1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718
|
#!/usr/bin/env python
# -*- coding: utf-8 -*-
# -----------------------------------------------------------------------------
# Copyright (c) 2011-2013, The BIOM Format Development Team.
#
# Distributed under the terms of the Modified BSD License.
#
# The full license is in the file COPYING.txt, distributed with this software.
# -----------------------------------------------------------------------------
__author__ = "Jai Ram Rideout"
__copyright__ = "Copyright 2011-2013, The BIOM Format Development Team"
__credits__ = ["Jai Ram Rideout", "Daniel McDonald",
"Jorge CaƱardo Alastuey"]
__license__ = "BSD"
__url__ = "http://biom-format.org"
__maintainer__ = "Jai Ram Rideout"
__email__ = "jai.rideout@gmail.com"
import os
import json
from unittest import TestCase, main
from shutil import copy
import numpy.testing as npt
from biom.cli.table_validator import TableValidator
from biom.util import HAVE_H5PY
if HAVE_H5PY:
import h5py
class TableValidatorTests(TestCase):
def setUp(self):
"""Set up data for use in unit tests."""
self.cmd = TableValidator()
self.min_sparse_otu = json.loads(min_sparse_otu)
self.rich_sparse_otu = json.loads(rich_sparse_otu)
self.rich_dense_otu = json.loads(rich_dense_otu)
self.min_dense_otu = json.loads(min_dense_otu)
self.to_remove = []
cur_path = os.path.split(os.path.abspath(__file__))[0]
examples_path = os.path.join(cur_path.rsplit('/', 2)[0], 'examples')
self.hdf5_file_valid = os.path.join(examples_path,
'min_sparse_otu_table_hdf5.biom')
self.hdf5_file_valid_md = os.path.join(examples_path,
('rich_sparse_otu_table_hdf5'
'.biom'))
def tearDown(self):
for f in self.to_remove:
os.remove(f)
@npt.dec.skipif(HAVE_H5PY == False, msg='H5PY is not installed')
def test_valid_hdf5_metadata_v210(self):
exp = {'valid_table': True, 'report_lines': []}
obs = self.cmd(table=self.hdf5_file_valid,
format_version='2.1')
self.assertEqual(obs, exp)
obs = self.cmd(table=self.hdf5_file_valid_md,
format_version='2.1')
self.assertEqual(obs, exp)
@npt.dec.skipif(HAVE_H5PY == False, msg='H5PY is not installed')
def test_valid_hdf5_metadata_v200(self):
pass # omitting, not a direct way to test at this time using the repo
@npt.dec.skipif(HAVE_H5PY == False, msg='H5PY is not installed')
def test_valid_hdf5(self):
"""Test a valid HDF5 table"""
exp = {'valid_table': True,
'report_lines': []}
obs = self.cmd(table=self.hdf5_file_valid)
self.assertEqual(obs, exp)
@npt.dec.skipif(HAVE_H5PY == False, msg='H5PY is not installed')
def test_invalid_hdf5(self):
"""Test an invalid HDF5 table"""
exp = {'valid_table': False,
'report_lines': ["Missing attribute: 'creation-date'"]}
copy(self.hdf5_file_valid, 'invalid.hdf5')
self.to_remove.append('invalid.hdf5')
f = h5py.File('invalid.hdf5', 'a')
del f.attrs['creation-date']
f.close()
obs = self.cmd(table='invalid.hdf5')
self.assertEqual(obs, exp)
def test_valid(self):
"""Correctly validates a table that is indeed... valid."""
exp = {'valid_table': True, 'report_lines': []}
f = open('valid_test1', 'w')
f.write(json.dumps(self.min_sparse_otu))
f.close()
self.to_remove.append('valid_test1')
obs = self.cmd(table='valid_test1')
self.assertEqual(obs, exp)
f = open('valid_test2', 'w')
f.write(json.dumps(self.rich_sparse_otu))
f.close()
self.to_remove.append('valid_test2')
obs = self.cmd(table='valid_test2')
self.assertEqual(obs, exp)
# Soldier, report!!
f = open('valid_test3', 'w')
f.write(json.dumps(self.rich_sparse_otu))
f.close()
self.to_remove.append('valid_test3')
obs = self.cmd(table='valid_test3', detailed_report=True)
self.assertTrue(obs['valid_table'])
self.assertTrue(len(obs['report_lines']) > 0)
def test_invalid(self):
"""Correctly invalidates a table that is... invalid."""
