1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38
|
# To run this example, issue:
# cp tRNA.pdb last.1.pdb
# also make sure you have tRNA.xplor in the current directory.
# And follow the tutorial guide!
loadSequencesFromPdb tRNA.pdb
#RNA V 5 CGCGGGAUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUCAAAUCCGGCCCCCGCAA
# Set bondMobility for all residues in all chains (in this case there is only one) to Rigid:
mobilizer Rigid
removeRigidBodyMomentum false
# This is constant that multiplies the density forces. In this case we leave it at the default value of unity:
density forceConstant 1.00
# Next you need to fetch tRNA.xplor . I'm not providing this on github b.c. it's antisocial. You can do:
# wget http://pe1.scilifelab.se/MMB-annex//examples/tRNA.xplor .
# While you're there, you may admire other fine MMB documents and products.
# This file contains the density map in XPLOR format:
density densityFileName ./tRNA.xplor
# This fits chain V to the density map:
fitToDensity V
# These parameters should be familiar by now:
temperature 1
numReportingIntervals 100
reportingInterval 1
firstStage 2
lastStage 2
|