1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508
|
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN""http://www.w3.org/TR/REC-html40/loose.dtd">
<!--NewPage-->
<HTML>
<HEAD>
<!-- Generated by javadoc on Thu Sep 11 03:19:52 BRT 2003 -->
<TITLE>
FactorSequence (NeoBio API)
</TITLE>
<LINK REL ="stylesheet" TYPE="text/css" HREF="../../stylesheet.css" TITLE="Style">
</HEAD>
<SCRIPT>
function asd()
{
parent.document.title="FactorSequence (NeoBio API)";
}
</SCRIPT>
<BODY BGCOLOR="white" onload="asd();">
<!-- ========== START OF NAVBAR ========== -->
<A NAME="navbar_top"><!-- --></A>
<TABLE BORDER="0" WIDTH="100%" CELLPADDING="1" CELLSPACING="0">
<TR>
<TD COLSPAN=3 BGCOLOR="#EEEEFF" CLASS="NavBarCell1">
<A NAME="navbar_top_firstrow"><!-- --></A>
<TABLE BORDER="0" CELLPADDING="0" CELLSPACING="3">
<TR ALIGN="center" VALIGN="top">
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../overview-summary.html"><FONT CLASS="NavBarFont1"><B>Overview</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-summary.html"><FONT CLASS="NavBarFont1"><B>Package</B></FONT></A> </TD>
<TD BGCOLOR="#FFFFFF" CLASS="NavBarCell1Rev"> <FONT CLASS="NavBarFont1Rev"><B>Class</B></FONT> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-tree.html"><FONT CLASS="NavBarFont1"><B>Tree</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../index-all.html"><FONT CLASS="NavBarFont1"><B>Index</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../help-doc.html"><FONT CLASS="NavBarFont1"><B>Help</B></FONT></A> </TD>
</TR>
</TABLE>
</TD>
<TD ALIGN="right" VALIGN="top" ROWSPAN=3><EM>
<B><EM>NeoBio</EM> API</B></EM>
</TD>
</TR>
<TR>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../neobio/alignment/Factor.html"><B>PREV CLASS</B></A>
<A HREF="../../neobio/alignment/LocalAlignmentBlock.html"><B>NEXT CLASS</B></A></FONT></TD>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../index.html" TARGET="_top"><B>FRAMES</B></A>
<A HREF="FactorSequence.html" TARGET="_top"><B>NO FRAMES</B></A>
<SCRIPT>
<!--
if(window==top) {
document.writeln('<A HREF="../../allclasses-noframe.html" TARGET=""><B>All Classes</B></A>');
}
//-->
</SCRIPT>
<NOSCRIPT>
<A HREF="../../allclasses-noframe.html" TARGET=""><B>All Classes</B></A>
</NOSCRIPT>
</FONT></TD>
</TR>
<TR>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
SUMMARY: NESTED | <A HREF="#field_summary">FIELD</A> | <A HREF="#constructor_summary">CONSTR</A> | <A HREF="#method_summary">METHOD</A></FONT></TD>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
DETAIL: <A HREF="#field_detail">FIELD</A> | <A HREF="#constructor_detail">CONSTR</A> | <A HREF="#method_detail">METHOD</A></FONT></TD>
</TR>
</TABLE>
<!-- =========== END OF NAVBAR =========== -->
<HR>
<!-- ======== START OF CLASS DATA ======== -->
<H2>
<FONT SIZE="-1">
neobio.alignment</FONT>
<BR>
Class FactorSequence</H2>
<PRE>
java.lang.Object
|
+--<B>neobio.alignment.FactorSequence</B>
</PRE>
<HR>
<DL>
<DT>public class <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.101"><B>FactorSequence</B></A><DT>extends java.lang.Object</DL>
<P>
This class builds a list of factors of a character sequence as induced by its
Lempel-Ziv (LZ78) factorisation. Each factor is enconded as the longest factor
previously seen plus one character.
