1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38
|
RNA N 17 GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
# We don't want to move the system center of mass to the global origin in this case, nor do we want to enforce zero overall momenta. So set:
removeRigidBodyMomentum False
constrainToGround N 17
# Specify rigid segments:
mobilizer Rigid N 17 21
mobilizer Rigid N 27 38
mobilizer Rigid N 41 45
# To prevent the discontinuous domain from splitting:
constraint N 17 Weld N 45
constraintTolerance .001
contact AllHeavyAtomSterics N FirstResidue LastResidue
numReportingIntervals 200
reportingInterval 2.0
firstStage 2
lastStage 2
temperature 10.0
baseInteraction N 26 WatsonCrick N 39 WatsonCrick Cis
baseInteraction N 22 WatsonCrick N 40 WatsonCrick Cis
baseInteraction N 27 WatsonCrick N 38 WatsonCrick Cis
baseInteraction N 28 WatsonCrick N 37 WatsonCrick Cis
baseInteraction N 29 WatsonCrick N 36 WatsonCrick Cis
baseInteraction N 17 WatsonCrick N 45 WatsonCrick Cis
baseInteraction N 18 WatsonCrick N 44 WatsonCrick Cis
baseInteraction N 19 WatsonCrick N 43 WatsonCrick Cis
baseInteraction N 20 WatsonCrick N 42 WatsonCrick Cis
baseInteraction N 21 WatsonCrick N 41 WatsonCrick Cis
|