File: primer_designer

package info (click to toggle)
libbio-primerdesigner-perl 0.07-3
  • links: PTS, VCS
  • area: main
  • in suites: jessie, jessie-kfreebsd
  • size: 252 kB
  • ctags: 69
  • sloc: perl: 1,378; makefile: 84
file content (223 lines) | stat: -rwxr-xr-x 17,725 bytes parent folder | download | duplicates (5)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
#!/usr/local/bin/perl

# $Id: primer_designer 10 2008-11-06 22:51:00Z kyclark $

use strict;
use warnings;
use Bio::PrimerDesigner;
use Getopt::Long;
use Pod::Usage;

$| = 1;

my ( $program, $num_primers, $binary_path, $method, $url, $list_aliases, 
    $list_params, $list_designers, $show_help );

GetOptions(
    'd|designer:s'   => \$program,
    'n|number:i'     => \$num_primers,
    'b|binary:s'     => \$binary_path,
    'm|method:s'     => \$method,
    'u|url:s'        => \$url,
    'list-aliases'   => \$list_aliases,
    'list-params'    => \$list_params,
    'h|help'         => \$show_help,
) or pod2usage(2);

pod2usage({ -exitval => 1 }) if $show_help;

#
# Create Bio::PrimerDesigner object.
#
my $pd          =  Bio::PrimerDesigner->new( 
    program     => $program,
    method      => $method,
    url         => $url,
    binary_path => $binary_path,
) or die Bio::PrimerDesigner->error;

#
# List paramaters to primer design program.
#
if ( $list_params ) {
    my $title = $program . ' Parameters:';
    print join "\n", $title, '-' x length $title, $pd->list_params, '';
    print "\n";
}
  
#
# List aliased keys to primer design program and exit.
#
if ( $list_aliases ) {
    my %alias_list = ( $pd->list_aliases );

    my $longest = 0;
    for my $length ( map { length $_ } keys %alias_list ) {
        $longest = $length if $length > $longest;
    }

    my @aliases;
    for my $key ( sort keys %alias_list ) {
        my $length = length $key;
        my $space  = ' ' x ( $longest - $length + 5 );
        push @aliases, "$key$space$alias_list{$key}";
    }

    my $header = 'Primer3 Parameter';
    my $space  = ' ' x ( $longest - length( $header ) + 5 );
    my $title  = "$header${space}Bio::PrimerDesigner Alias";
    unshift @aliases, $title, '-' x length $title;

    print join "\n", @aliases, '';
    exit;
}

#
# Get the DNA sequence from somewhere.
#
chomp (my $dna = <DATA>);

$num_primers ||= 5;
my $length    = length $dna;
my $seqID     = "C02D5.1";

#
# Define Bio::PrimerDesigner parameters
# in this case I use aliased keys
# the primer3 Boulder IO keys are also valid
#
my %params    = (
    num       => $num_primers, 
    seq       => $dna,  
    sizerange => '500-600',                      
    target    => '5001,200',                     
    excluded  => '1,4500 5500,'.($length-5500-1),
    id        => $seqID                          
);

#
# Design the primers.
#
my $result = $pd->design( %params );

#
# Did it work? 
#
die ("Some sort of primer3 error\n", $result->raw_output)
    unless $result && $result->left; 

#
# Initialize e-PCR object
#
$method   ||= 'local';
my $epcr    = Bio::PrimerDesigner->new( 
    program => 'epcr', 
    method  => $method
) or die Bio::PrimerDesigner->error;

#                                                                               
# List paramaters for epcr program and exit.
#
if ( $list_params ) {
    my $title = 'e-PCR Parameters:';
    print join "\n", $title, '-' x length $title, 
                     $epcr->list_params, '';
    exit;
}

my $header = "Primers designed using $method primer3/e-PCR"
            ." installation";
my $hline = '-' x length $header;

print "\n$hline\n$header\n$hline\n\nPrimer",
      (" " x 14), "\tF/R\t5' Coord  Pair-qual\n";

for ( 1 .. $num_primers ) {
    my %params = ( seq => $dna,
                   left => $result->left($_),
           right => $result->right($_),
                   permute => 1
         );
         
