1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962
|
/*
* chimerauchimecommand.cpp
* Mothur
*
* Created by westcott on 5/13/11.
* Copyright 2011 Schloss Lab. All rights reserved.
*
*/
#include "chimerauchimecommand.h"
#include "deconvolutecommand.h"
//#include "uc.h"
#include "sequence.hpp"
#include "referencedb.h"
#include "systemcommand.h"
//**********************************************************************************************************************
vector<string> ChimeraUchimeCommand::setParameters(){
try {
CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none","",false,true,true); parameters.push_back(ptemplate);
CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none","chimera-accnos",false,true,true); parameters.push_back(pfasta);
CommandParameter pname("name", "InputTypes", "", "", "NameCount", "none", "none","",false,false,true); parameters.push_back(pname);
CommandParameter pcount("count", "InputTypes", "", "", "NameCount-CountGroup", "none", "none","",false,false,true); parameters.push_back(pcount);
CommandParameter pgroup("group", "InputTypes", "", "", "CountGroup", "none", "none","",false,false,true); parameters.push_back(pgroup);
CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors);
CommandParameter pstrand("strand", "String", "", "", "", "", "","",false,false); parameters.push_back(pstrand);
CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
CommandParameter pabskew("abskew", "Number", "", "1.9", "", "", "","",false,false); parameters.push_back(pabskew);
CommandParameter pchimealns("chimealns", "Boolean", "", "F", "", "", "","alns",false,false); parameters.push_back(pchimealns);
CommandParameter pminh("minh", "Number", "", "0.3", "", "", "","",false,false); parameters.push_back(pminh);
CommandParameter pmindiv("mindiv", "Number", "", "0.5", "", "", "","",false,false); parameters.push_back(pmindiv);
CommandParameter pxn("xn", "Number", "", "8.0", "", "", "","",false,false); parameters.push_back(pxn);
CommandParameter pdn("dn", "Number", "", "1.4", "", "", "","",false,false); parameters.push_back(pdn);
CommandParameter pxa("xa", "Number", "", "1", "", "", "","",false,false); parameters.push_back(pxa);
CommandParameter pchunks("chunks", "Number", "", "4", "", "", "","",false,false); parameters.push_back(pchunks);
CommandParameter pminchunk("minchunk", "Number", "", "64", "", "", "","",false,false); parameters.push_back(pminchunk);
CommandParameter pidsmoothwindow("idsmoothwindow", "Number", "", "32", "", "", "","",false,false); parameters.push_back(pidsmoothwindow);
CommandParameter pdups("dereplicate", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pdups);
//CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid);
CommandParameter pmaxp("maxp", "Number", "", "2", "", "", "","",false,false); parameters.push_back(pmaxp);
CommandParameter pskipgaps("skipgaps", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(pskipgaps);
CommandParameter pskipgaps2("skipgaps2", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(pskipgaps2);
CommandParameter pminlen("minlen", "Number", "", "10", "", "", "","",false,false); parameters.push_back(pminlen);
CommandParameter pmaxlen("maxlen", "Number", "", "10000", "", "", "","",false,false); parameters.push_back(pmaxlen);
CommandParameter pucl("ucl", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pucl);
CommandParameter pqueryfract("queryfract", "Number", "", "0.5", "", "", "","",false,false); parameters.push_back(pqueryfract);
vector<string> myArray;
for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
return myArray;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "setParameters");
exit(1);
}
}
//**********************************************************************************************************************
string ChimeraUchimeCommand::getHelpString(){
try {
string helpString = "";
helpString += "The chimera.uchime command reads a fastafile and referencefile and outputs potentially chimeric sequences.\n";
helpString += "This command is a wrapper for uchime written by Robert C. Edgar.\n";
helpString += "The chimera.uchime command parameters are fasta, name, count, reference, processors, dereplicate, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl, strand and queryfact.\n";
helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n";
helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n";
helpString += "The count parameter allows you to provide a count file, if you are using template=self. When you use a count file with group info and dereplicate=T, mothur will create a *.pick.count_table file containing seqeunces after chimeras are removed. \n";
helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n";
helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n";
helpString += "If the dereplicate parameter is false, then if one group finds the seqeunce to be chimeric, then all groups find it to be chimeric, default=f.\n";
helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n";
helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n";
helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n";
helpString += "The chimealns parameter allows you to indicate you would like a file containing multiple alignments of query sequences to parents in human readable format. Alignments show columns with differences that support or contradict a chimeric model.\n";
helpString += "The minh parameter - mininum score to report chimera. Default 0.3. Values from 0.1 to 5 might be reasonable. Lower values increase sensitivity but may report more false positives. If you decrease xn you may need to increase minh, and vice versa.\n";
helpString += "The mindiv parameter - minimum divergence ratio, default 0.5. Div ratio is 100%% - %%identity between query sequence and the closest candidate for being a parent. If you don't care about very close chimeras, then you could increase mindiv to, say, 1.0 or 2.0, and also decrease minh, say to 0.1, to increase sensitivity. How well this works will depend on your data. Best is to tune parameters on a good benchmark.\n";
helpString += "The xn parameter - weight of a no vote. Default 8.0. Decreasing this weight to around 3 or 4 may give better performance on denoised data.\n";
helpString += "The dn parameter - pseudo-count prior on number of no votes. Default 1.4. Probably no good reason to change this unless you can retune to a good benchmark for your data. Reasonable values are probably in the range from 0.2 to 2.\n";
helpString += "The xa parameter - weight of an abstain vote. Default 1. So far, results do not seem to be very sensitive to this parameter, but if you have a good training set might be worth trying. Reasonable values might range from 0.1 to 2.\n";
helpString += "The chunks parameter is the number of chunks to extract from the query sequence when searching for parents. Default 4.\n";
helpString += "The minchunk parameter is the minimum length of a chunk. Default 64.\n";
helpString += "The idsmoothwindow parameter is the length of id smoothing window. Default 32.\n";
//helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n";
helpString += "The maxp parameter - maximum number of candidate parents to consider. Default 2. In tests so far, increasing maxp gives only a very small improvement in sensivity but tends to increase the error rate quite a bit.\n";
helpString += "The skipgaps parameter controls how gapped columns affect counting of diffs. If skipgaps is set to T, columns containing gaps do not found as diffs. Default = T.\n";
helpString += "The skipgaps2 parameter controls how gapped columns affect counting of diffs. If skipgaps2 is set to T, if column is immediately adjacent to a column containing a gap, it is not counted as a diff. Default = T.\n";
helpString += "The minlen parameter is the minimum unaligned sequence length. Defaults 10. Applies to both query and reference sequences.\n";
helpString += "The maxlen parameter is the maximum unaligned sequence length. Defaults 10000. Applies to both query and reference sequences.\n";
helpString += "The ucl parameter - use local-X alignments. Default is global-X or false. On tests so far, global-X is always better; this option is retained because it just might work well on some future type of data.\n";
helpString += "The queryfract parameter - minimum fraction of the query sequence that must be covered by a local-X alignment. Default 0.5. Applies only when ucl is true.\n";
#ifdef USE_MPI
helpString += "When using MPI, the processors parameter is set to the number of MPI processes running. \n";
#endif
helpString += "The chimera.uchime command should be in the following format: \n";
helpString += "chimera.uchime(fasta=yourFastaFile, reference=yourTemplate) \n";
helpString += "Example: chimera.uchime(fasta=AD.align, reference=silva.gold.align) \n";
helpString += "Note: No spaces between parameter labels (i.e. fasta), '=' and parameters (i.e.yourFastaFile).\n";
return helpString;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "getHelpString");
exit(1);
}
}
//**********************************************************************************************************************
string ChimeraUchimeCommand::getOutputPattern(string type) {
try {
string pattern = "";
if (type == "chimera") { pattern = "[filename],uchime.chimeras"; }
else if (type == "accnos") { pattern = "[filename],uchime.accnos"; }
else if (type == "alns") { pattern = "[filename],uchime.alns"; }
else if (type == "count") { pattern = "[filename],uchime.pick.count_table"; }
else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; }
return pattern;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "getOutputPattern");
exit(1);
}
}
//**********************************************************************************************************************
ChimeraUchimeCommand::ChimeraUchimeCommand(){
try {
abort = true; calledHelp = true;
setParameters();
vector<string> tempOutNames;
outputTypes["chimera"] = tempOutNames;