<P>The input can come from any source, provided it is encapsulated in a proper
<CODE>Reader</CODE> instance. The stream is expected to be ready (i.e. the next
<CODE>read</CODE> operation must return the first character of the sequence) and it is
not closed when its end is reached, so the client is allowed to reset it and maybe use
it for another purpose.</P>
<P>Sequences can contain letters only although lines started with the
<CODE>COMMENT_CHAR</CODE> character ('>') are regarded as comments and are completely
skipped. White spaces (including tabs, line feeds and carriage returns) are also
ignored throughout.</P>
<P>This class uses a <A HREF="../../neobio/alignment/Trie.html">Trie</A> to keep track of a list of factors. Each node of
the trie contains a <A HREF="../../neobio/alignment/Factor.html">Factor</A> of the text. As the sequence is read from the
input, the trie is traversed as far as possible. When a leaf node is reached (which
means that the longest prefix of the input has been found), two tasks are
accomplished:</P>
<UL>
<LI>a new <CODE>Factor</CODE> is created with the character at the current position of
the input and the leaf node's factor;
<LI>a new node is added to the trie with the character at the current position of the
input;
</UL>
<P>Each factor also receives a serial number according to the order they are found and
a pointer to the next factor (in that order) for fast access. This pointer, together
with the factor's ancestor pointer forms a doubly-linked list of factors. The original
text can then be reconstructed simply by following the linked list and writing out its
factors.</P>
<P>As an example, the sequence <CODE>ACTAAACCGCATTAATAATAAAA</CODE> is parsed into the
following 12 factors:</P>
<CODE><BLOCKQUOTE><PRE>
0 ( , ) = empty
1 (0,A) = A
2 (0,C) = C
3 (0,T) = T
4 (1,A) = AA
5 (1,C) = AC
6 (2,G) = CG
7 (2,A) = CA
8 (3,T) = TT
9 (4,T) = AAT
10 (9,A) = AATA
11 (4,A) = AAA
serial # (prefix, new char) = factor text
</PRE></BLOCKQUOTE></CODE>
<P>This class is used by <A HREF="../../neobio/alignment/CrochemoreLandauZivUkelson.html">CrochemoreLandauZivUkelson</A> algorithm to speed up
the classic dynamic programming approach to sequence alignment.</P>
<P>
<P>
<DL>
<DT><B>Author:</B><DD>Sergio A. de Carvalho Jr.</DD>
</DD>
<DT><B>See Also:</B><DD><A HREF="../../neobio/alignment/Factor.html"><CODE>Factor</CODE></A>,
<A HREF="../../neobio/alignment/Trie.html"><CODE>Trie</CODE></A>,
<A HREF="../../neobio/alignment/CrochemoreLandauZivUkelson.html"><CODE>CrochemoreLandauZivUkelson</CODE></A></DL>
<HR>
<P>
<!-- ======== NESTED CLASS SUMMARY ======== -->
<!-- =========== FIELD SUMMARY =========== -->
<A NAME="field_summary"><!-- --></A>
<TABLE BORDER="1" CELLPADDING="3" CELLSPACING="0" WIDTH="100%">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=2><FONT SIZE="+2">
<B>Field Summary</B></FONT></TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE>protected static char</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#COMMENT_CHAR">COMMENT_CHAR</A></B></CODE>
<BR>
The character used to start a comment line in a sequence file. </TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE>protected int</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#num_chars">num_chars</A></B></CODE>
<BR>
The numbers of character represented by this sequence.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE>protected int</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#num_factors">num_factors</A></B></CODE>
<BR>
The numbers of factors generated by the LZ78 parsing of the sequence.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE>protected <A HREF="../../neobio/alignment/Factor.html">Factor</A></CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#root_factor">root_factor</A></B></CODE>
<BR>
A pointer to the root factor, the one that starts the list of factors.</TD>
</TR>
</TABLE>
<!-- ======== CONSTRUCTOR SUMMARY ======== -->
<A NAME="constructor_summary"><!-- --></A>
