1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469
|
Content-Type: text/html; charset=ISO-8859-1
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">
<head>
<!-- site meta data -->
<meta http-equiv="content-type" content="text/html; charset=utf-8" />
<meta name="description" content="NeXML is a file format for encoding phyloinformatic data using XML." />
<meta name="keywords" content="NeXML, XML, NEXUS, phyloinformatics, phylogenetics, phylogenies, trees, dna, rna, nucleotide, standard, continuous, amino, acid, matrix, tree, network, data" />
<meta name="author" content="Rutger Vos" />
<meta name="robots" content="index,follow" />
<meta name="verify-v1" content="mYceuNu58e0c0TNJ/gJ2NO63bxeH1nu28sZ2rtzcLoM=" />
<!-- RSS feeds -->
<link
rel="alternate"
type="application/rss+xml"
title="nexml-discuss mailing list - RSS 2.0"
href="http://mailbucket.org/nexml_discuss.xml"/>
<link
rel="alternate"
type="application/rss+xml"
title="SourceForge project summary - RSS 2.0"
href="http://sourceforge.net/export/rss2_projsummary.php?group_id=209571"/>
<link
rel="alternate"
type="application/rss+xml"
title="Wiki changes - RSS 2.0"
href="https://www.nescent.org/wg/evoinfo/index.php?title=Future_Data_Exchange_Standard&action=history&feed=rss"/>
<link
rel="alternate"
type="application/rss+xml"
title="SVN revision history - RSS 2.0"
href=""/>
<title>FAIL</title>
<link rel="stylesheet" href="/nexml/html/include/style.css" type="text/css" />
<link rel="stylesheet" href="/nexml/html/include/schema.css" type="text/css" />
<style type="text/css">
<!--
/* inclusions for validation service */
li.debug {
list-style-image: url('/nexml/html/include/bug.png');
}
li.info {
list-style-image: url('/nexml/html/include/lightbulb.png');
}
li.warn {
list-style-image: url('/nexml/html/include/error.png');
}
li.error {
list-style-image: url('/nexml/html/include/exclamation.png');
}
li.fatal {
list-style-image: url('/nexml/html/include/bomb.png');
} -->
</style>
<script type="text/javascript" src="/nexml/html/include/functions.js"></script>
<script type="text/javascript" src="/nexml/html/include/schema.js"></script>
<link rel="shortcut icon" href="/nexml/html/include/cross.png" />
</head>
<body>
<!-- This heading is only here for text browsers without css -->
<h1 class="hide">FAIL</h1>
<div id="thetop">
<a id="top" name="top"></a>
<p class="hide">
Skip to:
<a href="#sitemenu" accesskey="2">Site menu</a> |
<a href="#maincontent" accesskey="3">Main content</a>
</p>
</div>
<div id="container">
<div id="main">
<!-- main banner in the top-left -->
<div id="logo">
<h1>
[<a href="/" accesskey="4">NeXML</a>]
</h1><span id="tagline">Rich phyloinformatic data</span>
</div>
<!-- site blurb in the top-middle -->
<div id="intro">
<h2>
<a id="maincontent" name="maincontent"></a>
The future data exchange standard is here!
</h2>
<p>
NeXML is an exchange standard for representing
phyloinformatic data — inspired by the commonly used
NEXUS format, but more robust and easier to process.
