File: release_notes.txt

package info (click to toggle)
primer3 2.4.0-4
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, sid
  • size: 134,560 kB
  • sloc: ansic: 16,336; perl: 1,595; makefile: 262; sh: 54
file content (802 lines) | stat: -rw-r--r-- 29,250 bytes parent folder | download | duplicates (2)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
release 2.4.0 2017-11-03  ===============================================
This release adds a new feature to primer3_core and related C code.

PCR PRIMER DESIGN TEMPLATE MASKING BEFORE PRIMER DESIGN. This feature
helps to prevent designing primers to template regions that are repetitive.
Primers with more binding sites tend to have higher failure rates. The
masking is based on statistical model (see Documentation for details).

NEW INPUT TAGS AND DEFAULT VALUES:
PRIMER_MASK_TEMPLATE=0
PRIMER_FAILURE_RATE=0.1
PRIMER_MASK_5P_DIRECTION=1
PRIMER_MASK_3P_DIRECTION=1
PRIMER_MASKING_LIST_PREFIX=homo_sapiens
PRIMER_WT_FAILURE_RATE=0.0
PRIMER_KMER_LISTS_PATH=../kmer_lists/

See the documentation for details. The tag PRIMER_MASK_TEMPLATE directs
primer3_core to premask template sequence for primer design.

NEW EXECUTABLE: primer3_masker

masker masks repetitive regions in INPUTFILE (given as fasta and/or multiple
fasta format) based on statistical approach.

IMPORTANT: because PRIMER_MASK_TEMPLATE=1,
PRIMER_KMER_LISTS_PATH must point to the right location.
This tag specifies the path to the directory that contains kmer list files
used by the template masking approach. The default location: ../kmer_lists/  If  the
list files are not in that location, be sure to set
PRIMER_KMER_LISTS_PATH

By default, directory ../kmer_lists/ contains example kmers. Software for
making kmers can be downloaded http://bioinfo.ut.ee/FastGT/index.php?r=site/index
Premade list files can be downloaded from: http://primer3.ut.ee/lists.htm

In 2016:
Major correction:
1. The long primer3_core comand line options with single hyphen (-myargs) 
   are depreciated. Use double hyphens (--myargs) instead. 

2. The PRIMER_TASK pick_discriminative_primers was modified. Now the primer
   border the provided SEQUENCE_TARGET and do not overlap by one basepair.

Minor fixes:
1. The test scripts were updated to use the default valgrind path and to
   use the --type comand line arguments instead of -type.

2. In thal.c the function finite() was replaced by the c99 isfinite().

3. In libprimer3 all abort() functions were removed and error handling
   implemented.


release 2.3.7 2016-02-18 ===============================================

Major correction:

In some cases, ntthal resulted with two different dimer structures depending
on the order of the two oligo sequences were given by the user. 

For example:

ntthal -s1 ACTGGAAAGAGGAAGGACTGGT -s2 TGGGACATCTCTATACCTTCCTCT

Calculated thermodynamical parameters for dimer:        dS = -207.817 dH = -73000     dG = -8545.56   t = 26.0559
SEQ     ACTGGAAA        ACTGGT---------
SEQ             GAGGAAGG
STR             CTCCTTCC
STR            T        ATATCTCTACAGGGT


If the order of two oligo sequences change places, ntthal resulted with
other structure and other values of thermodynamic parameters.

ntthal -s2 ACTGGAAAGAGGAAGGACTGGT -s1 TGGGACATCTCTATACCTTCCTCT

Calculated thermodynamical parameters for dimer:        dS = -290.416 dH = -93600     dG = -3527.63   t = 13.4587
SEQ     TGGGA  TCTCTATA        T-------
SEQ          CA        CCTTCCTC
STR          GT        GGAAGGAG
STR        TG  CA------        AAAGGTCA


What was modified in the code:

1. calculation of melting temperature values were replaced with calculation
of dG values as calculating Tm values cannot result always the most stabile
dimer as dimers melting temperature depends significantly on salt correction
2. Dimers 5` end stability was calculated only when the most stabile dimer
was found. Now 5` ends stability is also considered at each dynamic
programming stage.
3. Some values of thermodynamic table were changed as they were not
symmetrical
4. Although AT dangling ends are more stable than AT pairing, ntthal now
prefers AT pairing to AT dangling end.