outputTypes["accnos"] = tempOutNames;
outputTypes["alns"] = tempOutNames;
outputTypes["count"] = tempOutNames;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "ChimeraUchimeCommand");
exit(1);
}
}
//***************************************************************************************************************
ChimeraUchimeCommand::ChimeraUchimeCommand(string option) {
try {
abort = false; calledHelp = false; hasName=false; hasCount=false;
ReferenceDB* rdb = ReferenceDB::getInstance();
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
else if(option == "citation") { citation(); abort = true; calledHelp = true;}
else {
vector<string> myArray = setParameters();
OptionParser parser(option);
map<string,string> parameters = parser.getParameters();
ValidParameters validParameter("chimera.uchime");
map<string,string>::iterator it;
//check to make sure all parameters are valid for command
for (it = parameters.begin(); it != parameters.end(); it++) {
if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
}
vector<string> tempOutNames;
outputTypes["chimera"] = tempOutNames;
outputTypes["accnos"] = tempOutNames;
outputTypes["alns"] = tempOutNames;
outputTypes["count"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
if (inputDir == "not found"){ inputDir = ""; }
//check for required parameters
fastafile = validParameter.validFile(parameters, "fasta", false);
if (fastafile == "not found") {
//if there is a current fasta file, use it
string filename = m->getFastaFile();
if (filename != "") { fastaFileNames.push_back(filename); m->mothurOut("Using " + filename + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
}else {
m->splitAtDash(fastafile, fastaFileNames);
//go through files and make sure they are good, if not, then disregard them
for (int i = 0; i < fastaFileNames.size(); i++) {
bool ignore = false;
if (fastaFileNames[i] == "current") {
fastaFileNames[i] = m->getFastaFile();
if (fastaFileNames[i] != "") { m->mothurOut("Using " + fastaFileNames[i] + " as input file for the fasta parameter where you had given current."); m->mothurOutEndLine(); }
else {
m->mothurOut("You have no current fastafile, ignoring current."); m->mothurOutEndLine(); ignore=true;
//erase from file list
fastaFileNames.erase(fastaFileNames.begin()+i);
i--;
}
}
if (!ignore) {
if (inputDir != "") {
string path = m->hasPath(fastaFileNames[i]);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { fastaFileNames[i] = inputDir + fastaFileNames[i]; }
}
int ableToOpen;
ifstream in;
ableToOpen = m->openInputFile(fastaFileNames[i], in, "noerror");
//if you can't open it, try default location
if (ableToOpen == 1) {
if (m->getDefaultPath() != "") { //default path is set
string tryPath = m->getDefaultPath() + m->getSimpleName(fastaFileNames[i]);
m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
fastaFileNames[i] = tryPath;
}
}
if (ableToOpen == 1) {
if (m->getOutputDir() != "") { //default path is set
string tryPath = m->getOutputDir() + m->getSimpleName(fastaFileNames[i]);
m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
fastaFileNames[i] = tryPath;
}
}
in.close();
if (ableToOpen == 1) {
m->mothurOut("Unable to open " + fastaFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
//erase from file list
fastaFileNames.erase(fastaFileNames.begin()+i);
i--;
}else {
m->setFastaFile(fastaFileNames[i]);
}
}
}
//make sure there is at least one valid file left
if (fastaFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid files."); m->mothurOutEndLine(); abort = true; }
}
//check for required parameters
namefile = validParameter.validFile(parameters, "name", false);
if (namefile == "not found") { namefile = ""; }
else {
m->splitAtDash(namefile, nameFileNames);
//go through files and make sure they are good, if not, then disregard them
for (int i = 0; i < nameFileNames.size(); i++) {
bool ignore = false;
if (nameFileNames[i] == "current") {
nameFileNames[i] = m->getNameFile();
if (nameFileNames[i] != "") { m->mothurOut("Using " + nameFileNames[i] + " as input file for the name parameter where you had given current."); m->mothurOutEndLine(); }
else {
m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
//erase from file list
nameFileNames.erase(nameFileNames.begin()+i);
i--;
}
}
if (!ignore) {
if (inputDir != "") {
string path = m->hasPath(nameFileNames[i]);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { nameFileNames[i] = inputDir + nameFileNames[i]; }
}
int ableToOpen;
ifstream in;
ableToOpen = m->openInputFile(nameFileNames[i], in, "noerror");
//if you can't open it, try default location
if (ableToOpen == 1) {
if (m->getDefaultPath() != "") { //default path is set
string tryPath = m->getDefaultPath() + m->getSimpleName(nameFileNames[i]);
m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
nameFileNames[i] = tryPath;
}
}
if (ableToOpen == 1) {
if (m->getOutputDir() != "") { //default path is set
string tryPath = m->getOutputDir() + m->getSimpleName(nameFileNames[i]);
m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
nameFileNames[i] = tryPath;
}
}
in.close();
if (ableToOpen == 1) {
m->mothurOut("Unable to open " + nameFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
//erase from file list
nameFileNames.erase(nameFileNames.begin()+i);
i--;
}else {
m->setNameFile(nameFileNames[i]);
}
}
}
}
if (nameFileNames.size() != 0) { hasName = true; }
//check for required parameters
vector<string> countfileNames;
countfile = validParameter.validFile(parameters, "count", false);
if (countfile == "not found") {
countfile = "";
}else {
m->splitAtDash(countfile, countfileNames);
//go through files and make sure they are good, if not, then disregard them
for (int i = 0; i < countfileNames.size(); i++) {
bool ignore = false;
if (countfileNames[i] == "current") {
countfileNames[i] = m->getCountTableFile();
if (nameFileNames[i] != "") { m->mothurOut("Using " + countfileNames[i] + " as input file for the count parameter where you had given current."); m->mothurOutEndLine(); }
else {
m->mothurOut("You have no current count file, ignoring current."); m->mothurOutEndLine(); ignore=true;
//erase from file list
countfileNames.erase(countfileNames.begin()+i);
i--;
}
}
if (!ignore) {
if (inputDir != "") {
string path = m->hasPath(countfileNames[i]);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { countfileNames[i] = inputDir + countfileNames[i]; }
}
int ableToOpen;
ifstream in;
ableToOpen = m->openInputFile(countfileNames[i], in, "noerror");
//if you can't open it, try default location
if (ableToOpen == 1) {
if (m->getDefaultPath() != "") { //default path is set
string tryPath = m->getDefaultPath() + m->getSimpleName(countfileNames[i]);
m->mothurOut("Unable to open " + countfileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
countfileNames[i] = tryPath;
}
}
if (ableToOpen == 1) {
if (m->getOutputDir() != "") { //default path is set
string tryPath = m->getOutputDir() + m->getSimpleName(countfileNames[i]);
m->mothurOut("Unable to open " + countfileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
countfileNames[i] = tryPath;
}
}
in.close();
if (ableToOpen == 1) {
m->mothurOut("Unable to open " + countfileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
//erase from file list
countfileNames.erase(countfileNames.begin()+i);
i--;
}else {
m->setCountTableFile(countfileNames[i]);
}
}
}
}
if (countfileNames.size() != 0) { hasCount = true; }
//make sure there is at least one valid file left
if (hasName && hasCount) { m->mothurOut("[ERROR]: You must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; }
if (!hasName && hasCount) { nameFileNames = countfileNames; }
if ((hasCount || hasName) && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of name or count files does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
bool hasGroup = true;
groupfile = validParameter.validFile(parameters, "group", false);
if (groupfile == "not found") { groupfile = ""; hasGroup = false; }
else {
m->splitAtDash(groupfile, groupFileNames);
//go through files and make sure they are good, if not, then disregard them
for (int i = 0; i < groupFileNames.size(); i++) {
bool ignore = false;
if (groupFileNames[i] == "current") {
groupFileNames[i] = m->getGroupFile();
if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); }
else {
m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
//erase from file list
groupFileNames.erase(groupFileNames.begin()+i);
i--;
}
}
if (!ignore) {
if (inputDir != "") {
string path = m->hasPath(groupFileNames[i]);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; }
}
int ableToOpen;
ifstream in;
ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror");
//if you can't open it, try default location
if (ableToOpen == 1) {
if (m->getDefaultPath() != "") { //default path is set
string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]);
m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
groupFileNames[i] = tryPath;
}
}
if (ableToOpen == 1) {
if (m->getOutputDir() != "") { //default path is set
string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]);
m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
in2.close();
groupFileNames[i] = tryPath;
}
}
in.close();
if (ableToOpen == 1) {
m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
//erase from file list
groupFileNames.erase(groupFileNames.begin()+i);
i--;
}else {
m->setGroupFile(groupFileNames[i]);
}
}
}
//make sure there is at least one valid file left
if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; }
}
if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
if (hasGroup && hasCount) { m->mothurOut("[ERROR]: You must enter ONLY ONE of the following: count or group."); m->mothurOutEndLine(); abort = true; }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
string path;
it = parameters.find("reference");
//user has given a template file
if(it != parameters.end()){
if (it->second == "self") { templatefile = "self"; }
else {
path = m->hasPath(it->second);
//if the user has not given a path then, add inputdir. else leave path alone.
