tt class="docutils literal">$</tt></td>
<td>0.4  -- 0.5</td>
<td><tt class="docutils literal">3</tt></td>
<td>0.013 -- 0.016</td>
</tr>
<tr><td><tt class="docutils literal">%</tt></td>
<td>0.32 -- 0.4</td>
<td><tt class="docutils literal">4</tt></td>
<td>0.01  -- 0.013</td>
</tr>
<tr><td><tt class="docutils literal">&amp;</tt></td>
<td>0.25 -- 0.32</td>
<td><tt class="docutils literal">5</tt></td>
<td>0.0079 -- 0.01</td>
</tr>
<tr><td><tt class="docutils literal">'</tt></td>
<td>0.2  -- 0.25</td>
<td><tt class="docutils literal">6</tt></td>
<td>0.0063 -- 0.0079</td>
</tr>
<tr><td><tt class="docutils literal">(</tt></td>
<td>0.16 -- 0.2</td>
<td><tt class="docutils literal">7</tt></td>
<td>0.005  -- 0.0063</td>
</tr>
<tr><td><tt class="docutils literal">)</tt></td>
<td>0.13 -- 0.16</td>
<td><tt class="docutils literal">8</tt></td>
<td>0.004  -- 0.005</td>
</tr>
<tr><td><tt class="docutils literal">*</tt></td>
<td>0.1  -- 0.13</td>
<td><tt class="docutils literal">9</tt></td>
<td>0.0032 -- 0.004</td>
</tr>
<tr><td><tt class="docutils literal">+</tt></td>
<td>0.079 -- 0.1</td>
<td><tt class="docutils literal">:</tt></td>
<td>0.0025 -- 0.0032</td>
</tr>
<tr><td><tt class="docutils literal">,</tt></td>
<td>0.063 -- 0.079</td>
<td><tt class="docutils literal">;</tt></td>
<td>0.002  -- 0.0025</td>
</tr>
<tr><td><tt class="docutils literal">-</tt></td>
<td>0.05  -- 0.063</td>
<td><tt class="docutils literal">&lt;</tt></td>
<td>0.0016 -- 0.002</td>
</tr>
<tr><td><tt class="docutils literal">.</tt></td>
<td>0.04  -- 0.05</td>
<td><tt class="docutils literal">=</tt></td>
<td>0.0013 -- 0.0016</td>
</tr>
<tr><td><tt class="docutils literal">/</tt></td>
<td>0.032 -- 0.04</td>
<td><tt class="docutils literal">&gt;</tt></td>
<td>0.001  -- 0.0013</td>
</tr>
</tbody>
</table>
</blockquote>
<p>Note that each alignment is grown from a &quot;core&quot; region, and the
ambiguity estimates assume that the core is correctly aligned.  The
core is indicated by &quot;~&quot; symbols, and it contains exact matches only.</p>
<p>LAST has options to find alignments with optimal column probabilities,
instead of optimal score: see <a class="reference external" href="lastal.txt">lastal.txt</a>.</p>
</div>
</div>
</body>
</html>