Now primer3 results:
ntthal -s1 ACTGGAAAGAGGAAGGACTGGT -s2 TGGGACATCTCTATACCTTCCTCT

Calculated thermodynamical parameters for dimer:        dS = -198.019   dH = -69700     dG = -8284.27   t = 24.4823
SEQ     ACTGGAA         ACTGGT---------
SEQ            AGAGGAAGG
STR            TCTCCTTCC
STR                     ATATCTCTACAGGGT

ntthal -s2 ACTGGAAAGAGGAAGGACTGGT -s1 TGGGACATCTCTATACCTTCCTCT

Calculated thermodynamical parameters for dimer:        dS = -198.019   dH = -69700     dG = -8284.27   t = 24.4823
SEQ     TGGGACATCTCTATA         -------
SEQ                    CCTTCCTCT
STR                    GGAAGGAGA
STR              TGGTCA         AAGGTCA

We have also added tests for this bug.

Minor fixes:

1. updated oligotm executable to accept float values as input for the 
concentration of monovalent cations and for concentration of DNA strands.

release 2.3.6 2013-10-22 ===============================================

Important changes:

1. Four new input tags were added:
- PRIMER_MUST_MATCH_THREE_PRIME
- PRIMER_MUST_MATCH_FIVE_PRIME
- PRIMER_INTERNAL_MUST_MATCH_THREE_PRIME
- PRIMER_INTERNAL_MUST_MATCH_FIVE_PRIME
The MUST_MATCH tags allow to define 5 nt patterns which the first and 
the last five bases of a primer or oligo have to match. For example, 
the pattern "NNGTN" would require the 3rd and 2nd last bases to be G and 
T respectively.

Minor fixes:

1. Fixed two bugs in ntdpal and oligotm that caused segmentation fault
whenever these binaries were called without specifying a given
option value.

release 2.3.5 2013-01-03 ===============================================

Important changes:

1. The tag PRIMER_THERMODYNAMIC_ALIGNMENT was replaced by two new tags:

   - PRIMER_THERMODYNAMIC_OLIGO_ALIGNMENT which governs hairpin 
and oligo-oligo interactions. Therefore, whenever it is set to 1 
(the default) thermodynamic alignments will be used for oligo-
oligo interactions and hairpins.

   - PRIMER_THERMODYNAMIC_TEMPLATE_ALIGNMENT which governs the 
oligo-template interactions and, when set to 1 (default is 0), will 
cause primer3 to use the thermodynamic alignment against templates.

The reason for this change is to provide the option of using the 
old alignment for oligo-template interactions when the thermodynamic 
alignment is too slow or the template is too long (there is a hard 
limit THAL_MAX_SEQ=10k on the length of sequences involved in 
thermodynamic alignments).

1.1 Added corresponding functions to libprimer3.c and libprimer3.h:

p3_set_gs_primer_thermodynamic_oligo_alignment
p3_set_gs_primer_thermodynamic_template_alignment

2. Modified the error handling of non-memory related errors that
can occur during the thermodynamic alignment. They are no longer
fatal errors.

3. Made a performance improvement for the case when thermodynamic 
alignment is used for templates: the alignment is done only once
for each oligo and the result is kept. This way we avoid performing
the same expensive alignment more than once.

4. Removed io_version 3, which was only kept for backward compatibility
with very old versions of primer3.

5. Fixed an error in which PRIMER_DNTP_CONC > PRIMER_SALT_DIVALENT causes 
Primer3 to crash.

6. Fixed a bug that made Primer3 not generate results in some cases
when PRIMER_FIRST_BASE_INDEX is negative.

Minor corrections:

1. Added function p3_set_max_end_gc (sets max_end_gc in the
primer_global_settings struct).

2. Removed intentional compile time division by zero in thal.c if
macro INFINITY is defined.

3. Updated text in error messages from function thal() to make them
more informative.

release 2.3.4 2012-05-30 ===============================================

Major correction:

1. Fixed error in which PRIMER_..._..._TEMPLATE_MISPRIMING_TH was
   calculated incorrectly in libprimer3.c

release 2.3.3 2012-05-18 ===============================================

Major correction:

1. Fixed error in which non-default values of monovalent and divalent
salt concentrations and non-default values of dNTP and DNA
concentrations were being ignored in thermodynamic calculations.

release 2.3.2 2012-03-15 ===============================================

Minor corrections:

1. _Removed_ warning if PRIMER_INTERNAL_SALT_DIVALENT > 0.0 but
PRIMER_INTERNAL_DNTP_CONC <= 0.0.  (dNTPs not used in hybridizations.)

release 2.3.1 2012-02-27 ===============================================

Minor corrections:

1. Added warnings if PRIMER_SALT_DIVALENT > 0.0 but PRIMER_DNTP_CONC
<= 0.0 or PRIMER_INTERNAL_SALT_DIVALENT > 0.0 but
PRIMER_INTERNAL_DNTP_CONC <= 0.0.