if (path == "") { parameters["reference"] = inputDir + it->second; }
templatefile = validParameter.validFile(parameters, "reference", true);
if (templatefile == "not open") { abort = true; }
else if (templatefile == "not found") { //check for saved reference sequences
if (rdb->getSavedReference() != "") {
templatefile = rdb->getSavedReference();
m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
}else {
m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
m->mothurOutEndLine();
abort = true;
}
}
}
}else if (hasName) { templatefile = "self"; }
else if (hasCount) { templatefile = "self"; }
else {
if (rdb->getSavedReference() != "") {
templatefile = rdb->getSavedReference();
m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
}else {
m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
m->mothurOutEndLine();
templatefile = ""; abort = true;
}
}
string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
m->mothurConvert(temp, processors);
abskew = validParameter.validFile(parameters, "abskew", false); if (abskew == "not found"){ useAbskew = false; abskew = "1.9"; }else{ useAbskew = true; }
if (useAbskew && templatefile != "self") { m->mothurOut("The abskew parameter is only valid with template=self, ignoring."); m->mothurOutEndLine(); useAbskew = false; }
temp = validParameter.validFile(parameters, "chimealns", false); if (temp == "not found") { temp = "f"; }
chimealns = m->isTrue(temp);
minh = validParameter.validFile(parameters, "minh", false); if (minh == "not found") { useMinH = false; minh = "0.3"; } else{ useMinH = true; }
mindiv = validParameter.validFile(parameters, "mindiv", false); if (mindiv == "not found") { useMindiv = false; mindiv = "0.5"; } else{ useMindiv = true; }
xn = validParameter.validFile(parameters, "xn", false); if (xn == "not found") { useXn = false; xn = "8.0"; } else{ useXn = true; }
dn = validParameter.validFile(parameters, "dn", false); if (dn == "not found") { useDn = false; dn = "1.4"; } else{ useDn = true; }
xa = validParameter.validFile(parameters, "xa", false); if (xa == "not found") { useXa = false; xa = "1"; } else{ useXa = true; }
chunks = validParameter.validFile(parameters, "chunks", false); if (chunks == "not found") { useChunks = false; chunks = "4"; } else{ useChunks = true; }
minchunk = validParameter.validFile(parameters, "minchunk", false); if (minchunk == "not found") { useMinchunk = false; minchunk = "64"; } else{ useMinchunk = true; }
idsmoothwindow = validParameter.validFile(parameters, "idsmoothwindow", false); if (idsmoothwindow == "not found") { useIdsmoothwindow = false; idsmoothwindow = "32"; } else{ useIdsmoothwindow = true; }
//minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; }
maxp = validParameter.validFile(parameters, "maxp", false); if (maxp == "not found") { useMaxp = false; maxp = "2"; } else{ useMaxp = true; }
minlen = validParameter.validFile(parameters, "minlen", false); if (minlen == "not found") { useMinlen = false; minlen = "10"; } else{ useMinlen = true; }
maxlen = validParameter.validFile(parameters, "maxlen", false); if (maxlen == "not found") { useMaxlen = false; maxlen = "10000"; } else{ useMaxlen = true; }
strand = validParameter.validFile(parameters, "strand", false); if (strand == "not found") { strand = ""; }
temp = validParameter.validFile(parameters, "ucl", false); if (temp == "not found") { temp = "f"; }
ucl = m->isTrue(temp);
queryfract = validParameter.validFile(parameters, "queryfract", false); if (queryfract == "not found") { useQueryfract = false; queryfract = "0.5"; } else{ useQueryfract = true; }
if (!ucl && useQueryfract) { m->mothurOut("queryfact may only be used when ucl=t, ignoring."); m->mothurOutEndLine(); useQueryfract = false; }
temp = validParameter.validFile(parameters, "skipgaps", false); if (temp == "not found") { temp = "t"; }
skipgaps = m->isTrue(temp);
temp = validParameter.validFile(parameters, "skipgaps2", false); if (temp == "not found") { temp = "t"; }
skipgaps2 = m->isTrue(temp);
temp = validParameter.validFile(parameters, "dereplicate", false);
if (temp == "not found") { temp = "false"; }
dups = m->isTrue(temp);
if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
if (hasCount && (templatefile != "self")) { m->mothurOut("You have provided a countfile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
//look for uchime exe
path = m->argv;
string tempPath = path;
for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
path = path.substr(0, (tempPath.find_last_of('m')));
string uchimeCommand;
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
uchimeCommand = path + "uchime"; // format the database, -o option gives us the ability
if (m->debug) {
m->mothurOut("[DEBUG]: Uchime location using \"which uchime\" = ");
Command* newCommand = new SystemCommand("which uchime"); m->mothurOutEndLine();
newCommand->execute();
delete newCommand;
m->mothurOut("[DEBUG]: Mothur's location using \"which mothur\" = ");
newCommand = new SystemCommand("which mothur"); m->mothurOutEndLine();
newCommand->execute();
delete newCommand;
}
#else
uchimeCommand = path + "uchime.exe";
#endif
//test to make sure uchime exists
ifstream in;
uchimeCommand = m->getFullPathName(uchimeCommand);
int ableToOpen = m->openInputFile(uchimeCommand, in, "no error"); in.close();
if(ableToOpen == 1) {
m->mothurOut(uchimeCommand + " file does not exist. Checking path... \n");
//check to see if uchime is in the path??
