1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127
|
#nexus
begin taxa;
dimensions ntax=6;
taxlabels
'P. fimbriata'
'P. robusta'
'P. americana'
'P. myriophylla'
'P. polygama'
'P. macrophylla'
;
end;
[!
*************
* Standard *
*************
]
begin characters;
dimensions nchar=45;
format datatype=dna missing=? gap=-;
matrix
P._fimbriata acctcggcttaacgaacctcggcttaacgaacctcggcttaacga
P._robusta acctcggcttaaccaacctcggcttaacgaacctcggcttaacga
P._americana acgtcgctttca---acgtcgctttcaccaacgtcgctttcacca
P._myriophylla acgtcgctttca---acgtcgctttcaccaacgtc?ctttcacca
P._polygama acgtcgctctcaccaacgtcgctttcaccaacgtc?ctttcacca
P._macrophylla acgtcgctctcaccaacgtcgctttcaccaacgtcgctttcacca
;
end;
[!
**********
* Tokens *
**********
]
begin characters;
dimensions nchar=3;
charstatelabels
1 'leaf margins' / entire fimbriate,
2 'flower color' / 'white to cream' crimson,
3 'breeding system' / hermaphroditic gynomonoecious gynodioecious dioecious
;
format tokens;
matrix
P._fimbriata fimbriate crimson gynomonoecious
P._robusta fimbriate crimson gynomonoecious
P._americana entire white_to_cream hermaphroditic
P._myriophylla entire white_to_cream hermaphroditic
P._polygama entire white_to_cream dioecious
P._macrophylla entire crimson gynodioecious
;
end;
[!
***********
* Symbols *
***********
]
begin characters;
dimensions nchar=3;
charstatelabels
1 'leaf margins' / entire fimbriate,
2 'flower color' / 'white to cream' crimson,
3 'breeding system' / hermaphroditic gynomonoecious gynodioecious dioecious
;
format notokens symbols="0123";
matrix
P._fimbriata 111
P._robusta 111
P._americana 000
P._myriophylla 000
P._polygama 003
P._macrophylla 012
;
end;
[!
*****************************
* Interleaved, missing taxa *
*****************************
]
begin characters;
dimensions ntax=4 nchar=15;
format datatype=dna interleave;
matrix
P._fimbriata acctcggc
P._robusta acctcggc
P._americana acgtcgct
P._myriophylla acgtcgct
P._fimbriata ttaacga
P._robusta ttaacca
P._americana ctcacca
P._myriophylla ttcacca
;
end;
[!
****************
** transposed **
****************
]
begin characters;
dimensions nchar=15;
format datatype=dna transpose;
matrix
site_1 aaaaaa
site_2 cccccc
site_3 ccggcc
site_4 tttttt
site_5 cccccc
site_6 gggggg
site_7 ggcccc
site_8 cctttt
site_9 ttcttt
site_10 tttttt
site_11 aacccc
site_12 aaaaaa
site_13 cccccc
site_14 gcccgg
site_15 aaaaaa
;
end;
|