    my $epcr_result = $epcr->design( %params )
      or die $epcr->error;
    
    print 
        "Set $_\n", $result->left($_),
        "\t F \t", $result->startleft($_), 
        "\n", $result->right($_),
        "\t R \t", $result->startright($_),
        "\t", $result->qual($_)."\n",
        "\ne-PCR products: ", $epcr_result->products, "\n";
         
    for my $prod ( 1 .. $epcr_result->products ) {
        printf "product %s: start->%s end->%s size->%s bp\n\n",
            $prod,
            $epcr_result->start($prod), 
            $epcr_result->stop($prod), 
            $epcr_result->size($prod),
        ;
    }
}

# ----------------------------------------------------

=pod

=head1 NAME 

primer_designer.pl -- command-line interface Bio::PrimerDesigner

=head1 SYNOPSIS

    ./primer_designer.pl [options] [dna_sequence or file]

  Options:

  -p|--program   Program (default "primer3")
  -n|--number    Number of primer sets to return (default "5")
  -b|--binary    Path to binary executable (default "/usr/local/bin")
  -m|--method    "local" or "remote" (default "local")
  -u|--url       URL of remote primer3/e-PCR system (default 
                   "aceserver.biotech.ubc.ca/cgi-bin/primer_designer.cgi")
  --list-aliases Print alias list to primer3 input options and exit
  --list-params  Print a list of primer3/e-PCR input options and exit
  -h|--help      Print help and exit

=head1 DESCRIPTION

This script tests/demonstrates the Bio::PrimerDesigner interface to
primer3 and e-PCR.  It can be used with a local installation of the
unix binaries or remotely via an HTTP/CGI request.

=cut

=head1 AUTHOR

Copyright (C) 2003-2009 Sheldon McKay E<lt>mckays@cshl.eduE<gt>,
Ken Youens-Clark E<lt>kclark@cpan.orgE<gt>.

=head1 SEE ALSO

Bio::PrimerDesigner.

=head1 LICENSE

This program is free software; you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation; version 3 or any later version.

This program is distributed in the hope that it will be useful, but
WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU
General Public License for more details.

You should have received a copy of the GNU General Public License
along with this program; if not, write to the Free Software
Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301
USA.