string uLocation = m->findProgramPath("uchime");
ifstream in2;
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
ableToOpen = m->openInputFile(uLocation, in2, "no error"); in2.close();
#else
ableToOpen = m->openInputFile((uLocation + ".exe"), in2, "no error"); in2.close();
#endif
if(ableToOpen == 1) { m->mothurOut("[ERROR]: " + uLocation + " file does not exist. mothur requires the uchime executable."); m->mothurOutEndLine(); abort = true; }
else { m->mothurOut("Found uchime in your path, using " + uLocation + "\n");uchimeLocation = uLocation; }
}else { uchimeLocation = uchimeCommand; }
uchimeLocation = m->getFullPathName(uchimeLocation);
}
}
catch(exception& e) {
m->errorOut(e, "ChimeraSlayerCommand", "ChimeraSlayerCommand");
exit(1);
}
}
//***************************************************************************************************************
int ChimeraUchimeCommand::execute(){
try{
if (abort == true) { if (calledHelp) { return 0; } return 2; }
m->mothurOut("\nuchime by Robert C. Edgar\nhttp://drive5.com/uchime\nThis code is donated to the public domain.\n\n");
for (int s = 0; s < fastaFileNames.size(); s++) {
m->mothurOut("Checking sequences from " + fastaFileNames[s] + " ..." ); m->mothurOutEndLine();
int start = time(NULL);
string nameFile = "";
if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
map<string, string> variables;
variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s]));
string outputFileName = getOutputFileName("chimera", variables);
string accnosFileName = getOutputFileName("accnos", variables);
string alnsFileName = getOutputFileName("alns", variables);
string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
string newCountFile = "";
//you provided a groupfile
string groupFile = "";
bool hasGroup = false;
if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; hasGroup = true; }
else if (hasCount) {
CountTable ct;
if (ct.testGroups(nameFileNames[s])) { hasGroup = true; }
variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(nameFileNames[s]));
newCountFile = getOutputFileName("count", variables);
}
if ((templatefile == "self") && (!hasGroup)) { //you want to run uchime with a template=self and no groups
if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; }
if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
nameFile = nameFileNames[s];
}else { nameFile = getNamesFile(fastaFileNames[s]); }
map<string, string> seqs;
readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
//read namefile
vector<seqPriorityNode> nameMapCount;
int error;
if (hasCount) {
CountTable ct;
ct.readTable(nameFile, true, false);
for(map<string, string>::iterator it = seqs.begin(); it != seqs.end(); it++) {
int num = ct.getNumSeqs(it->first);
if (num == 0) { error = 1; }
else {
seqPriorityNode temp(num, it->second, it->first);
nameMapCount.push_back(temp);
}
}
}else {
error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
}
if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
printFile(nameMapCount, newFasta);
fastaFileNames[s] = newFasta;
}
if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
if (hasGroup) {
if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
nameFile = nameFileNames[s];
}else { nameFile = getNamesFile(fastaFileNames[s]); }
//Parse sequences by group
vector<string> groups;
map<string, string> uniqueNames;
if (hasCount) {
cparser = new SequenceCountParser(nameFile, fastaFileNames[s]);
groups = cparser->getNamesOfGroups();
uniqueNames = cparser->getAllSeqsMap();
}else{
sparser = new SequenceParser(groupFile, fastaFileNames[s], nameFile);
groups = sparser->getNamesOfGroups();
uniqueNames = sparser->getAllSeqsMap();
}
if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
//clears files
ofstream out, out1, out2;
m->openOutputFile(outputFileName, out); out.close();
m->openOutputFile(accnosFileName, out1); out1.close();
if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); }
int totalSeqs = 0;
if(processors == 1) { totalSeqs = driverGroups(outputFileName, newFasta, accnosFileName, alnsFileName, newCountFile, 0, groups.size(), groups);
if (hasCount && dups) {
CountTable c; c.readTable(nameFile, true, false);
if (!m->isBlank(newCountFile)) {
ifstream in2;
m->openInputFile(newCountFile, in2);
string name, group;
while (!in2.eof()) {
in2 >> name >> group; m->gobble(in2);
c.setAbund(name, group, 0);
}
in2.close();
}
m->mothurRemove(newCountFile);
c.printTable(newCountFile);
}
}else { totalSeqs = createProcessesGroups(outputFileName, newFasta, accnosFileName, alnsFileName, newCountFile, groups, nameFile, groupFile, fastaFileNames[s]); }
if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
if (!dups) {
int totalChimeras = deconvoluteResults(uniqueNames, outputFileName, accnosFileName, alnsFileName);
m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine();
m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine();
}else {
if (hasCount) {
set<string> doNotRemove;
CountTable c; c.readTable(newCountFile, true, true);
vector<string> namesInTable = c.getNamesOfSeqs();
for (int i = 0; i < namesInTable.size(); i++) {
int temp = c.getNumSeqs(namesInTable[i]);
if (temp == 0) { c.remove(namesInTable[i]); }
else { doNotRemove.insert((namesInTable[i])); }
}
//remove names we want to keep from accnos file.
set<string> accnosNames = m->readAccnos(accnosFileName);
ofstream out2;
m->openOutputFile(accnosFileName, out2);
for (set<string>::iterator it = accnosNames.begin(); it != accnosNames.end(); it++) {
if (doNotRemove.count(*it) == 0) { out2 << (*it) << endl; }
}
out2.close();
c.printTable(newCountFile);
outputNames.push_back(newCountFile); outputTypes["count"].push_back(newCountFile);
}
}
if (hasCount) { delete cparser; }
else { delete sparser; }
if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
}else{
if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
int numSeqs = 0;
int numChimeras = 0;
if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
//add headings
ofstream out;
m->openOutputFile(outputFileName+".temp", out);
out << "Score\tQuery\tParentA\tParentB\tIdQM\tIdQA\tIdQB\tIdAB\tIdQT\tLY\tLN\tLA\tRY\tRN\tRA\tDiv\tYN\n";
out.close();
m->appendFiles(outputFileName, outputFileName+".temp");
m->mothurRemove(outputFileName); rename((outputFileName+".temp").c_str(), outputFileName.c_str());
if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
//remove file made for uchime
if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine();
}
outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName);
outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName);
if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); }
}
//set accnos file as new current accnosfile
string current = "";
itTypes = outputTypes.find("accnos");
if (itTypes != outputTypes.end()) {
if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setAccnosFile(current); }
}
itTypes = outputTypes.find("count");
if (itTypes != outputTypes.end()) {
if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setCountTableFile(current); }
}
m->mothurOutEndLine();
m->mothurOut("Output File Names: "); m->mothurOutEndLine();
for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
m->mothurOutEndLine();
return 0;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "execute");
exit(1);
}
}
//**********************************************************************************************************************
int ChimeraUchimeCommand::deconvoluteResults(map<string, string>& uniqueNames, string outputFileName, string accnosFileName, string alnsFileName){
try {
map<string, string>::iterator itUnique;
int total = 0;
ofstream out2;
m->openOutputFile(accnosFileName+".temp", out2);
string name;
set<string> namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once
set<string>::iterator itNames;
set<string> chimerasInFile;
set<string>::iterator itChimeras;
if (!m->isBlank(accnosFileName)) {
//edit accnos file
ifstream in2;
m->openInputFile(accnosFileName, in2);
while (!in2.eof()) {
if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; }
in2 >> name; m->gobble(in2);
//find unique name
itUnique = uniqueNames.find(name);
if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find " + name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
else {
itChimeras = chimerasInFile.find((itUnique->second));
if (itChimeras == chimerasInFile.end()) {
out2 << itUnique->second << endl;
chimerasInFile.insert((itUnique->second));
total++;
}
}
}
in2.close();
}
out2.close();
m->mothurRemove(accnosFileName);
rename((accnosFileName+".temp").c_str(), accnosFileName.c_str());
//edit chimera file
ifstream in;
m->openInputFile(outputFileName, in);
ofstream out;
m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint);
out << "Score\tQuery\tParentA\tParentB\tIdQM\tIdQA\tIdQB\tIdAB\tIdQT\tLY\tLN\tLA\tRY\tRN\tRA\tDiv\tYN\n";
float temp1;
string parent1, parent2, temp2, temp3, temp4, temp5, temp6, temp7, temp8, temp9, temp10, temp11, temp12, temp13, flag;
name = "";
namesInFile.clear();
//assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
/* 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N
0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N
*/
while (!in.eof()) {
if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; }
bool print = false;
in >> temp1; m->gobble(in);
in >> name; m->gobble(in);
in >> parent1; m->gobble(in);
in >> parent2; m->gobble(in);
in >> temp2 >> temp3 >> temp4 >> temp5 >> temp6 >> temp7 >> temp8 >> temp9 >> temp10 >> temp11 >> temp12 >> temp13 >> flag;
m->gobble(in);
//parse name - name will look like U68590/ab=1/
string restOfName = "";
int pos = name.find_first_of('/');
if (pos != string::npos) {
restOfName = name.substr(pos);
name = name.substr(0, pos);
}
//find unique name
itUnique = uniqueNames.find(name);
if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
else {
name = itUnique->second;
//is this name already in the file
itNames = namesInFile.find((name));
if (itNames == namesInFile.end()) { //no not in file
if (flag == "N") { //are you really a no??