2. No longer an error if a settings file has
PRIMER_THERMODYNAMIC_ALIGNMENT=1 but does not have a valid
PRIMER_THERMODYNAMIC_PARAMETERS_PATH.
(PRIMER_THERMODYNAMIC_PARAMETERS_PATH can then be set in the regular
boulder IO input stream.)

3. Updates to documetation on salt corrections.

4. Corrections to primer3web_v3_0_0_default_settings.txt (removed
non-existent tags and removed the setting of
PRIMER_THERMODYNAMIC_PARAMETERS_PATH)

5. Removed un-needed files from distribution .tar.gz file.

6. Removed the -i option from the oligotm executable, as the
necessary information is in the Primer3 manual.

7. Updated PRIMER_PRODUCT_SIZE_RANGE in
primer3web_v3_0_0_default_settings to same value as in previous
version of primer3web.

release 2.3.0 2012-02-03 ===============================================

1. *** We changed the following default values:

1.1 Changing default oligo temperature calculations

PRIMER_TM_FORMULA=1  (was 0)
PRIMER_SALT_CORRECTIONS=1 (was 0)

1.2 Making thermodynamic secondary structure calculations the default:

PRIMER_THERMODYNAMIC_ALIGNMENT=1 (was 0)

1.3 The following need reasonable values to support the changes in 1.1
and 1.2 above:

PRIMER_SALT_DIVALENT=1.5 (was 0.0)
PRIMER_DNTP_CONC=0.6 (was 0.0)

1.4 To make old defaults easily accessible, we added a command line
argument, --default_version=1, which directs primer3_core to use the
old defaults. --default_version=2 directs primer3_core to use the new
defaults.  The default is --default_version=2.

1.5 IMPORTANT: because PRIMER_THERMODYNAMIC_ALIGNMENT=1,
PRIMER_THERMODYNAMIC_PARAMETERS_PATH must point to the right location.
This tag specifies the path to the directory that contains all the
parameter files used by the thermodynamic approach. In Debian, there
are two *default* locations that are tested if this tag is not
defined: ./primer3_config/ and /etc/primer3_config/. For Windows,
there is only one default location: .\primer3_config\.  If the the
parameter files are not in one these locations, be sure to set
PRIMER_THERMODYNAMIC_PARAMETERS_PATH

1.6 Changed default for 

PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS=0 (was 1)

(0 is almost always the the behavior one wants.)

1.7 To get the behavior of -default_version=1 when -default_version=2
set the following:

PRIMER_TM_FORMULA=0
PRIMER_SALT_CORRECTIONS=0
PRIMER_THERMODYNAMIC_ALIGNMENT=0
PRIMER_SALT_DIVALENT=0.0
PRIMER_DNTP_CONC=0.0
PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS=1

1.8 To get the behavior of -default_version=2 when -default_version=1
set the following:

PRIMER_TM_FORMULA=1
PRIMER_SALT_CORRECTIONS=1
PRIMER_THERMODYNAMIC_ALIGNMENT=1
PRIMER_SALT_DIVALENT=1.5
PRIMER_DNTP_CONC=0.6
PRIMER_LIB_AMBIGUITY_CODES_CONSENSUS=0

2. We changed the NULL value for SEQUENCE_FORCE_{LEFT,RIGHT}_START_END to
-1000000, and made it an error to select PRIMER_FIRST_BASE_INDEX <=
this value.  This is to correct an error when
SEQUENCE_FORCE_{LEFT,RIGHT}_START_END was -1 (value previously used to
indicate a NULL) but PRIMER_FIRST_BASE_INDEX was < 0, which caused the
intended NULL value (-1) to be treated as a constraint on primer
location (a constraint that was not possible to satisfy).