</p>
</div>
<div class="clear"></div>
<!-- validate form -->
<div id="validateDiv">
<form
action="/nexml/validator"
enctype="multipart/form-data"
method="post"
id="validateForm">
<fieldset id="validateFieldset">
<legend class="hide">Process nexml data</legend>
<select id="validateSelect">
<option value="validator.cgi">validate</option>
<option value="nex2xml.cgi">nexus -> nexml</option>
<option value="newick2xml.cgi">newick -> nexml</option>
<option value="xml2json.cgi">nexml -> json</option>
<option value="xml2rdf.cgi">nexml -> rdf</option>
</select>
<input type="file" name="file" id="validateUpload"/>
<input type="button" onclick="submitForm()" id="validateSubmit" value="Submit"/>
</fieldset>
</form>
</div>
<!-- main heading of this page -->
<h3 class="headerstyle">FAIL</h3>
<!-- http://www.nexml.org/nexml/nex2xml -->
<div style="padding-bottom:1em;margin-top: 1em; margin-left: 10px;color: #888888">
<small>
<a href="/">~</a> /
<a href="/nexml">nexml</a> /
nex2xml </small>
</div>
<div class="linkshare credit">
<a rel="nofollow" href="http://digg.com/submit?phase=2&url=http://www.nexml.org/nexml/nex2xml">
<img class="icon" src="/nexml/html/include/digg.gif" alt="digg"/>
</a>
<a rel="nofollow" href="http://reddit.com/submit?url=http://www.nexml.org/nexml/nex2xml">
<img class="icon" src="/nexml/html/include/reddit.gif" alt="reddit"/>
</a>
<a rel="nofollow" href="http://del.icio.us/post?url=http://www.nexml.org/nexml/nex2xml">
<img class="icon" src="/nexml/html/include/delicious.gif" alt="del.icio.us"/>
</a>
<a rel="nofollow" href="http://www.facebook.com/share.php?u=http://www.nexml.org/nexml/nex2xml">
<img class="icon" src="/nexml/html/include/facebook.gif" alt="facebook"/>
</a>
<small> | Last updated: Thu Aug 25 05:35:56 EDT 2011
—</small>
</div>
<h3 class="plain">Detailed results</h3>
<p>
Below are the messages received from the parsing and validation operations (if any). They
are organized as debugging messages (<img class="icon" src="/nexml/html/include/bug.png"/>),
informational (<img class="icon" src="/nexml/html/include/lightbulb.png"/>),
warnings (<img class="icon" src="/nexml/html/include/error.png"/>), errors
(<img class="icon" src="/nexml/html/include/exclamation.png"/>) and fatal
exceptions (<img class="icon" src="/nexml/html/include/bomb.png"/>):
</p>
<ul>
<li class="info validator">
going to parse nexus data </li>
<li class="info validator">
going to split nexus data on lines </li>
<li class="info validator">
going to split lines on tokens </li>
<li class="info validator">
going to split non-quoted/commented fragments on whitespace </li>
<li class="info validator">
tokenized and split data, going to parse blocks </li>
<li class="info validator">
found nexus token </li>
<li class="info validator">
starting taxa block </li>
<li class="info validator">
number of taxa: 6 </li>
<li class="info validator">
starting taxlabels </li>
<li class="info validator">
starting characters block </li>
<li class="info validator">
number of characters: 45 </li>
<li class="info validator">
datatype: dna </li>
<li class="info validator">
missing character: ? </li>
<li class="info validator">
gap character: - </li>
<li class="info validator">
block has title 'dna_forty_five' </li>
<li class="info validator">
charlabels: labone labtwo labthree labfour labfive labsix labseven </li>
<li class="info validator">
adding matrix metadata </li>
<li class="fatal validator">
Can't call method "set_name" on an undefined value at perl/lib/Bio/Phylo/Matrices/Matrix.pm line 431, <DATA> line 1.