//is this sequence really not chimeric??
itChimeras = chimerasInFile.find(name);
//then you really are a no so print, otherwise skip
if (itChimeras == chimerasInFile.end()) { print = true; }
}else{ print = true; }
}
}
if (print) {
out << temp1 << '\t' << name << restOfName << '\t';
namesInFile.insert(name);
//parse parent1 names
if (parent1 != "*") {
restOfName = "";
pos = parent1.find_first_of('/');
if (pos != string::npos) {
restOfName = parent1.substr(pos);
parent1 = parent1.substr(0, pos);
}
itUnique = uniqueNames.find(parent1);
if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
else { out << itUnique->second << restOfName << '\t'; }
}else { out << parent1 << '\t'; }
//parse parent2 names
if (parent2 != "*") {
restOfName = "";
pos = parent2.find_first_of('/');
if (pos != string::npos) {
restOfName = parent2.substr(pos);
parent2 = parent2.substr(0, pos);
}
itUnique = uniqueNames.find(parent2);
if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
else { out << itUnique->second << restOfName << '\t'; }
}else { out << parent2 << '\t'; }
out << temp2 << '\t' << temp3 << '\t' << temp4 << '\t' << temp5 << '\t' << temp6 << '\t' << temp7 << '\t' << temp8 << '\t' << temp9 << '\t' << temp10 << '\t' << temp11 << '\t' << temp12 << temp13 << '\t' << flag << endl;
}
}
in.close();
out.close();
m->mothurRemove(outputFileName);
rename((outputFileName+".temp").c_str(), outputFileName.c_str());
//edit anls file
//assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
/*
------------------------------------------------------------------------
Query ( 179 nt) F21Fcsw_11639/ab=591/
ParentA ( 179 nt) F11Fcsw_6529/ab=1625/
ParentB ( 181 nt) F21Fcsw_12128/ab=1827/
A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78
Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78
B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80
Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN
Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000
Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160
Diffs NNN N N N N N BB NNN
Votes 000 0 0 0 0 0 ++ 000
Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
A 159 TGGAACTGAGACACGGTCCAA 179
Q 159 TGGAACTGAGACACGGTCCAA 179
B 161 TGGAACTGAGACACGGTCCAA 181
Diffs
Votes
Model BBBBBBBBBBBBBBBBBBBBB
Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5%
Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047
*/
if (chimealns) {
ifstream in3;
m->openInputFile(alnsFileName, in3);
ofstream out3;
m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint);
name = "";
namesInFile.clear();
string line = "";
while (!in3.eof()) {
if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; }
line = "";
line = m->getline(in3);
string temp = "";
if (line != "") {
istringstream iss(line);
iss >> temp;
//are you a name line
if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) {
int spot = 0;
for (int i = 0; i < line.length(); i++) {
spot = i;
if (line[i] == ')') { break; }
else { out3 << line[i]; }
}
if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
else {
out << line[spot] << line[spot+1];
name = line.substr(spot+2);
//parse name - name will either look like U68590/ab=1/ or U68590
string restOfName = "";
int pos = name.find_first_of('/');
if (pos != string::npos) {
restOfName = name.substr(pos);
name = name.substr(0, pos);
}
//find unique name
itUnique = uniqueNames.find(name);
if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; }
else {
//only limit repeats on query names
if (temp == "Query") {
itNames = namesInFile.find((itUnique->second));
if (itNames == namesInFile.end()) {
out << itUnique->second << restOfName << endl;
namesInFile.insert((itUnique->second));
}
}else { out << itUnique->second << restOfName << endl; }
}
}
}else { //not need to alter line
out3 << line << endl;
}
}else { out3 << endl; }
}
in3.close();
out3.close();
m->mothurRemove(alnsFileName);
rename((alnsFileName+".temp").c_str(), alnsFileName.c_str());
}
return total;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults");
exit(1);
}
}
//**********************************************************************************************************************
int ChimeraUchimeCommand::printFile(vector<seqPriorityNode>& nameMapCount, string filename){
try {
sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
ofstream out;
m->openOutputFile(filename, out);
//print new file in order of
for (int i = 0; i < nameMapCount.size(); i++) {
out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
}
out.close();
return 0;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "printFile");
exit(1);
}
}
//**********************************************************************************************************************
int ChimeraUchimeCommand::readFasta(string filename, map<string, string>& seqs){
try {
//create input file for uchime
//read through fastafile and store info
ifstream in;
m->openInputFile(filename, in);
while (!in.eof()) {
if (m->control_pressed) { in.close(); return 0; }
Sequence seq(in); m->gobble(in);
seqs[seq.getName()] = seq.getAligned();
}
in.close();
return 0;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "readFasta");
exit(1);
}
}
//**********************************************************************************************************************
string ChimeraUchimeCommand::getNamesFile(string& inputFile){
try {
string nameFile = "";
m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
//use unique.seqs to create new name and fastafile
string inputString = "fasta=" + inputFile;
m->mothurOut("/******************************************/"); m->mothurOutEndLine();
m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
m->mothurCalling = true;
Command* uniqueCommand = new DeconvoluteCommand(inputString);
uniqueCommand->execute();
map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
delete uniqueCommand;
m->mothurCalling = false;
m->mothurOut("/******************************************/"); m->mothurOutEndLine();
nameFile = filenames["name"][0];
inputFile = filenames["fasta"][0];
return nameFile;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile");
exit(1);
}
}
//**********************************************************************************************************************
int ChimeraUchimeCommand::driverGroups(string outputFName, string filename, string accnos, string alns, string countlist, int start, int end, vector<string> groups){
try {
int totalSeqs = 0;
int numChimeras = 0;
ofstream outCountList;
if (hasCount && dups) { m->openOutputFile(countlist, outCountList); }
for (int i = start; i < end; i++) {
int start = time(NULL); if (m->control_pressed) { outCountList.close(); m->mothurRemove(countlist); return 0; }
int error;
if (hasCount) { error = cparser->getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; } }
else { error = sparser->getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; } }
int numSeqs = driver((outputFName + groups[i]), filename, (accnos+groups[i]), (alns+ groups[i]), numChimeras);
totalSeqs += numSeqs;
if (m->control_pressed) { return 0; }
//remove file made for uchime
if (!m->debug) { m->mothurRemove(filename); }
else { m->mothurOut("[DEBUG]: saving file: " + filename + ".\n"); }
//if we provided a count file with group info and set dereplicate=t, then we want to create a *.pick.count_table
//This table will zero out group counts for seqs determined to be chimeric by that group.