3. We changed the PRIMER_TASK called 'pick_detection_primers' to
'generic' while retaining 'pick_detection_primers' as an alias for
backward compatibility.

4. The code now uses 'end' alignments when assessing template mispriming
using thermodynamic alignments. This is consistent with the approach
taken with the previous alignment algorithm and with checking for
mispriming against repeat libraries.

4. We removed PRIMER_PAIR_MAX_HAIRPIN_TH (which was ignored previously).

5. Primer3 now requires the user to set SEQUENCE_TARGET, not
SEQUENCE_INCLUDED_REGION when PRIMER_TASK=pick_discriminative_primers

5. When PRIMER_TASK=pick_discriminative_primers or
PRIMER_TASK=pick_cloning_primers the value of SEQUENCE_INCLUDED_REGION
is no longer changed to the entire input sequence.

6. The handling of divalent cations when PRIMER_SALT_CORRECTIONS=2
(not the default and not the recommended value) has been updated. The
rationale is that, when divalent cations are present, the formula by
Owczarzy et al., 2004 (used previously by Primer3) can be improved
upon as described in (Ahsen et al., 2010; Owczarzy et al.,
2008). Therefore we have updated the melting temperature calculation
to follow the scheme in Figure 9 of (Owczarzy et al., 2008). Please
find references to these papers in the Primer3 manual.

7. In addition, several error corrections:

7.1 Corrected a short, fixed-size buffer for the file/path names specified
by the command line arguments -output, -error and for the settings
file.

7.2 Two other corrected errors were in p3_set_gs_primer_self_end and
p3_set_gs_primer_internal_oligo_self_end, which erroneously multiplied
their 'val' arguments by 100.

7.3 Primer3 now detects and handles the situation in which user-supplied
primers (SEQUENCE_PRIMER and SEQUENCE_PRIMER_REVCOMP) have the left
primer to the right of the right primer.  Also issue a warning if
user-supplied primers occur in more than one location in the template.

release 2.2.3 2010-07-08 ===============================================

Minor error corrections, minor cleanup.
This is a stable release.

release 2.2.2 beta 2010-03-04 ==========================================

This release adds a performance enhancement for inputs involving
SEQUENCE_PRIMER_PAIR_OK_REGION_LIST.

This release adds two new tags, PRIMER_MIN_LEFT_THREE_PRIME_DISTANCE
and PRIMER_MIN_RIGHT_THREE_PRIME_DISTANCE

release 2.2.1 alpha 2009-10-28 ==========================================

This release adds several performance enhancements.

release 2.2.0 alpha 2009-10-23 ==========================================

This release adds multiple new features to primer3_core and related
C code.

The enhancements fall under several categories:

1. PRIMER/OLIGO SECONDARY STRUCTURE AND PRIMER-DIMER AND TEMPLATE
MISPRIMING PREDICTION

We added capabilities for predicting secondary structure,
primer-dimer, and template mispriming based on a thermodynamic model.

INPUT/OUTPUT TAGS:

Added tags PRIMER_THERMODYNAMIC_ALIGNMENT,
PRIMER_INTERNAL_MAX_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISHYB_TH},
PRIMER_INTERNAL_WT_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISHYB_TH},
PRIMER_MAX_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISPRIMING_TH},
PRIMER_PAIR_MAX_{COMPL_ANY_TH,COMPL_END_TH,HAIRPIN,TEMPLATE_MISPRIMING_TH},
PRIMER_PAIR_WT_{COMPL_ANY_TH,COMPL_END_TH,HAIRPIN,TEMPLATE_MISPRIMING_TH},
PRIMER_WT_{HAIRPIN,SELF_ANY_TH,SELF_END_TH,TEMPLATE_MISPRIMING_TH}

See the documentation for details. The tag
PRIMER_THERMODYNAMICAL_ALIGNMENT=1 directs primer3_core to use the
thermodynamic alignments.

NEW EXECUTABLE: ntthal

ntthal is analogous to ntdpal.  Between two sequences, ntthal finds
alignment/sec structure, that has the highest melting
temperature. Ntthal is based on nearest-neighbor thermodynamical
approach.  For input parameters to ntthal, execute: ./ntthal (without
arguments).