del self.min_sparse_otu['date']
exp = {'valid_table': False, 'report_lines': ["Missing field: 'date'"]}
f = open('invalid_test1', 'w')
f.write(json.dumps(self.min_sparse_otu))
f.close()
self.to_remove.append('invalid_test1')
obs = self.cmd(table='invalid_test1')
self.assertEqual(obs, exp)
self.rich_dense_otu['shape'][1] = 42
exp = {'valid_table': False,
'report_lines': ['Incorrect number of cols: [0, 0, 1, 0, 0, 0]',
"Number of columns in 'columns' is not equal "
"to 'shape'"]}
f = open('invalid_test2', 'w')
f.write(json.dumps(self.rich_dense_otu))
f.close()
self.to_remove.append('invalid_test2')
obs = self.cmd(table='invalid_test2')
self.assertEqual(obs, exp)
def test_valid_format_url(self):
"""validates format url"""
table = self.min_sparse_otu
obs = self.cmd._valid_format_url(table)
self.assertTrue(len(obs) == 0)
table['format_url'] = 'foo'
obs = self.cmd._valid_format_url(table)
self.assertTrue(len(obs) > 0)
def test_valid_format(self):
"""Should match format string"""
table = self.min_sparse_otu
self.cmd._format_version = '1.0.0'
obs = self.cmd._valid_format(table)
self.assertTrue(len(obs) == 0)
table['format'] = 'foo'
obs = self.cmd._valid_format(table)
self.assertTrue(len(obs) > 0)
def test_valid_type(self):
"""Should be valid table type"""
table = self.min_sparse_otu
table['type'] = 'otu table' # should not be case sensitive
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'Pathway table'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'Function table'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'Ortholog table'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'Gene table'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'Metabolite table'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'OTU table'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'Taxon table'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) == 0)
table['type'] = 'foo'
obs = self.cmd._valid_type(table)
self.assertTrue(len(obs) > 0)
def test_valid_generated_by(self):
"""Should have some string for generated by"""
table = self.min_sparse_otu
obs = self.cmd._valid_generated_by(table)
self.assertTrue(len(obs) == 0)
table['generated_by'] = None
obs = self.cmd._valid_generated_by(table)
self.assertTrue(len(obs) > 0)
def test_valid_nullable_id(self):
"""Should just work."""
pass
def test_valid_metadata(self):
"""Can be nullable or an object"""
table = self.min_sparse_otu
table['rows'][2]['metadata'] = None
obs = self.cmd._valid_metadata(table['rows'][2])
self.assertTrue(len(obs) == 0)
table['rows'][2]['metadata'] = {10: 20}
obs = self.cmd._valid_metadata(table['rows'][2])
self.assertTrue(len(obs) == 0)
table['rows'][2]['metadata'] = ""
obs = self.cmd._valid_metadata(table['rows'][2])
self.assertTrue(len(obs) > 0)
table['rows'][2]['metadata'] = "asdasda"
obs = self.cmd._valid_metadata(table['rows'][2])
self.assertTrue(len(obs) > 0)
table['rows'][2]['metadata'] = [{'a': 'b'}, {'c': 'd'}]
obs = self.cmd._valid_metadata(table['rows'][2])
self.assertTrue(len(obs) > 0)
def test_valid_matrix_type(self):
"""Make sure we have a valid matrix type"""
obs = self.cmd._valid_matrix_type(self.min_dense_otu)
self.assertTrue(len(obs) == 0)
obs = self.cmd._valid_matrix_type(self.min_sparse_otu)
self.assertTrue(len(obs) == 0)
table = self.min_dense_otu
table['matrix_type'] = 'spARSe'
obs = self.cmd._valid_matrix_type(table)
self.assertTrue(len(obs) > 0)