if (dups) {
if (!m->isBlank(accnos+groups[i])) {
ifstream in;
m->openInputFile(accnos+groups[i], in);
string name;
if (hasCount) {
while (!in.eof()) {
in >> name; m->gobble(in);
outCountList << name << '\t' << groups[i] << endl;
}
in.close();
}else {
map<string, string> thisnamemap = sparser->getNameMap(groups[i]);
map<string, string>::iterator itN;
ofstream out;
m->openOutputFile(accnos+groups[i]+".temp", out);
while (!in.eof()) {
in >> name; m->gobble(in);
itN = thisnamemap.find(name);
if (itN != thisnamemap.end()) {
vector<string> tempNames; m->splitAtComma(itN->second, tempNames);
for (int j = 0; j < tempNames.size(); j++) { out << tempNames[j] << endl; }
}else { m->mothurOut("[ERROR]: parsing cannot find " + name + ".\n"); m->control_pressed = true; }
}
out.close();
in.close();
m->renameFile(accnos+groups[i]+".temp", accnos+groups[i]);
}
}
}
//append files
m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i]));
m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i]));
if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); }
m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine();
}
if (hasCount && dups) { outCountList.close(); }
return totalSeqs;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "driverGroups");
exit(1);
}
}
//**********************************************************************************************************************
int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){
try {
outputFName = m->getFullPathName(outputFName);
filename = m->getFullPathName(filename);
alns = m->getFullPathName(alns);
//to allow for spaces in the path
outputFName = "\"" + outputFName + "\"";
filename = "\"" + filename + "\"";
alns = "\"" + alns + "\"";
vector<char*> cPara;
string uchimeCommand = uchimeLocation;
uchimeCommand = "\"" + uchimeCommand + "\" ";
char* tempUchime;
tempUchime= new char[uchimeCommand.length()+1];
*tempUchime = '\0';
strncat(tempUchime, uchimeCommand.c_str(), uchimeCommand.length());
cPara.push_back(tempUchime);
//are you using a reference file
if (templatefile != "self") {
string outputFileName = filename.substr(1, filename.length()-2) + ".uchime_formatted";
prepFile(filename.substr(1, filename.length()-2), outputFileName);
filename = outputFileName;
filename = "\"" + filename + "\"";
//add reference file
char* tempRef = new char[5];
//strcpy(tempRef, "--db");
*tempRef = '\0'; strncat(tempRef, "--db", 4);
cPara.push_back(tempRef);
char* tempR = new char[templatefile.length()+1];
//strcpy(tempR, templatefile.c_str());
*tempR = '\0'; strncat(tempR, templatefile.c_str(), templatefile.length());
cPara.push_back(tempR);
}
char* tempIn = new char[8];
*tempIn = '\0'; strncat(tempIn, "--input", 7);
//strcpy(tempIn, "--input");
cPara.push_back(tempIn);
char* temp = new char[filename.length()+1];
*temp = '\0'; strncat(temp, filename.c_str(), filename.length());
//strcpy(temp, filename.c_str());
cPara.push_back(temp);
char* tempO = new char[12];
*tempO = '\0'; strncat(tempO, "--uchimeout", 11);
//strcpy(tempO, "--uchimeout");
cPara.push_back(tempO);
char* tempout = new char[outputFName.length()+1];
//strcpy(tempout, outputFName.c_str());
*tempout = '\0'; strncat(tempout, outputFName.c_str(), outputFName.length());
cPara.push_back(tempout);
if (chimealns) {
char* tempA = new char[13];
*tempA = '\0'; strncat(tempA, "--uchimealns", 12);
//strcpy(tempA, "--uchimealns");
cPara.push_back(tempA);
char* tempa = new char[alns.length()+1];
//strcpy(tempa, alns.c_str());
*tempa = '\0'; strncat(tempa, alns.c_str(), alns.length());
cPara.push_back(tempa);
}
if (strand != "") {
char* tempA = new char[9];
*tempA = '\0'; strncat(tempA, "--strand", 8);
cPara.push_back(tempA);
char* tempa = new char[strand.length()+1];
*tempa = '\0'; strncat(tempa, strand.c_str(), strand.length());
cPara.push_back(tempa);
}
if (useAbskew) {
char* tempskew = new char[9];
*tempskew = '\0'; strncat(tempskew, "--abskew", 8);
//strcpy(tempskew, "--abskew");
cPara.push_back(tempskew);
char* tempSkew = new char[abskew.length()+1];
//strcpy(tempSkew, abskew.c_str());
*tempSkew = '\0'; strncat(tempSkew, abskew.c_str(), abskew.length());
cPara.push_back(tempSkew);
}
if (useMinH) {
char* tempminh = new char[7];
*tempminh = '\0'; strncat(tempminh, "--minh", 6);
//strcpy(tempminh, "--minh");
cPara.push_back(tempminh);
char* tempMinH = new char[minh.length()+1];
*tempMinH = '\0'; strncat(tempMinH, minh.c_str(), minh.length());
//strcpy(tempMinH, minh.c_str());
cPara.push_back(tempMinH);
}
if (useMindiv) {
char* tempmindiv = new char[9];
*tempmindiv = '\0'; strncat(tempmindiv, "--mindiv", 8);
//strcpy(tempmindiv, "--mindiv");
cPara.push_back(tempmindiv);
char* tempMindiv = new char[mindiv.length()+1];
*tempMindiv = '\0'; strncat(tempMindiv, mindiv.c_str(), mindiv.length());
//strcpy(tempMindiv, mindiv.c_str());
cPara.push_back(tempMindiv);
}
if (useXn) {
char* tempxn = new char[5];
//strcpy(tempxn, "--xn");
*tempxn = '\0'; strncat(tempxn, "--xn", 4);
cPara.push_back(tempxn);
char* tempXn = new char[xn.length()+1];
//strcpy(tempXn, xn.c_str());
*tempXn = '\0'; strncat(tempXn, xn.c_str(), xn.length());
cPara.push_back(tempXn);
}
if (useDn) {
char* tempdn = new char[5];
//strcpy(tempdn, "--dn");
*tempdn = '\0'; strncat(tempdn, "--dn", 4);
cPara.push_back(tempdn);
char* tempDn = new char[dn.length()+1];
*tempDn = '\0'; strncat(tempDn, dn.c_str(), dn.length());
//strcpy(tempDn, dn.c_str());
cPara.push_back(tempDn);
}
if (useXa) {
char* tempxa = new char[5];
//strcpy(tempxa, "--xa");
*tempxa = '\0'; strncat(tempxa, "--xa", 4);
cPara.push_back(tempxa);
char* tempXa = new char[xa.length()+1];
*tempXa = '\0'; strncat(tempXa, xa.c_str(), xa.length());
//strcpy(tempXa, xa.c_str());
cPara.push_back(tempXa);
}
if (useChunks) {
char* tempchunks = new char[9];
//strcpy(tempchunks, "--chunks");
*tempchunks = '\0'; strncat(tempchunks, "--chunks", 8);
cPara.push_back(tempchunks);
char* tempChunks = new char[chunks.length()+1];
*tempChunks = '\0'; strncat(tempChunks, chunks.c_str(), chunks.length());
//strcpy(tempChunks, chunks.c_str());
cPara.push_back(tempChunks);
}
if (useMinchunk) {
char* tempminchunk = new char[11];
//strcpy(tempminchunk, "--minchunk");
*tempminchunk = '\0'; strncat(tempminchunk, "--minchunk", 10);
cPara.push_back(tempminchunk);
char* tempMinchunk = new char[minchunk.length()+1];
*tempMinchunk = '\0'; strncat(tempMinchunk, minchunk.c_str(), minchunk.length());
//strcpy(tempMinchunk, minchunk.c_str());
cPara.push_back(tempMinchunk);
}
if (useIdsmoothwindow) {
char* tempidsmoothwindow = new char[17];
*tempidsmoothwindow = '\0'; strncat(tempidsmoothwindow, "--idsmoothwindow", 16);
//strcpy(tempidsmoothwindow, "--idsmoothwindow");
cPara.push_back(tempidsmoothwindow);
char* tempIdsmoothwindow = new char[idsmoothwindow.length()+1];