2. NEW COMMAND LINE FLAGS AND ARGUMENTS

primer3_core now has a more conventional command line.  For example,
you can type

primer3_core -output my_output -error my_error my_input

and primer3_core will take its input from my_input and put
its outputs in the files my_output and my_error.  There
is also a command line flag -echo_settings_file to cause
the settings file contents to be echoed to output.

3. NEW INPUT TAGS TO CONTROL PRIMER LOCATION

See the documentation for SEQUENCE_PRIMER_PAIR_OK_REGION_LIST.  Tags
SEQUENCE_OVERLAP_JUNCTION_LIST,
PRIMER_MIN_3_PRIME_OVERLAP_OF_JUNCTION,
PRIMER_MIN_5_PRIME_OVERLAP_OF_JUNCTION have _replaced_
SEQUENCE_PRIMER_OVERLAP_POS and PRIMER_POS_OVERLAP_TO_END_DIST.  See
the documentation.

4. PERFORMANCE IMPROVEMENTS

release 2.0.0 alpha 2008-12-15 ==========================================

 This is major release, involving enhancements to functionality,
  software architecture, and input and output conventions.

 INPUT/OUTPUT CHANGES:

 * A new command line flag, -io_version=3 provides backward compatible
   behavior for boulder IO input, and boulder IO output that is
   backward compatible except for error messages, warnings, and the
   text of PRIMER...EXPLAIN tags.

 * -io_version=3 IS NOT the default -- you must specify it on the
   command line.
  
 For the new default IO, we renamed many Boulder IO INPUT/OUTPUT TAGS
  for clarification and easier integration into scripts
  
 NEW OR IMPROVED FUNCTIONALITY:
   
 Primer3 'settings' files were added.  A settings file can be read in
  at program start up to set global parameters.  Our intent is that
  parameter values suitable for particular primer design objectives
  can be easily stored and re-used.

 We added new "tasks" such as selection of primer lists, sequencing
  primers, or cloning primers, or the checking of primers or primer pairs
  in the absence of a target sequence. See tag PRIMER_TASK.
 
 It is now possible to request only unique primers when multiple
  primer pairs are requested.  (In the past, each _pair_ was unique,
  but the same primer might occur in more than one pair).  The user
  also has some control over what constitutes a 'unique' primer. See
  tag PRIMER_MIN_THREE_PRIME_DISTANCE.

 When an illegal primer pair is specified for checking primer3, the
  program now assess it.  In the past, primer3 assessed individual
  primers if they violated a constraint, but in some cases not pairs
  that violated constraints on pairs (such as product size).

 We added new functionality with tags 
  SEQUENCE_PRIMER_OVERLAP_POS, PRIMER_POS_OVERLAP_TO_END_DIST,
  PRIMER_MAX_END_GC.  Please see the documentation.

 We added tags PRIMER_PAIR_MAX_COMPL_END and
  PRIMER_PAIR_MAX_COMPL_ANY, which previously took the same values as
  PRIMER_SELF_{END,ANY}

 OTHER CHANGES TO BEHAVIOR:

 We corrected a few errors and a mis-feature in the ways in which
  primer3 searches for primer pairs. Consequently, the latest version
  of primer3 will return different sets of primer pairs in a few
  instances.
  
 INTERNAL CHANGES:

 It is now possible to use the main primer3 functionality from a
  single C function. We cleanly separated the functionality of reading
  in Boulder IO records from the primer choosing / designing
  functionality.  We also substantially simplified the organization
  and documentation of the main primer picking code, now in
  libprimer3.[ch].  The file libprimer3.h specifies the external
  interface, although it is not separately documented. It is also
  possible to create a binary library file that provides this
  functionality (libprimer3.a or libprimer3.so in Unix/Linux).  All C
  code is ANSI C.

release 1.1.2 2007-06-10 ================================================

 Updates to dpal.c so that no error forces an exit.
 Adaptation in primer3_main.c and ntdpal_main.c to 
   updated error handling in dpal().
 Arranged for primer3_main.c align() to check for
   and circumvent local alignments to "targets" < nucleotides
   long, and added tests for this condition.
 Comment and code readability updates in dpal.h and dpal.c

release 1.1.1 3/37/2007 ==================================================

 Minor corrections

release 1.1.0 1/17/2007 ==================================================

 Added tags PRIMER_TM_SANTALUCIA, PRIMER_SALT_CORRECTIONS,
   PRIMER_LOWERCASE_MASKING, PRIMER_DIVALENT_CONC,
   and PRIMER_DNTP_CONC.  See the README for
   details of what these tags do.  Briefly, the first two
   tags allow the use of modern melting temperature 
   calculations.  New tests for this functionality
   were added to the tests/ subdirectory

 NOTE: The oligotm executable now takes additional
   arguments.