<TABLE BORDER="1" CELLPADDING="3" CELLSPACING="0" WIDTH="100%">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=2><FONT SIZE="+2">
<B>Constructor Summary</B></FONT></TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#FactorSequence(java.io.Reader)">FactorSequence</A></B>(java.io.Reader reader)</CODE>
<BR>
Creates a new instance of a <CODE>FactorSequence</CODE>, loading the sequence data
from the <CODE>Reader</CODE> input stream. </TD>
</TR>
</TABLE>
<!-- ========== METHOD SUMMARY =========== -->
<A NAME="method_summary"><!-- --></A>
<TABLE BORDER="1" CELLPADDING="3" CELLSPACING="0" WIDTH="100%">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=2><FONT SIZE="+2">
<B>Method Summary</B></FONT></TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> <A HREF="../../neobio/alignment/Factor.html">Factor</A></CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#getRootFactor()">getRootFactor</A></B>()</CODE>
<BR>
Returns the root factor, the one that starts the list of factors.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> int</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#numChars()">numChars</A></B>()</CODE>
<BR>
Returns the number of characters of the original sequence.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> int</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#numFactors()">numFactors</A></B>()</CODE>
<BR>
Returns the number of factors produced by the LZ78 parsing of the text.</TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> java.lang.String</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#printFactors()">printFactors</A></B>()</CODE>
<BR>
Returns a string representation of the actual list of factors produced by the LZ78
parsing of the text. </TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1">
<CODE> java.lang.String</CODE></FONT></TD>
<TD><CODE><B><A HREF="../../neobio/alignment/FactorSequence.html#toString()">toString</A></B>()</CODE>
<BR>
Reconstructs the sequence from the list of factors induced by the LZ78 parsing of
the text.</TD>
</TR>
</TABLE>
<A NAME="methods_inherited_from_class_java.lang.Object"><!-- --></A>
<TABLE BORDER="1" CELLPADDING="3" CELLSPACING="0" WIDTH="100%">
<TR BGCOLOR="#EEEEFF" CLASS="TableSubHeadingColor">
<TD><B>Methods inherited from class java.lang.Object</B></TD>
</TR>
<TR BGCOLOR="white" CLASS="TableRowColor">
<TD><CODE>clone, equals, finalize, getClass, hashCode, notify, notifyAll, wait, wait, wait</CODE></TD>
</TR>
</TABLE>
<P>
<!-- ============ FIELD DETAIL =========== -->
<A NAME="field_detail"><!-- --></A>
<TABLE BORDER="1" CELLPADDING="3" CELLSPACING="0" WIDTH="100%">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=1><FONT SIZE="+2">
<B>Field Detail</B></FONT></TD>
</TR>
</TABLE>
<A NAME="COMMENT_CHAR"><!-- --></A><H3>
COMMENT_CHAR</H3>
<PRE>
protected static final char <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.107"><B>COMMENT_CHAR</B></A></PRE>
<DL>
<DD>The character used to start a comment line in a sequence file. When this character
is found, the rest of the line is ignored.
<P>
<DL>
<DT><B>See Also:</B><DD><A HREF="../../constant-values.html#neobio.alignment.FactorSequence.COMMENT_CHAR">Constant Field Values</A></DL>
</DL>
<HR>
<A NAME="root_factor"><!-- --></A><H3>
root_factor</H3>
<PRE>
protected <A HREF="../../neobio/alignment/Factor.html">Factor</A> <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.112"><B>root_factor</B></A></PRE>
<DL>
<DD>A pointer to the root factor, the one that starts the list of factors.
<P>
<DL>
</DL>
</DL>
<HR>
<A NAME="num_chars"><!-- --></A><H3>
num_chars</H3>
<PRE>
protected int <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.117"><B>num_chars</B></A></PRE>
<DL>
<DD>The numbers of character represented by this sequence.
<P>
<DL>
</DL>
</DL>
<HR>
<A NAME="num_factors"><!-- --></A><H3>
num_factors</H3>
<PRE>
protected int <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.122"><B>num_factors</B></A></PRE>
<DL>
<DD>The numbers of factors generated by the LZ78 parsing of the sequence.