*tempIdsmoothwindow = '\0'; strncat(tempIdsmoothwindow, idsmoothwindow.c_str(), idsmoothwindow.length());
//strcpy(tempIdsmoothwindow, idsmoothwindow.c_str());
cPara.push_back(tempIdsmoothwindow);
}
/*if (useMinsmoothid) {
char* tempminsmoothid = new char[14];
//strcpy(tempminsmoothid, "--minsmoothid");
*tempminsmoothid = '\0'; strncat(tempminsmoothid, "--minsmoothid", 13);
cPara.push_back(tempminsmoothid);
char* tempMinsmoothid = new char[minsmoothid.length()+1];
*tempMinsmoothid = '\0'; strncat(tempMinsmoothid, minsmoothid.c_str(), minsmoothid.length());
//strcpy(tempMinsmoothid, minsmoothid.c_str());
cPara.push_back(tempMinsmoothid);
}*/
if (useMaxp) {
char* tempmaxp = new char[7];
//strcpy(tempmaxp, "--maxp");
*tempmaxp = '\0'; strncat(tempmaxp, "--maxp", 6);
cPara.push_back(tempmaxp);
char* tempMaxp = new char[maxp.length()+1];
*tempMaxp = '\0'; strncat(tempMaxp, maxp.c_str(), maxp.length());
//strcpy(tempMaxp, maxp.c_str());
cPara.push_back(tempMaxp);
}
if (!skipgaps) {
char* tempskipgaps = new char[13];
//strcpy(tempskipgaps, "--[no]skipgaps");
*tempskipgaps = '\0'; strncat(tempskipgaps, "--noskipgaps", 12);
cPara.push_back(tempskipgaps);
}
if (!skipgaps2) {
char* tempskipgaps2 = new char[14];
//strcpy(tempskipgaps2, "--[no]skipgaps2");
*tempskipgaps2 = '\0'; strncat(tempskipgaps2, "--noskipgaps2", 13);
cPara.push_back(tempskipgaps2);
}
if (useMinlen) {
char* tempminlen = new char[9];
*tempminlen = '\0'; strncat(tempminlen, "--minlen", 8);
//strcpy(tempminlen, "--minlen");
cPara.push_back(tempminlen);
char* tempMinlen = new char[minlen.length()+1];
//strcpy(tempMinlen, minlen.c_str());
*tempMinlen = '\0'; strncat(tempMinlen, minlen.c_str(), minlen.length());
cPara.push_back(tempMinlen);
}
if (useMaxlen) {
char* tempmaxlen = new char[9];
//strcpy(tempmaxlen, "--maxlen");
*tempmaxlen = '\0'; strncat(tempmaxlen, "--maxlen", 8);
cPara.push_back(tempmaxlen);
char* tempMaxlen = new char[maxlen.length()+1];
*tempMaxlen = '\0'; strncat(tempMaxlen, maxlen.c_str(), maxlen.length());
//strcpy(tempMaxlen, maxlen.c_str());
cPara.push_back(tempMaxlen);
}
if (ucl) {
char* tempucl = new char[5];
strcpy(tempucl, "--ucl");
cPara.push_back(tempucl);
}
if (useQueryfract) {
char* tempqueryfract = new char[13];
*tempqueryfract = '\0'; strncat(tempqueryfract, "--queryfract", 12);
//strcpy(tempqueryfract, "--queryfract");
cPara.push_back(tempqueryfract);
char* tempQueryfract = new char[queryfract.length()+1];
*tempQueryfract = '\0'; strncat(tempQueryfract, queryfract.c_str(), queryfract.length());
//strcpy(tempQueryfract, queryfract.c_str());
cPara.push_back(tempQueryfract);
}
char** uchimeParameters;
uchimeParameters = new char*[cPara.size()];
string commandString = "";
for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; commandString += toString(cPara[i]) + " "; }
//int numArgs = cPara.size();
//uchime_main(numArgs, uchimeParameters);
//cout << "commandString = " << commandString << endl;
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
#else
commandString = "\"" + commandString + "\"";
#endif
if (m->debug) { m->mothurOut("[DEBUG]: uchime command = " + commandString + ".\n"); }
system(commandString.c_str());
//free memory
for(int i = 0; i < cPara.size(); i++) { delete cPara[i]; }
delete[] uchimeParameters;
//remove "" from filenames
outputFName = outputFName.substr(1, outputFName.length()-2);
filename = filename.substr(1, filename.length()-2);
alns = alns.substr(1, alns.length()-2);
if (m->control_pressed) { return 0; }
//create accnos file from uchime results
ifstream in;
m->openInputFile(outputFName, in);
ofstream out;
m->openOutputFile(accnos, out);
int num = 0;
numChimeras = 0;
while(!in.eof()) {
if (m->control_pressed) { break; }
string name = "";
string chimeraFlag = "";
//in >> chimeraFlag >> name;
string line = m->getline(in);
vector<string> pieces = m->splitWhiteSpace(line);
if (pieces.size() > 2) {
name = pieces[1];
//fix name if needed
if (templatefile == "self") {
name = name.substr(0, name.length()-1); //rip off last /
name = name.substr(0, name.find_last_of('/'));
}
chimeraFlag = pieces[pieces.size()-1];
}
//for (int i = 0; i < 15; i++) { in >> chimeraFlag; }
m->gobble(in);
if (chimeraFlag == "Y") { out << name << endl; numChimeras++; }
num++;
}
in.close();
out.close();
//if (templatefile != "self") { m->mothurRemove(filename); }
return num;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "driver");
exit(1);
}
}
/**************************************************************************************************/
//uchime can't handle some of the things allowed in mothurs fasta files. This functions "cleans up" the file.
int ChimeraUchimeCommand::prepFile(string filename, string output) {
try {
ifstream in;
m->openInputFile(filename, in);
ofstream out;
m->openOutputFile(output, out);
while (!in.eof()) {
if (m->control_pressed) { break; }
Sequence seq(in); m->gobble(in);
if (seq.getName() != "") { seq.printSequence(out); }
}
in.close();
out.close();
return 0;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "prepFile");
exit(1);
}
}
/**************************************************************************************************/
int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) {
try {
processIDS.clear();
int process = 1;
int num = 0;
vector<string> files;
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
//break up file into multiple files
m->divideFile(filename, processors, files);
if (m->control_pressed) { return 0; }
//loop through and create all the processes you want
while (process != processors) {
int pid = fork();
if (pid > 0) {
processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
process++;
}else if (pid == 0){
num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras);
//pass numSeqs to parent
ofstream out;
string tempFile = outputFileName + toString(getpid()) + ".num.temp";
m->openOutputFile(tempFile, out);
out << num << endl;
out << numChimeras << endl;
out.close();
exit(0);
}else {
m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
exit(0);
}
}
//do my part
num = driver(outputFileName, files[0], accnos, alns, numChimeras);
//force parent to wait until all the processes are done
for (int i=0;i<processIDS.size();i++) {
int temp = processIDS[i];
wait(&temp);
}
for (int i = 0; i < processIDS.size(); i++) {
ifstream in;
string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
m->openInputFile(tempFile, in);
if (!in.eof()) {
int tempNum = 0;
in >> tempNum; m->gobble(in);
num += tempNum;
in >> tempNum;
numChimeras += tempNum;
}
in.close(); m->mothurRemove(tempFile);
}
#else
//////////////////////////////////////////////////////////////////////////////////////////////////////
//Windows version shared memory, so be careful when passing variables through the preClusterData struct.