 Cleaned up Makefile, and created Makefile for the test
   directory with a target to clean up after tests

 Most (but not all) temporary files created by the
   tests now end in .tmp or .tmp2

 Tried to create more informative test for 
   MAX_PRIMER_LENGTH > DPAL_MAX_ALIGN in primer3_main.c

 NOTE: The oligtotm() function is now provided as
   a library, liboligotm.

 NOTE: non-backward compatible change: removed support of
   flag -2x_compat.

release 1.0.1 11/06 ==================================================

 Identical to 1.0b except for release number

release 1.0b 11/06 ==================================================

  Corrected bug involving check for template mispriming
  Minor code cleanup

release 1.0a   9/06 ==================================================

  No new functionality (bug fixes and minor code cleanup only)

  Bug fixes:

    * Corrected calculation of ..._TEMPLATE_MISPRIMING when
      INCLUDED_REGION was set (thanks to Tomoaki Nishiyama, Advanced
      Sciences Research Center, Kanazawa University, Japan).

    * Corrected error that caused crash when
      PRIMER_WT_TEMPLATE_MISPRIMING was set (thanks to Peng Yu,
      Functional Genomics Group II, Chinese National Human Genome
      Center, Beijing).

    * Added olgiotm_main.c (for executable oligotm)

release 1.0   6/04 ==================================================

  Added ability to search source sequence (template) for
  mispriming or mishybing sites.

  Added _experimental_ facility to calculate Tm on long
  oligos using a GC% based formula.

  Miscellaneous fixes and cleanup, including:

    * Avoiding closing NULL file handles when a mispriming or mishyb
      library is missing

    * Correction to long_seq_tm() in oligotm.c plus addition of
      related tests.

    * Gave user the ability to _not_ treat IUB/IUPAC ambiguity
      codes as a consensus while matching against mispriming
      or mishyb libraries.  Inability to turn off this "feature"
      caused severe problems when libraries contained strings
      of N's:  NNNNNNNNN, since if N is treated as a consensus,
      any base matches.

release 0.9  9/98 ==================================================

  Corrected errors in calculation of amplicon Tm.

release 0.8  6/98 ==================================================

  Added flexible objective function.  Various tags governing
  the penalty weights are not fully documented in this
  release.
  
  Added much changed web interface.

  Added ability to select only a single
  left or right primer or hyb probe.

  Made it possible to continue even if 
  PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_INPUT is
  not legal.

  Added PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_GC_PERCENT
  output tags.

release 0.7  5/98   ==================================================

  Fixed the 'case problem' for
  PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_INPUT (and at the
  same time a related bug).

  Added experimental PRIMER_START_CODON_POSITION tag
  and related outputs.  This feature should still be
  considered experimental and the user should scrutinize
  the output.

  Added PRIMER_PRODUCT_{MAX,MIN}_TM and related outputs.

release 0.6   ==================================================

  Bug fixes (most introduced as part of 0.5 enhancements).

release 0.5   ==================================================

  ** Non-Backward compatible change:
  Fixed inconsistency in output format;
  PRIMER_INTERNAL_n_OLIGO_SEQUENCE
  -> PRIMER_INTERNAL_OLIGO_n_SEQUENCE.
  The old format can be preserved by
  compiling with the precompiler
  symbol USE_OLD_FORMAT_MISTAKE defined.

  Added end-anchored local alignment option to dpal.

  Removed some un-needed dpal implementations.

  Added end-anchored local alignments for checking
  mispriming libraries.

  Added mispriming estimates for primer _pairs_
  (see PRIMER_PAIR_MISPRIMING_LIBRARY),
  with related new output tags.  Trivial change
  in maximum allowable library sequence weight.

  Added an experimental primer position component to
  the objective function (PRIMER_{IN,OUT}SIDE_PENALTY),
  with related new output tags.

  Added sequence quality scores as constraints
  in primer picking (PRIMER_MIN_{,END_}_QUALITY,
  PRIMER_QUALITY_RANGE_{MIN,MAX}) with related
  new output tags.