table['matrix_type'] = 'sparse_asdasd'
obs = self.cmd._valid_matrix_type(table)
self.assertTrue(len(obs) > 0)
def test_valid_matrix_element_type(self):
"""Make sure we have a valid matrix type"""
table = self.min_sparse_otu
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) == 0)
table['matrix_element_type'] = u'int'
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) == 0)
table['matrix_element_type'] = 'float'
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) == 0)
table['matrix_element_type'] = u'float'
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) == 0)
table['matrix_element_type'] = 'str'
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) == 0)
table['matrix_element_type'] = u'str'
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) == 0)
table['matrix_element_type'] = 'obj'
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) > 0)
table['matrix_element_type'] = u'asd'
obs = self.cmd._valid_matrix_element_type(table)
self.assertTrue(len(obs) > 0)
def test_valid_datetime(self):
"""Make sure we have a datetime stamp"""
table = self.min_sparse_otu
obs = self.cmd._valid_datetime(table)
self.assertTrue(len(obs) == 0)
table['date'] = "1999-11-11T10:11:12"
obs = self.cmd._valid_datetime(table)
self.assertTrue(len(obs) == 0)
def test_valid_sparse_data(self):
"""Takes a sparse matrix field and validates"""
table = self.min_sparse_otu
obs = self.cmd._valid_sparse_data(table)
self.assertTrue(len(obs) == 0)
# incorrect type
table['matrix_element_type'] = 'float'
obs = self.cmd._valid_sparse_data(table)
self.assertTrue(len(obs) > 0)
# not balanced
table['matrix_element_type'] = 'int'
table['data'][5] = [0, 10]
obs = self.cmd._valid_sparse_data(table)
self.assertTrue(len(obs) > 0)
# odd type for index
table['data'][5] = [1.2, 5, 10]
obs = self.cmd._valid_sparse_data(table)
self.assertTrue(len(obs) > 0)
def test_valid_dense_data(self):
"""Takes a dense matrix field and validates"""
table = self.min_dense_otu
obs = self.cmd._valid_dense_data(table)
self.assertTrue(len(obs) == 0)
# incorrect type
table['matrix_element_type'] = 'float'
obs = self.cmd._valid_dense_data(table)
self.assertTrue(len(obs) > 0)
# not balanced
table['matrix_element_type'] = 'int'
table['data'][1] = [0, 10]
obs = self.cmd._valid_dense_data(table)
self.assertTrue(len(obs) > 0)
# bad type in a field
table['data'][1] = [5, 1, 0, 2.3, 3, 1]
obs = self.cmd._valid_dense_data(table)
self.assertTrue(len(obs) > 0)
def test_valid_shape(self):
"""validates shape information"""
obs = self.cmd._valid_shape(self.min_sparse_otu)
self.assertTrue(len(obs) == 0)
obs = self.cmd._valid_shape(self.rich_sparse_otu)
self.assertTrue(len(obs) == 0)
bad_shape = self.min_sparse_otu.copy()
bad_shape['shape'] = ['asd', 10]
obs = self.cmd._valid_shape(bad_shape)
self.assertTrue(len(obs) > 0)
def test_valid_rows(self):
"""validates rows: field"""
table = self.rich_dense_otu
obs = self.cmd._valid_rows(table)
self.assertTrue(len(obs) == 0)
table['rows'][0]['id'] = ""
obs = self.cmd._valid_rows(table)
self.assertTrue(len(obs) > 0)
table['rows'][0]['id'] = None
obs = self.cmd._valid_rows(table)
self.assertTrue(len(obs) > 0)
del table['rows'][0]['id']
obs = self.cmd._valid_rows(table)
self.assertTrue(len(obs) > 0)
table['rows'][0]['id'] = 'asd'
table['rows'][0]['metadata'] = None
obs = self.cmd._valid_rows(table)
self.assertTrue(len(obs) == 0)
# since this is an OTU table, metadata is a required key
del table['rows'][0]['metadata']
obs = self.cmd._valid_rows(table)
self.assertTrue(len(obs) > 0)
def test_valid_columns(self):
"""validates table:columns: fields"""
table = self.rich_dense_otu
obs = self.cmd._valid_columns(table)
self.assertTrue(len(obs) == 0)
table['columns'][0]['id'] = ""
obs = self.cmd._valid_columns(table)
self.assertTrue(len(obs) > 0)
table['columns'][0]['id'] = None
obs = self.cmd._valid_columns(table)
self.assertTrue(len(obs) > 0)
del table['columns'][0]['id']
obs = self.cmd._valid_columns(table)
self.assertTrue(len(obs) > 0)
table['columns'][0]['id'] = 'asd'
table['columns'][0]['metadata'] = None
obs = self.cmd._valid_columns(table)
self.assertTrue(len(obs) == 0)
# since this is an OTU table, metadata is a required key
del table['columns'][0]['metadata']
obs = self.cmd._valid_columns(table)
self.assertTrue(len(obs) > 0)
def test_valid_data(self):
"""validates data: fields"""
# the burden of validating data is passed on to valid_sparse_data
# and valid_dense_data
table = self.rich_sparse_otu
obs = self.cmd._valid_data(table)
self.assertTrue(len(obs) == 0)
table['matrix_type'] = 'foo'
obs = self.cmd._valid_data(table)
self.assertTrue(len(obs) > 0)
rich_sparse_otu = """{
"id":null,
"format": "1.0.0",
"format_url": "http://biom-format.org",
"type": "OTU table",
"generated_by": "QIIME revision XYZ",
"date": "2011-12-19T19:00:00",
"rows":[{"id":"GG_OTU_1",
"metadata":{"taxonomy":["k__Bacteria",
"p__Proteobacteria",
"c__Gammaproteobacteria",
"o__Enterobacteriales",
"f__Enterobacteriaceae",
"g__Escherichia",
"s__"]}},
{"id":"GG_OTU_2",
"metadata":{"taxonomy":["k__Bacteria",
"p__Cyanobacteria",
"c__Nostocophycideae",
"o__Nostocales",
"f__Nostocaceae",
"g__Dolichospermum",
"s__"]}},
{"id":"GG_OTU_3",
"metadata":{"taxonomy":["k__Archaea",
"p__Euryarchaeota",
"c__Methanomicrobia",
"o__Methanosarcinales",
"f__Methanosarcinaceae",
"g__Methanosarcina",
"s__"]}},
{"id":"GG_OTU_4",
"metadata":{"taxonomy":["k__Bacteria",
"p__Firmicutes",
"c__Clostridia",
"o__Halanaerobiales",
"f__Halanaerobiaceae",
"g__Halanaerobium",
"s__Halanaerobiumsaccharolyticum"]}},
{"id":"GG_OTU_5",
"metadata":{"taxonomy":["k__Bacteria",
"p__Proteobacteria",
"c__Gammaproteobacteria",
"o__Enterobacteriales",
"f__Enterobacteriaceae",
"g__Escherichia",
"s__"]}}
],
"columns":[
{"id":"Sample1", "metadata":{
"BarcodeSequence":"CGCTTATCGAGA",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample2", "metadata":{
"BarcodeSequence":"CATACCAGTAGC",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample3", "metadata":{
"BarcodeSequence":"CTCTCTACCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample4", "metadata":{
"BarcodeSequence":"CTCTCGGCCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample5", "metadata":{
"BarcodeSequence":"CTCTCTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample6", "metadata":{
"BarcodeSequence":"CTAACTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}}
],
"matrix_type": "sparse",
"matrix_element_type": "int",
"shape": [5, 6],
"data":[[0,2,1],
[1,0,5],
[1,1,1],
[1,3,2],
[1,4,3],
[1,5,1],
[2,2,1],
[2,3,4],
[2,5,2],
[3,0,2],
[3,1,1],
[3,2,1],
[3,5,1],
[4,1,1],
[4,2,1]
]
}"""
min_sparse_otu = """{
"id":null,
"format": "1.0.0",
"format_url": "http://biom-format.org",
"type": "OTU table",
"generated_by": "QIIME revision XYZ",
"date": "2011-12-19T19:00:00",
"rows":[
{"id":"GG_OTU_1", "metadata":null},