//Above fork() will clone, so memory is separate, but that's not the case with windows,
//////////////////////////////////////////////////////////////////////////////////////////////////////
//divide file
int count = 0;
int spot = 0;
map<int, ofstream*> filehandles;
map<int, ofstream*>::iterator it3;
ofstream* temp;
for (int i = 0; i < processors; i++) {
temp = new ofstream;
filehandles[i] = temp;
m->openOutputFile(filename+toString(i)+".temp", *(temp));
files.push_back(filename+toString(i)+".temp");
}
ifstream in;
m->openInputFile(filename, in);
while(!in.eof()) {
if (m->control_pressed) { in.close(); for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) { (*(it3->second)).close(); delete it3->second; } return 0; }
Sequence tempSeq(in); m->gobble(in);
if (tempSeq.getName() != "") {
tempSeq.printSequence(*(filehandles[spot]));
spot++; count++;
if (spot == processors) { spot = 0; }
}
}
in.close();
//delete memory
for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) {
(*(it3->second)).close();
delete it3->second;
}
//sanity check for number of processors
if (count < processors) { processors = count; }
vector<uchimeData*> pDataArray;
DWORD dwThreadIdArray[processors-1];
HANDLE hThreadArray[processors-1];
vector<string> dummy; //used so that we can use the same struct for MyUchimeSeqsThreadFunction and MyUchimeThreadFunction
//Create processor worker threads.
for( int i=1; i<processors; i++ ){
// Allocate memory for thread data.
string extension = toString(i) + ".temp";
uchimeData* tempUchime = new uchimeData(outputFileName+extension, uchimeLocation, templatefile, files[i], "", "", "", accnos+extension, alns+extension, "", dummy, m, 0, 0, i);
tempUchime->setBooleans(dups, useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract, hasCount);
tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract, strand);
pDataArray.push_back(tempUchime);
processIDS.push_back(i);
//MySeqSumThreadFunction is in header. It must be global or static to work with the threads.
//default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier
hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeSeqsThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]);
}
//using the main process as a worker saves time and memory
num = driver(outputFileName, files[0], accnos, alns, numChimeras);
//Wait until all threads have terminated.
WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
//Close all thread handles and free memory allocations.
for(int i=0; i < pDataArray.size(); i++){
num += pDataArray[i]->count;
numChimeras += pDataArray[i]->numChimeras;
CloseHandle(hThreadArray[i]);
delete pDataArray[i];
}
#endif
//append output files
for(int i=0;i<processIDS.size();i++){
m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp"));
m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
if (chimealns) {
m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
}
}
//get rid of the file pieces.
for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); }
return num;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "createProcesses");
exit(1);
}
}
/**************************************************************************************************/
int ChimeraUchimeCommand::createProcessesGroups(string outputFName, string filename, string accnos, string alns, string newCountFile, vector<string> groups, string nameFile, string groupFile, string fastaFile) {
try {
processIDS.clear();
int process = 1;
int num = 0;
CountTable newCount;
if (hasCount && dups) { newCount.readTable(nameFile, true, false); }
//sanity check
if (groups.size() < processors) { processors = groups.size(); }
//divide the groups between the processors
vector<linePair> lines;
int remainingPairs = groups.size();
int startIndex = 0;
for (int remainingProcessors = processors; remainingProcessors > 0; remainingProcessors--) {
int numPairs = remainingPairs; //case for last processor
if (remainingProcessors != 1) { numPairs = ceil(remainingPairs / remainingProcessors); }
lines.push_back(linePair(startIndex, (startIndex+numPairs))); //startIndex, endIndex
startIndex = startIndex + numPairs;
remainingPairs = remainingPairs - numPairs;
}
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
//loop through and create all the processes you want
while (process != processors) {
int pid = fork();
if (pid > 0) {
processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
process++;
}else if (pid == 0){
num = driverGroups(outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", accnos + ".byCount." + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups);
//pass numSeqs to parent
ofstream out;
string tempFile = outputFName + toString(getpid()) + ".num.temp";
m->openOutputFile(tempFile, out);
out << num << endl;
out.close();
exit(0);
}else {
m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
exit(0);
}
}
//do my part
num = driverGroups(outputFName, filename, accnos, alns, accnos + ".byCount", lines[0].start, lines[0].end, groups);
//force parent to wait until all the processes are done
for (int i=0;i<processIDS.size();i++) {
int temp = processIDS[i];
wait(&temp);
}
for (int i = 0; i < processIDS.size(); i++) {
ifstream in;
string tempFile = outputFName + toString(processIDS[i]) + ".num.temp";
m->openInputFile(tempFile, in);
if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
in.close(); m->mothurRemove(tempFile);
}
#else
//////////////////////////////////////////////////////////////////////////////////////////////////////
//Windows version shared memory, so be careful when passing variables through the uchimeData struct.
//Above fork() will clone, so memory is separate, but that's not the case with windows,
//////////////////////////////////////////////////////////////////////////////////////////////////////
vector<uchimeData*> pDataArray;
DWORD dwThreadIdArray[processors-1];
HANDLE hThreadArray[processors-1];
//Create processor worker threads.
for( int i=1; i<processors; i++ ){
// Allocate memory for thread data.
string extension = toString(i) + ".temp";
uchimeData* tempUchime = new uchimeData(outputFName+extension, uchimeLocation, templatefile, filename+extension, fastaFile, nameFile, groupFile, accnos+extension, alns+extension, accnos+".byCount."+extension, groups, m, lines[i].start, lines[i].end, i);
tempUchime->setBooleans(dups, useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract, hasCount);
tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract, strand);
pDataArray.push_back(tempUchime);
processIDS.push_back(i);
//MyUchimeThreadFunction is in header. It must be global or static to work with the threads.
//default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier
hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]);
}
//using the main process as a worker saves time and memory
num = driverGroups(outputFName, filename, accnos, alns, accnos + ".byCount", lines[0].start, lines[0].end, groups);
//Wait until all threads have terminated.
WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
//Close all thread handles and free memory allocations.
for(int i=0; i < pDataArray.size(); i++){
num += pDataArray[i]->count;
CloseHandle(hThreadArray[i]);
delete pDataArray[i];
}
#endif
//read my own
if (hasCount && dups) {
if (!m->isBlank(accnos + ".byCount")) {
ifstream in2;
m->openInputFile(accnos + ".byCount", in2);
string name, group;
while (!in2.eof()) {
in2 >> name >> group; m->gobble(in2);
newCount.setAbund(name, group, 0);
}
in2.close();
}
m->mothurRemove(accnos + ".byCount");
}
//append output files
for(int i=0;i<processIDS.size();i++){
m->appendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName);
m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp"));
m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
if (chimealns) {
m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
}
if (hasCount && dups) {
if (!m->isBlank(accnos + ".byCount." + toString(processIDS[i]) + ".temp")) {
ifstream in2;
m->openInputFile(accnos + ".byCount." + toString(processIDS[i]) + ".temp", in2);
string name, group;
while (!in2.eof()) {
in2 >> name >> group; m->gobble(in2);
newCount.setAbund(name, group, 0);
}
in2.close();
}
m->mothurRemove(accnos + ".byCount." + toString(processIDS[i]) + ".temp");
}
}
//print new *.pick.count_table
if (hasCount && dups) { newCount.printTable(newCountFile); }
return num;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups");
exit(1);
}
}
/**************************************************************************************************/
|