  Added more error reporting to primer3.cgi when primer3
  exits with a non-0 termination status.

  Fixed bug when non-0, non-1 value was supplied
  for pick internal oligos.

  Added PRIMER_{LEFT,RIGHT,INTERNAL_OLIGO}_INPUT
  for checking or for designing around existing primers or
  internal oligos.

  Added error checking for duplicates of certain
  tags, such as SEQUENCE.

  Added PRIMER_MAX_END_STABILITY and related changes
  to output.

release 0.4b   ==================================================

  Corrected bug in parsing of INCLUDED_REGION tag.

release 0.4   ==================================================

  Added optional check of oligos against "mispriming" or
  "mishyb" libraries  with related changes to formated output
  and to the contents of primer list files.

  Modified search algorithm to compute complementarity/
  similarity measures as late as possible.

  Got rid of quotes (") around error and warning strings.

  Fixed numerical overflow on input sequences longer than
  MAX_SHRT.  (Thanks to Pete Young for finding this one.)

release 0.3   ==================================================

  Changes to dpal to make it substantially faster on the maxgap=1
  case for local and end-anchored complementarity measures.

  Removed restriction on maximum sequence length (by removing
  ftar, fexcl, fexcl_int, fnn, fn, fgc arrays, which necessitated
  internal changes to methods for calculating overlap with
  excluded regions and targets and to calculate spanning of
  targets.

  Modified 'primer list' format (clean up and hopefully got rid
  of spurious regression test discrepancy on some systems due to
  differences in rounding).

  Exit codes for some errors changed.

  Text of error messages for PRIMER_PRODUCT_SIZE -> PRIMER_PRODUCT_SIZE_RANGE.

  Some errors that should have been global (fatal) were not.
  These were fixed and error handling rationalized somewhat.
  
  An error in the display of the start position of targets, and
  excluded regions in formated output was corrected.

  An error in which overlapping product size ranges caused
  primer3 to return duplicate primer pairs was corrected.

  Made regression tests more complete.
  
  Made the maximum number of primer pairs to return a 
  parameter (PRIMER_NUM_RETURN).

  Added optional n-based indexing in input and output
  (PRIMER_FIRST_BASE_INDEX=n).  Has not been tested
  for n < 0.

release 0.2b (10/11/96)  ==================================================
  Added PRIMER_WARNING tag.

  Made it legal for excluded regions and targets to lie outside
  of included region.  Documentation fixes (especially to
  PRIMER_DNA_CONC).

release 0.2a ==================================================
  Tweaks to formated output to make it more complete
  (included complementarity measures);  adjusted tests.

release 0.2 ==================================================
  Made 0-length excluded region legal, and adjusted tests.
  Tweaked error reporting of negative-length excluded regions,
  internal oligo excluded regions, and target.


==============================================================
==============================================================
Compared to non-primer3 progenitors:

Compared to primer 0.5
---------------
Completely different input format.  

It has been reported the 0.5 deleted Ns when they occurred in
primers.  

More stringent self-complementarity defaults.

Primer3 selects internal oligos on request (and produces .int
files if requested).

Compared to both primer 0.5 and primer v2
---------------------------
The format of the contents of .for, .rev (and .int) files is
different.

Primer3 returns a user-specifiable number of primer pairs (or
triples) sorted by "goodness".

Primer3 will find a primer pair if any acceptable pair exists.

Optional n-based indexing into source sequence.

Use of sequence quality and 3' stability as constraints in primer
picking.  Optional positional component to objective function.

Compared to primer v2
-------------
Tag name changes.  However, primer3 should understand most or
all Primer v2 input tags, and should produce v2-compatible output
tag names when the -v2_compat command-line switch is used.

The one exception is that the PRIMER_RECOMMEND tag is no longer
produced. Instead primer3 produces the PRIMER_x_EXPLAIN output
tags.  The format of the data in this tags is different from the
data in v2's PRIMER_RECOMMEND output tag.

Numerous fixes.

Uses the PRIMER_SELF_ANY and PRIMER_SELF_END parameters to govern
maximum allowable complementarity between left and right primers,
as well as complementarity between copies of a single oligo or
within a single oligo.  This behaviour is very close to that of
primer 0.5; self complementarity calculations in v2 were
unreliable.

Primer3 produces much more output information, including the TMs
and self complementarity measures of selected primers.