{"id":"GG_OTU_2", "metadata":null},
{"id":"GG_OTU_3", "metadata":null},
{"id":"GG_OTU_4", "metadata":null},
{"id":"GG_OTU_5", "metadata":null}
],
"columns": [
{"id":"Sample1", "metadata":null},
{"id":"Sample2", "metadata":null},
{"id":"Sample3", "metadata":null},
{"id":"Sample4", "metadata":null},
{"id":"Sample5", "metadata":null},
{"id":"Sample6", "metadata":null}
],
"matrix_type": "sparse",
"matrix_element_type": "int",
"shape": [5, 6],
"data":[[0,2,1],
[1,0,5],
[1,1,1],
[1,3,2],
[1,4,3],
[1,5,1],
[2,2,1],
[2,3,4],
[2,5,2],
[3,0,2],
[3,1,1],
[3,2,1],
[3,5,1],
[4,1,1],
[4,2,1]
]
}"""
rich_dense_otu = """{
"id":null,
"format": "1.0.0",
"format_url": "http://biom-format.org",
"type": "OTU table",
"generated_by": "QIIME revision XYZ",
"date": "2011-12-19T19:00:00",
"rows":[{"id":"GG_OTU_1",
"metadata":{"taxonomy":["k__Bacteria",
"p__Proteobacteria",
"c__Gammaproteobacteria",
"o__Enterobacteriales",
"f__Enterobacteriaceae",
"g__Escherichia",
"s__"]}},
{"id":"GG_OTU_2",
"metadata":{"taxonomy":["k__Bacteria",
"p__Cyanobacteria",
"c__Nostocophycideae",
"o__Nostocales",
"f__Nostocaceae",
"g__Dolichospermum",
"s__"]}},
{"id":"GG_OTU_3",
"metadata":{"taxonomy":["k__Archaea",
"p__Euryarchaeota",
"c__Methanomicrobia",
"o__Methanosarcinales",
"f__Methanosarcinaceae",
"g__Methanosarcina",
"s__"]}},
{"id":"GG_OTU_4",
"metadata":{"taxonomy":["k__Bacteria",
"p__Firmicutes",
"c__Clostridia",
"o__Halanaerobiales",
"f__Halanaerobiaceae",
"g__Halanaerobium",
"s__Halanaerobiumsaccharolyticum"]}},
{"id":"GG_OTU_5",
"metadata":{"taxonomy":["k__Bacteria",
"p__Proteobacteria",
"c__Gammaproteobacteria",
"o__Enterobacteriales",
"f__Enterobacteriaceae",
"g__Escherichia",
"s__"]}}
],
"columns":[
{"id":"Sample1", "metadata":{
"BarcodeSequence":"CGCTTATCGAGA",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample2", "metadata":{
"BarcodeSequence":"CATACCAGTAGC",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample3", "metadata":{
"BarcodeSequence":"CTCTCTACCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"gut",
"Description":"human gut"}},
{"id":"Sample4", "metadata":{
"BarcodeSequence":"CTCTCGGCCTGT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample5", "metadata":{
"BarcodeSequence":"CTCTCTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}},
{"id":"Sample6", "metadata":{
"BarcodeSequence":"CTAACTACCAAT",
"LinkerPrimerSequence":"CATGCTGCCTCCCGTAGGAGT",
"BODY_SITE":"skin",
"Description":"human skin"}}
],
"matrix_type": "dense",
"matrix_element_type": "int",
"shape": [5,6],
"data": [[0,0,1,0,0,0],
[5,1,0,2,3,1],
[0,0,1,4,2,0],
[2,1,1,0,0,1],
[0,1,1,0,0,0]]
}"""
min_dense_otu = """ {
"id":null,
"format": "1.0.0",
"format_url": "http://biom-format.org",
"type": "OTU table",
"generated_by": "QIIME revision XYZ",
"date": "2011-12-19T19:00:00",
"rows":[
{"id":"GG_OTU_1", "metadata":null},
{"id":"GG_OTU_2", "metadata":null},
{"id":"GG_OTU_3", "metadata":null},
{"id":"GG_OTU_4", "metadata":null},
{"id":"GG_OTU_5", "metadata":null}
],
"columns": [
{"id":"Sample1", "metadata":null},
{"id":"Sample2", "metadata":null},
{"id":"Sample3", "metadata":null},
{"id":"Sample4", "metadata":null},
{"id":"Sample5", "metadata":null},
{"id":"Sample6", "metadata":null}
],
"matrix_type": "dense",
"matrix_element_type": "int",
"shape": [5,6],
"data": [[0,0,1,0,0,0],
[5,1,0,2,3,1],
[0,0,1,4,2,0],
[2,1,1,0,0,1],
[0,1,1,0,0,0]]
}"""
if __name__ == "__main__":
main()
|