<P>
<DL>
</DL>
</DL>
<!-- ========= CONSTRUCTOR DETAIL ======== -->
<A NAME="constructor_detail"><!-- --></A>
<TABLE BORDER="1" CELLPADDING="3" CELLSPACING="0" WIDTH="100%">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=1><FONT SIZE="+2">
<B>Constructor Detail</B></FONT></TD>
</TR>
</TABLE>
<A NAME="FactorSequence(java.io.Reader)"><!-- --></A><H3>
FactorSequence</H3>
<PRE>
public <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.133"><B>FactorSequence</B></A>(java.io.Reader reader)
throws java.io.IOException,
<A HREF="../../neobio/alignment/InvalidSequenceException.html">InvalidSequenceException</A></PRE>
<DL>
<DD>Creates a new instance of a <CODE>FactorSequence</CODE>, loading the sequence data
from the <CODE>Reader</CODE> input stream. A doubly-linked list of factors is built
according to its LZ78 factorisation.
<P>
<DT><B>Parameters:</B><DD><CODE>reader</CODE> - source of characters for this sequence
<DT><B>Throws:</B>
<DD><CODE>java.io.IOException</CODE> - if an I/O exception occurs when reading the input
<DD><CODE><A HREF="../../neobio/alignment/InvalidSequenceException.html">InvalidSequenceException</A></CODE> - if the input does not contain a valid sequence</DL>
<!-- ============ METHOD DETAIL ========== -->
<A NAME="method_detail"><!-- --></A>
<TABLE BORDER="1" CELLPADDING="3" CELLSPACING="0" WIDTH="100%">
<TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor">
<TD COLSPAN=1><FONT SIZE="+2">
<B>Method Detail</B></FONT></TD>
</TR>
</TABLE>
<A NAME="getRootFactor()"><!-- --></A><H3>
getRootFactor</H3>
<PRE>
public <A HREF="../../neobio/alignment/Factor.html">Factor</A> <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.220"><B>getRootFactor</B></A>()</PRE>
<DL>
<DD>Returns the root factor, the one that starts the list of factors.
<P>
<DD><DL>
<DT><B>Returns:</B><DD>root factor</DL>
</DD>
</DL>
<HR>
<A NAME="numFactors()"><!-- --></A><H3>
numFactors</H3>
<PRE>
public int <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.230"><B>numFactors</B></A>()</PRE>
<DL>
<DD>Returns the number of factors produced by the LZ78 parsing of the text.
<P>
<DD><DL>
<DT><B>Returns:</B><DD>number of factors</DL>
</DD>
</DL>
<HR>
<A NAME="numChars()"><!-- --></A><H3>
numChars</H3>
<PRE>
public int <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.240"><B>numChars</B></A>()</PRE>
<DL>
<DD>Returns the number of characters of the original sequence.
<P>
<DD><DL>
<DT><B>Returns:</B><DD>number of characters of the original sequence</DL>
</DD>
</DL>
<HR>
<A NAME="toString()"><!-- --></A><H3>
toString</H3>
<PRE>
public java.lang.String <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.251"><B>toString</B></A>()</PRE>
<DL>
<DD>Reconstructs the sequence from the list of factors induced by the LZ78 parsing of
the text.
<P>
<DD><DL>
<DT><B>Overrides:</B><DD><CODE>toString</CODE> in class <CODE>java.lang.Object</CODE></DL>
</DD>
<DD><DL>
<DT><B>Returns:</B><DD>the original sequence</DL>
</DD>
</DL>
<HR>
<A NAME="printFactors()"><!-- --></A><H3>
printFactors</H3>
<PRE>
public java.lang.String <A HREF="../../src-html\neobio\alignment\FactorSequence.html#line.276"><B>printFactors</B></A>()</PRE>
<DL>
<DD>Returns a string representation of the actual list of factors produced by the LZ78
parsing of the text. Each factor is printed out in a separate line, in the order
they appear in the text, with its serial number, its ancestor's serial number, its
new character, length and a string representation of the factor itself.