</li>
</ul>
<h3 class="plain">Submitted contents</h3>
<p>
Below are the contents (if any) that were submitted to this query:
</p>
<div style="width:470px;overflow:auto;margin-left:2em;padding-bottom:1em">
<a name="line1"></a>
<div title="1" style="white-space:pre;font-family:courier"><span style="color:silver">1</span> #nexus
</div>
<a name="line2"></a>
<div title="2" style="white-space:pre;font-family:courier"><span style="color:silver">2</span>
</div>
<a name="line3"></a>
<div title="3" style="white-space:pre;font-family:courier"><span style="color:silver">3</span> begin taxa;
</div>
<a name="line4"></a>
<div title="4" style="white-space:pre;font-family:courier"><span style="color:silver">4</span> dimensions ntax=6;
</div>
<a name="line5"></a>
<div title="5" style="white-space:pre;font-family:courier"><span style="color:silver">5</span> taxlabels
</div>
<a name="line6"></a>
<div title="6" style="white-space:pre;font-family:courier"><span style="color:silver">6</span> 'P. fimbriata'
</div>
<a name="line7"></a>
<div title="7" style="white-space:pre;font-family:courier"><span style="color:silver">7</span> 'P. robusta'
</div>
<a name="line8"></a>
<div title="8" style="white-space:pre;font-family:courier"><span style="color:silver">8</span> 'P. americana'
</div>
<a name="line9"></a>
<div title="9" style="white-space:pre;font-family:courier"><span style="color:silver">9</span> 'P. myriophylla'
</div>
<a name="line10"></a>
<div title="10" style="white-space:pre;font-family:courier"><span style="color:silver">10</span> 'P. polygama'
</div>
<a name="line11"></a>
<div title="11" style="white-space:pre;font-family:courier"><span style="color:silver">11</span> 'P. macrophylla'
</div>
<a name="line12"></a>
<div title="12" style="white-space:pre;font-family:courier"><span style="color:silver">12</span> ;
</div>
<a name="line13"></a>
<div title="13" style="white-space:pre;font-family:courier"><span style="color:silver">13</span> blockid bogus;
</div>
<a name="line14"></a>
<div title="14" style="white-space:pre;font-family:courier"><span style="color:silver">14</span> end;
</div>
<a name="line15"></a>
<div title="15" style="white-space:pre;font-family:courier"><span style="color:silver">15</span>
</div>
<a name="line16"></a>
<div title="16" style="white-space:pre;font-family:courier"><span style="color:silver">16</span> [!
</div>
<a name="line17"></a>
<div title="17" style="white-space:pre;font-family:courier"><span style="color:silver">17</span> *************
</div>
<a name="line18"></a>
<div title="18" style="white-space:pre;font-family:courier"><span style="color:silver">18</span> * dna *
</div>
<a name="line19"></a>
<div title="19" style="white-space:pre;font-family:courier"><span style="color:silver">19</span> *************
</div>
<a name="line20"></a>
<div title="20" style="white-space:pre;font-family:courier"><span style="color:silver">20</span> ]
</div>
<a name="line21"></a>
<div title="21" style="white-space:pre;font-family:courier"><span style="color:silver">21</span> begin characters;
</div>
<a name="line22"></a>
<div title="22" style="white-space:pre;font-family:courier"><span style="color:silver">22</span> dimensions nchar=45;
</div>
<a name="line23"></a>
<div title="23" style="white-space:pre;font-family:courier"><span style="color:silver">23</span> format datatype=dna missing=? gap=-;
</div>
<a name="line24"></a>
<div title="24" style="white-space:pre;font-family:courier"><span style="color:silver">24</span> title dna_forty_five;
</div>
<a name="line25"></a>
<div title="25" style="white-space:pre;font-family:courier"><span style="color:silver">25</span> CHARLABELS labone labtwo labthree labfour labfive labsix labseven;