=cut

__DATA__
cagagttaaagagaaaactgataattttttttccatctttctcctcacttgtgaataaactaaacgcatttctgtggacgttccaagtgtaatatgagagttgttttcatttggaaatgcgggaatatattgaatcttccattagatgttcaggaatatataaatacgttgtctgctctgaaaattcacacggaaaatctaaaaattgtcaaattatagatttcattctcaaatgactatataacattttatttttgcaatttcttttcaattaggaaacatttcaaaaagctacgttgtttttcacattcaaaatgattactgtcggtgcgttcattttccgagtttttccaatttcacgcttgctcttcttcgtaaaaaactcgtaatttagaaattgtgtctagatcaaaaaaaaaattttctgagcaatcctgaatcaggcatgctctctaaacaactctcagatatctgagatatgggaagcaaattttgagaccttactagttataaaaatcattaaaaatcaacgccgacagtttctcacagaaacttaaaccgaaaaatcccaacgaagacttcagctcttttttctttgaaatttgagacaaaggcccgttctattgtctttccgactcacatcgttcattaataaatcgttctttcttctacttcattcatcaatttcctcttgaccagagagagtccctactcttgaagctcctcttctttactcttttcttacttacgcacaaaaagtctctctatcactgcgtctctctatccatctcttctacatgtcacttgtcgtctctgcgcctctataacacgtaacaatctctaccttcaagttctctagtcacctgtcttcgtctataccttttgccacgaaaattactacgtagaagctgtcctattgtaaagatgaaacagtttgaagagaaattggatgattgtgatctattggtctcagaatttgatggatttcttttccatgttttcaattttaacgtctatattcttacctaggtactcataattttaactttgtttatatttttataaacttataagttacaatttttaaatcagttaacaacttcctataatcaaattgtattctattttttttggcacaaacacatataaatgtccaaatatttgcgcacgagtcacccctctccactcatttgccgcccaattttgacgttttcttccttgcacattttgacagcatttctaatttcaggaaattcttcatatatcaattggtcagtcacaattatcctcctcattcttggactttacgcctgtcatcgatttttgaacatgaagaagttgactcgagatgcacaggaaccacttttacgtgagtttttaaagattttttttttgaaaattgatgtcttgcattttatttagctcactggatagtagaaaaaatattttttttatctatttgaaaatcaaatgtgttaaaaaaatatttttggagaaaaataactgaaagctcctttctgaattattgttttattattaaacatttgttttcttctaactttatgttttttaatgttttttttttactttttaaatcctgaattattttgtgaaaattcaaacagtttcatttttaaaatttcaaaccctgataaaaagttcaatatttttcactgaactttaatttttttaaaagtttatgaaaatttcctatgaaattaagttcagaagttttttagctcatatccgcccctccacaaggaataaaattcgaaaatatatttatggaactatttttattttatcaatttttctcctttatcgatcactgaacagtccagacacatcaaaacacggaattggcagaaatggagatgtaagttttgagatttattgcaacaaataatttacaaaataatttcagtttattgaatatgagccaaaagcaggacccacgataaaagagcctgtagagaatatagttaaattggacgtttatatggaagcacagtgtccggatacatctaggtgagcagttagtaattaaattaatttaatatttgatttattttaagatttttccgtcaacaacttaaaaaagcgtgggatattctaggaaggctaaatcgaatcgaattgaatgtaattccatttggaaaagcgaggtgtacagagaaaggaaacgatttcgagtgagttttttttgttaattgattttaaatctgatcataaaatattgcagatgtcaatgtcagcatggtccgacagaatgtcagattaatcaattaatgaattgtgtcattgatcgatttgggtttccacatagatatttgccaggtgttttgtgtatgcagggaaaatattcattagatgaggcaatgaaatgtgttactgagaattatccatctgaatatgaaaggtatgtattttgtgccgtaaatgcatagttagaccaacgaatactttttaaaatcatacgaaatatattttcatatattatcactgaatataatagttaatgaaagagtaatgctcatttttcagttcaactttatttttcaaagaatattgaattttagaatgcgtgaatgtgcatcaggaactcgaggtcgccgccttcttgctctttccggacagaaaactgcatcactaactccagcaattgacttcattccctggattgttattaatggttcacgtaactcggatgctctttatgatctaacacagaatgtctgtgaagcaatgcaaccaatgccatctgcatgcaaagattacttacgttcattacaataatcacatcttttacgggttgacttttcgtcttatagttttttttaaaatacaattggtgtctatctatgagtgcctttcacaactcggcgggtcctaaaattgtttattatatttatttaaatttttgttgtagtttgtgttagtgtgactaacttattgtgttaattttcttaaaaagaacgttttttattaaaataaaaagttgcaaattgtaaaagtttgtgtttatcacattatgatattttgggcaattgtgaggatctattaaaaatttataaatctctttgacagtgtgtgggaaaaataagttatttttagcttctgatattttctaggattaacagaaaaaacagcaaatttcaggtatacccgcttgccagttcgtgatcaactccagtgttttccaaaaaaacaaatctacccttccccagcttcagatgttacaaactcgataaaatttgtttcagaaacatctcttcagtgtgaccacaaactagtctttcgcttccttttaacaacaaaaaatggaaaaagaaggagggatttacaagaggctacgacgatacgaatgaatgaaaacgatttgatgcaatcagctgctgcttctgcatttgccattcaatttgtcacctttctgccaaatttacacgatctgttttgagtgtggactttttgaaagtttaaaccacttttcgtcaatttttaaatgatgtttttacttcagtttttattattttgttttgcaaaaaatatttcagtatgcctgcattttttaaatatttaaagtttgattttttttaacatccaagtagaaatgatagctcacctactccaactaaattttgaccaacaactgtcacttctatatttgaagacataattaacataaatcttgaatttttgaagtaattttaatgtctgaacatcttgttttgaatcttgtttttttgccgaaaaatttgaagaaaaaagaaactgaaatattgcaaacatcgccagaatgcagacggtagggttgaataagatagagggcattgaaccctttctaattttctgttttgcaaattattttacagtaggtctgaacttcacagtttcatggtacgcccaatttttaacttcttttttgaattcaaattttctaaactacattatcgatttccatgaaaacagttgcattaacttcctctgaccattccaagaatttctggcttaccaaccgacatcactcttgccccctcgtcattaagccgtaattgatagcgacaaaaaaaaagaaaagccggctattttaatcgaatcttcttcatttgagaatggagggtgctacttgaatgggtgacaattgactcgtgaaattcttctttatcttttctccttatttttctcagaatttcttcatcatccacttttttggagtttcaaatgttaattgcaatctgtctcattttggtagtcatttggaaaacacgggggaggcgataacaggaagcttaagggatagacatacacttgcaattgtcgaaaaagcgatatctttaacgattattacgattctttcagtgtgacgtaatcctaatcagtttatttttattttttctgaaagcttcttttacgaattgcgcaattaatagtgtcagtagaaaaggcataatttttgaagaatatgccaaaatatgtaaaccctctccgttaatagcagtagctagtgatctagactatatgcaatacacactagttgtccaattgaaacaggtatccacaatattcacgatttttgaagtgtgatgtattagataatcctatcattttttcctcatcggccagtactttttttgttgttatttttgcaatatcctccgctttttattgttttcctattcacacctgtatttgattctggtttcccaaaaagaacaggcatagtttttgcgttgggaactggttttatttcagcatatcttctcatttctcaaccagaattagaaacatttttagaacaatcacatttatagcctaaatttttactaaaaatatctgaaaaacatgatatacactttgtagaatttttgaaaataatatccgcctatccatgatttaaccttattattcgaaatctgtgagattcctcaaagtagaaacataaaatttcaggcacaacacaaaagtcggaactcaattaaaatcgaataccctgtttgagatggcgtttctggctcgtaaaacgtcttctctcctaccagccaccacatcctctacagtcaagcatatgatctacgatgaaccacattttgcaatgcagaacagtttggcaaaacttatcaaagagaaaataaacccaaatgttgcacaatgggaaaagagtggaagatatccagcacattttgtgttcaaaatgcttggacaacttggagtatttgcggtgaataagcctgtaggtgaggatacttattttaaagaaaaaattttggaagttgaaaattattgaagactatggtgggactggtcgagattttgcaatgtcaatagcaatagctgaacaaattggagcagttgattgtggatcgattccaatgtcagtcatggttcaaagtgacatgagtactcctgctcttgcacaatttggtgagttctataaaacttatactgtaacttaattgatatatcaggctccgattcactccgcaatcgctttcttcgtccttcaatcaatggtgatctagttagttcaattgcagtctccgaaccacatgcaggatcagatgtatccgcaattcgcacacatgcccgtcggtacggcagcgacttgataataaatggctcaaaaatgtggataacaaatggagatcaggcagattgggcatgtgttctagtaaatacttcaaatgcgaaaaatttgcacaaaaataagtcgctggtgtgtattccactggactcaattggtgtacatcgatcaactccgttggataaattaggaatgagaagctccgatacagttcaactattttttgaagatgttagggtgagtttcttaaaatgatctacggcccctttaaccaattttaataaataattcaatgttcatttcaatcgaatcatttttcaggttccctcgtcatacataataggcgaagaaggacgtggatttgcatatcaaatgaatcaattcaatgatgagcgccttgtaacagttgctgttgggcttctcccacttcaaaaatgtataaatgagacgattgagtatgcaagagaacgattaatatttggaaagacacttctcgatcagcaatatgttcaatttcggttagccgagttggaggctgaactggaggcaacccgttctttgctctatcgaacagtgctggcacgttgccaaggcgaggatgtgagcatgttgactgcgatggcgaaattgaaaattggaagactggcaagaaaagttactgatcagtgtctacaggtgaggcgtttttgttctaaaatatacaaaaaattctcaaaatatgtatataaatcacttgtaatattctccatattagacttgaatattccttgctcttctttgtcagattatatctcggttgtatttgtttttatgaaaacaaaattgccaactaacaaaatttgtgcaaaataatttgctttattttggatgttgaactttttttgatgaaattaagacaaccgagatataaacagtcaaagtatagcaatgcaaggataattcggtatatgtttttgtgatccctccagtggcagtttttcataacttgatggtttttttatagaaatgaattggaataacgctaaagcttcattattaatattctcttaatttcagatctggggaggtgctggatatctgaatgacaatggaatatcgagagccttcagagatttccgtatattttcgattggcgctggttgcgatgaagttatgatgcagattattcataaaacacagtccaaaaggcaacagaaaagaatttgagaacatttttaaatgttatatttgtaaatacgaaaataaaatgcaattgtactgaaaacgataaaaataaaacagcgaaaaagtcatattgtatagaatttggcacgtatatctacaaccagtttctagtgacccaggtatcttgaagtaagtattcaatgaatcaattcaagttattatatttatatttgtccgcatcggaaggaaagcgcaaagaagtttctctctccgcctcatcaaattttttgtgtttgcatttcaaaaatgactgcaatgaaacgcgaattactgcgagtaagtaaagttagttttgatagaaactactgtatgagaaaaccggttgaaaagtaaagatgagcagcagtatttcatggaaaaaagagggagacaacaagagacggagtatataaggtgtcatggatgctccgagagtgtttacttctttgtttcaattttcacacttttcattcttttcattctttttgtttttcacaattatttagcagatcggtaactttttgctttgataatttcatagatactttcgaatcgaaattaattttcaaattagcctacagtaattttgctctcatctctgagttctagatcatgtttcaatttaccgaaagtgtttacacaagttaccaagaaaacaaaaaattcaagtttccgaaaattatcaaatgtttatcaaaaaggtcctatgatgtttaaaacaatttttcaaacttccagaaaaattttaacttactgtttcttgagcgtttacagtaactccggtgtttccagtaggcatagcttaccttgaaagcaggcaggcgaaaatttctctagaccaaccagaataacttactttattgctaagttgaatcaaacaattttgtaaaaaaaacgaattttggaatcatgatccctattcaagcttctagttgctggtcagctaggttttgggtttttttttggaaaaatattcaaaaaacatttatataatagttagaattaacattttttgataaaacctcgacatttttgttttgtctgaaaaaataggaaaatcttacgtttttcgaaaaaacccgtgctcgtgaaaagtatgtcctctgagagaagtaatgtttcatctgaccagttgcaactttctgtgtgcacattcttttgataaaatggtatcacagatctattctaaaagccaacatctaaattctttgctctatctttatcagttgatacggatcttctcatctcattcgcccacaatcttcccatactaattcatcaaacccacttgtaaatatacgcgcggttgatcaaaatttgtgtgtgttatggcacattgtgcaaatagttttaccacacttacatacttcaactcaaacctttgaggagtttgacagagagatggaaagatagtctgcaaacggcagatttttgaagtttcaccgctgtccatctaattttaggtatttttcggaatcttttgcaggacgttatcatctatctttcccgttatcaattagtcataattatccaattagtggcagttgttagaagaaataggtaatatgcataatagtgtcatttgccattggccacctccaccaaactttcgattatgccgttttccgttttctgtgtgtttcttcgtccttcctcatcatttctcattcgcttttttttcttcccatcttttccaacatgtcgcactaagagtgaccaaaaaacctttcaaattttgcgtgttctttcggtctttccggaagggacaaaaatcaaaacgacactggaattatgaactcatccattttccactttaaaagttgaaaaaagtaaacagcggggttattgtggtttgatctcttttaaaaatcagttaaatataggagtcaagacctcaatgagcactcttcaagatatggttctactagactcaacttgaagattttcaagagttctggagactttttcaaggctactgctttcaagcttcagaattttaaacattttggaaataatcttaaactggagttcaatagccaattgagcaatttgttataacgtttttttcttaattttttaaattagaatcagtgtaaatttataagtttcaaaattagttttgcacttatctttgggcgttactgaattttttacgtggtgaaccttgagaaaaaattctaaggcttctaattgagaaaactaatttaaattccgctcccaggagttaccaattttaatacgtttccaaaaaattaaatattcttcgaatctcatttttaaagtttccatttggcacaaaccacaataatttaagtaagacgtttgatctatgccgtagtttgtgtacttcaacgtttatccttaagtacctaggcccgtgtttttacagctctgctctttatcggtacatactgttctctgtctttattgatagaaattttgaaaaatgcaacaatatggtatctatcaggtcgtcccataagtttttgtacttttttaaaactttttgaacaagttctaaactgacagaacaaaatcgaatcttttataaatgcgcatgtatagtatgtactacttgtcaaaatttttatgcgttatttcaatatcctcctgataacaatcacggaaaccagagccacaaatagcgacatacccaaataatgggaggtgttttccttcgtcctgctattcacagggaatttatcaatgaacatgaaaacatagtattagtaaagataatgattcaaaatacatgttcagtatggttaaaattatcattagcacttattagccgttttggacgtggactatttggctcatgtttatcaagcactgagtgaacatcttcatggaataatttctcactaaaagtgatgggattattttgattgttgtttctaattttatataacaatacttgcatagtacaaatacaaacttcgttttacttgctgatttctcaatcataaattagaagcccaacactataaatgtcgggtatcacatgaggttggccatgtagattgtttgaacgaagaggccaccagtaaagtttgttaatttatttatgatacatatatccacttctaaataacactagacttaattatctatctttcattccgaggactaaatggaccaatatatgcttcaatcactcctataggcaattgttaaaagtacaaaatagtgtggttacaatgttctcaattataacatctccccatgactgaaaaaattaaatttttttaaaattttgactgcacatgatgtgcacttatcgtaaacatacacgatgcacccgttccattcccagcggcttcacaggaatcaaaaactcgggcgccatatttaattggcctcaacaattgtgtttagctacagtagtttttccggaatagttatactaaatttaaaattatttaaaacaagagtgtggaagcatctacttgacagtatatattaaccattactttaagctctgggtggtgtagaacaaactccagaaggaatggtgtaaaaagctgattctatagttactcgtttttctaaacaaccgcgggggcctgggatgccagagttatgttgcaataaggtgacaagttggtgacatgctaccactaatataaaatcttagaattgtccgaaaaagttttgggaataattcgaaaaaaagtacaaaaacttatgggacgacctgataggatatatgttaaaaactatttttgaaaaaatattttattttgaacaatgaaataaggttcctgcctcaaggtttctttttgacgcgaactccgatgacattttaattatcaaacggtctaagtgaaaatttattggacaactctttagttgaagtgcactttaggagcaggcatacatgaaggcgtgaggcaggcgtaggtcgcttacgaggcagacaatttttaaaaaaatcaccatccttttgtactaataaacactctctaaaagtttgcaatgttgtctcccaacacgaaaagttcaatcaacttctgcactcaatttttttgcaagatgacccatttgattcaagggggttaccagtagacttacctgcaaaaaaacagtattcgtgcataaatccatcaaaatgaagtgtgcgtcttcttcttagtttccgtctcccgttgtttcttaatgtatacagaagatgtacggggcagcagcagcagaaaaaagatttgcgtacaccaaacacatcaaaacgatatgcgtgaaatgagcgaatcgtccgcattctccccttttttctttcaattttcaaggagagagaaaactctgtgagacagtgaagaagtggggttttgactggaaaagaagaagaagaagaagaagaagaagaagaagaagaactgattcttatctgagttccgacgacgattccaccgttttttggtctggtcttctttcctccgcttcttcttcttctacttctcttttcacgtctttctcatatttggttgtttttcaagttttgaactctttctactacatacttttcacatgtacctttaaaaaactcataattcattttccaatgtgttgaaaactactgtaactgcttaaaagtcagaaacagtaacgaaactattttcatgataaaatcaaaaattgtttcgattcgaaaatgtttttatatactcgacatgtgtgtacatgtgtaaaccagtcgtttcaaaaattttacaaaaaaatgtaaagaaactgttcagtgatcagtatgctccagcttcttagtttcttagtttctaggacttcacacactgcctgccttcaaactaccgcctattaacatttattccggtcgctcttttgtatttattgaggaaatcaactactgtagttttttaaaaattaatttattgatttggcaatttttctttttttttcaagattcaaaaataagaaattgtattttactcaccattattcaaaaaacttgatgaaatgtttaaattttatggtaaatgatcaaaactaat