<P>
<DD><DL>
<DT><B>Returns:</B><DD>a string representation of the list of factors</DL>
</DD>
</DL>
<!-- ========= END OF CLASS DATA ========= -->
<HR>
<!-- ========== START OF NAVBAR ========== -->
<A NAME="navbar_bottom"><!-- --></A>
<TABLE BORDER="0" WIDTH="100%" CELLPADDING="1" CELLSPACING="0">
<TR>
<TD COLSPAN=3 BGCOLOR="#EEEEFF" CLASS="NavBarCell1">
<A NAME="navbar_bottom_firstrow"><!-- --></A>
<TABLE BORDER="0" CELLPADDING="0" CELLSPACING="3">
<TR ALIGN="center" VALIGN="top">
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../overview-summary.html"><FONT CLASS="NavBarFont1"><B>Overview</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-summary.html"><FONT CLASS="NavBarFont1"><B>Package</B></FONT></A> </TD>
<TD BGCOLOR="#FFFFFF" CLASS="NavBarCell1Rev"> <FONT CLASS="NavBarFont1Rev"><B>Class</B></FONT> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="package-tree.html"><FONT CLASS="NavBarFont1"><B>Tree</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../index-all.html"><FONT CLASS="NavBarFont1"><B>Index</B></FONT></A> </TD>
<TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../help-doc.html"><FONT CLASS="NavBarFont1"><B>Help</B></FONT></A> </TD>
</TR>
</TABLE>
</TD>
<TD ALIGN="right" VALIGN="top" ROWSPAN=3><EM>
<A TARGET="_blank" HREF="http://sourceforge.net"><IMG SRC="http://sourceforge.net/sflogo.php?group_id=87937&type=2" WIDTH="125" HEIGHT="37" BORDER="0" ALT="SourceForge.net" /></A></EM>
</TD>
</TR>
<TR>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../neobio/alignment/Factor.html"><B>PREV CLASS</B></A>
<A HREF="../../neobio/alignment/LocalAlignmentBlock.html"><B>NEXT CLASS</B></A></FONT></TD>
<TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2">
<A HREF="../../index.html" TARGET="_top"><B>FRAMES</B></A>
<A HREF="FactorSequence.html" TARGET="_top"><B>NO FRAMES</B></A>
<SCRIPT>
<!--
if(window==top) {
document.writeln('<A HREF="../../allclasses-noframe.html" TARGET=""><B>All Classes</B></A>');
}
//-->
</SCRIPT>
<NOSCRIPT>
<A HREF="../../allclasses-noframe.html" TARGET=""><B>All Classes</B></A>
</NOSCRIPT>
</FONT></TD>
</TR>
<TR>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
SUMMARY: NESTED | <A HREF="#field_summary">FIELD</A> | <A HREF="#constructor_summary">CONSTR</A> | <A HREF="#method_summary">METHOD</A></FONT></TD>
<TD VALIGN="top" CLASS="NavBarCell3"><FONT SIZE="-2">
DETAIL: <A HREF="#field_detail">FIELD</A> | <A HREF="#constructor_detail">CONSTR</A> | <A HREF="#method_detail">METHOD</A></FONT></TD>
</TR>
</TABLE>
<!-- =========== END OF NAVBAR =========== -->
<HR>
<FONT SIZE=-1><script language="JavaScript" type="text/javascript" src="http://m1.nedstatbasic.net/basic.js"></script><script language="JavaScript" type="text/javascript" ><!--
nedstatbasic("ACZ/LArmjx/k+DNHUelcrNt5+qIQ", 0);
--></script><noscript><a target="_blank" href="http://v1.nedstatbasic.net/stats?ACZ/LArmjx/k+DNHUelcrNt5+qIQ"><img src="http://m1.nedstatbasic.net/n?id=ACZ/LArmjx/k+DNHUelcrNt5+qIQ" border="0" nosave width="18" height="18" alt="Nedstat Basic - Free web site statistics"></a></noscript><A TARGET="_blank" HREF="http://neobio.sourceforge.net">http://neobio.sourceforge.net</A><BR><EM>NeoBio</EM> is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. <EM>NeoBio</EM> is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with NeoBio; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307, USA.</FONT><BR>
</BODY>
</HTML>
|