</div>
<a name="line26"></a>
<div title="26" style="white-space:pre;font-family:courier"><span style="color:silver">26</span>
</div>
<a name="line27"></a>
<div title="27" style="white-space:pre;font-family:courier"><span style="color:silver">27</span> matrix
</div>
<a name="line28"></a>
<div title="28" style="white-space:pre;font-family:courier"><span style="color:silver">28</span> P._fimbriata {a, G}cctcggcttaacgaacctcggcttaacgaacctcggcttaacga
</div>
<a name="line29"></a>
<div title="29" style="white-space:pre;font-family:courier"><span style="color:silver">29</span> P._robusta (a, , C)cctcggcttaaccaacctcggcttaacgaacctcggcttaacga
</div>
<a name="line30"></a>
<div title="30" style="white-space:pre;font-family:courier"><span style="color:silver">30</span> P._americana rcgtcgctttca---acgtcgctttcaccaacgtcgctttcacca
</div>
<a name="line31"></a>
<div title="31" style="white-space:pre;font-family:courier"><span style="color:silver">31</span> P._myriophylla acgtcgctttca---acgtcgctttcaccaacgtc?ctttcacca
</div>
<a name="line32"></a>
<div title="32" style="white-space:pre;font-family:courier"><span style="color:silver">32</span> P._polygama acgtcgctctcaccaacgtcgctttcaccaacgtc?ctttcacca
</div>
<a name="line33"></a>
<div title="33" style="white-space:pre;font-family:courier"><span style="color:silver">33</span> P._macrophylla acgtcgctctcaccaacgtcgctttcaccaacgtcgctttcacca
</div>
<a name="line34"></a>
<div title="34" style="white-space:pre;font-family:courier"><span style="color:silver">34</span> ;
</div>
<a name="line35"></a>
<div title="35" style="white-space:pre;font-family:courier"><span style="color:silver">35</span> end;
</div>
<a name="line36"></a>
<div title="36" style="white-space:pre;font-family:courier"><span style="color:silver">36</span> BEGIN SETS;
</div>
<a name="line37"></a>
<div title="37" style="white-space:pre;font-family:courier"><span style="color:silver">37</span> CHARSET csone (STANDARD CHARACTERS='dna forty five') = 1-3;
</div>
<a name="line38"></a>
<div title="38" style="white-space:pre;font-family:courier"><span style="color:silver">38</span> CHARSET cstwo (CHARACTERS='dna forty five' STANDARD) = csone;
</div>
<a name="line39"></a>
<div title="39" style="white-space:pre;font-family:courier"><span style="color:silver">39</span> CHARSET csthree = 5 labfour cstwo;
</div>
<a name="line40"></a>
<div title="40" style="white-space:pre;font-family:courier"><span style="color:silver">40</span> CHARSET csfour = 4 labone - . \ 3 7;
</div>
<a name="line41"></a>
<div title="41" style="white-space:pre;font-family:courier"><span style="color:silver">41</span> CHARSET csfive = 44 43 csthree 41 10 - 16 \2 18 40 42 45;
</div>
<a name="line42"></a>
<div title="42" style="white-space:pre;font-family:courier"><span style="color:silver">42</span> CHARSET cssix (CHARACTERS='dna forty five') = labseven csthree csfour 6;
</div>
<a name="line43"></a>
<div title="43" style="white-space:pre;font-family:courier"><span style="color:silver">43</span> end;
</div>
<a name="line44"></a>
<div title="44" style="white-space:pre;font-family:courier"><span style="color:silver">44</span>
</div>
<a name="line45"></a>
<div title="45" style="white-space:pre;font-family:courier"><span style="color:silver">45</span>
</div>
<a name="line46"></a>
<div title="46" style="white-space:pre;font-family:courier"><span style="color:silver">46</span> BEGIN ASSUMPTIONS;
</div>
<a name="line47"></a>
<div title="47" style="white-space:pre;font-family:courier"><span style="color:silver">47</span>
</div>
<a name="line48"></a>
<div title="48" style="white-space:pre;font-family:courier"><span style="color:silver">48</span> EXSET csone (STANDARD CHARACTERS='dna forty five') = 1-3;
</div>
<a name="line49"></a>
<div title="49" style="white-space:pre;font-family:courier"><span style="color:silver">49</span> EXSET cstwo (CHARACTERS='dna forty five' STANDARD) = csone;
</div>
<a name="line50"></a>
<div title="50" style="white-space:pre;font-family:courier"><span style="color:silver">50</span> EXSET csthree = 5 labfour cstwo;
</div>
<a name="line51"></a>
<div title="51" style="white-space:pre;font-family:courier"><span style="color:silver">51</span> EXSET * csfour = 4 labone - . \ 3 7;
</div>
<a name="line52"></a>
<div title="52" style="white-space:pre;font-family:courier"><span style="color:silver">52</span> EXSET csfive = 44 43 csthree 41 10 - 16 \2 18 40 42 45;
</div>
<a name="line53"></a>
<div title="53" style="white-space:pre;font-family:courier"><span style="color:silver">53</span> EXSET cssix (CHARACTERS='dna forty five') = labseven csthree csfour 6;
</div>
<a name="line54"></a>
<div title="54" style="white-space:pre;font-family:courier"><span style="color:silver">54</span> end;
</div>
</div> </div>
<div id="sidebar">
<!-- top-right site navigation menu -->
<h2 class="quicklinks">
<a id="quicklinks" name="quicklinks"></a>Quick links:
</h2>
<a class="quicklink" href="/manual">Manual</a>
<a class="quicklink" href="/nexml/html/doc/schema-1/">Schema documentation</a>
<a class="quicklink" href="/nexml/examples">Example files</a>
<a class="quicklink" href="/nexml/downloads">Downloads</a>
<a class="quicklink" href="http://docs.google.com/Present?docid=dc3k7mhr_8g9j2j7ct&invite=g56xcjx">Slide show</a>
<br />
<h2 class="sidelink menuheader">
<a name="sitemenu"></a>Bindings:
</h2>
<a class="sidelink" href="/nexml/java/">Java</a>
<span class="hide">|</span>
<a class="sidelink" href="/nexml/python/">Python</a>
<span class="hide">|</span>
<a class="sidelink" href="/nexml/perl/">Perl</a>
<span class="hide">|</span>
<a class="sidelink" href="/nexml/cpp/">C++</a>
<span class="hide">|</span>
<a class="sidelink" href="/nexml/javascript/">JavaScript</a>
<span class="hide">|</span>
<a class="sidelink" href="/nexml/ruby/">Ruby</a>
<span class="hide">|</span>
<br />
<h2 class="sidelink menuheader">
<a name="sitemenu"></a>Goings on:
</h2>
<a class="sidelink" href="/wiki/">Wiki</a>
<span class="hide">|</span>
<a class="sidelink" href="/mail/">Mailing list</a>
<span class="hide">|</span>
<a class="sidelink" href="/code/">SVN repository</a>
<span class="hide">|</span>
<a class="sidelink" href="/tracker/">Issue tracker</a>
<span class="hide">|</span>
<a class="hide" href="#top" accesskey="1">Top of page</a>
<!-- links at the bottom right -->
<h3>
External links
</h3>
<ul>
<li class="external">
<a href="http://sourceforge.net/projects/nexml/" rel="nofollow">SF.net project</a>
</li>
<li class="external">
<a href="http://www.nescent.org/wg_evoinfo/Future_Data_Exchange_Standard" rel="nofollow">EvoInfo wiki</a>
</li>
<li class="external">
<a href="http://www.evolutionaryontology.org/" rel="nofollow">CDAO</a>
</li>
</ul>
</div>
<div class="clear">
</div>
</div>
<div id="footer">
<p>
Site implementation and technology:
© <a href="http://rutgervos.blogspot.com" class="credit">Rutger Vos</a>.
Site design: © <a href="http://andreasviklund.com/" class="credit">Andreas Viklund</a>
of <a href="http://jokkmokk.biz/" title="ITUS Jokkmokk">Jokkmokk</a>.
</p>
</div>
<!--
<script src="http://www.google-analytics.com/urchin.js" type="text/javascript">
</script>
<script type="text/javascript">
_uacct = "UA-3174308-1";
urchinTracker();
</script>
-->
</body>
</html>
|