1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357
|
<p><!--
QBlastInfoBegin
Status=READY
QBlastInfoEnd
--><p><TITLE>Results for RID 984887321-25017-7612 </TITLE>
<HTML>
<HEAD>
<TITLE>BLAST Search Results </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" LINK="#0000FF" VLINK="#660099" ALINK="#660099">
<A HREF="http://www.ncbi.nlm.nih.gov/BLAST/blast_form.map"> <IMG SRC="http://www.ncbi.nlm.nih.gov/BLAST/blast_results.gif" BORDER=0 ISMAP></A>
<BR><BR><PRE>
<b>BLASTN 2.1.2 [Nov-13-2000]</b>
<b><a href="http://www.ncbi.nlm.nih.gov/htbin-
post/Entrez/query?uid=9254694&form=6&db=m&Dopt=r">Reference</a>:</b>
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
<p>
RID: 984887321-25017-7612
<p>
<p>
<b>Database:</b> nt
816,659 sequences; 2,928,690,202 total letters
<p> <p>If you have any problems or questions with the results of this search <br>please refer to the <b><a href=http://www.ncbi.nlm.nih.gov/blast/blast_FAQs.html>BLAST FAQs</a></b><br><p>
<FORM NAME="BLASTFORM" METHOD="POST">
<INPUT TYPE="hidden" NAME="PAGE" VALUE ="NUCLEOTIDES"><INPUT TYPE="hidden" NAME="EXPECT" VALUE ="10"><INPUT TYPE="hidden" NAME="DESCRIPTIONS" VALUE ="100"><INPUT TYPE="hidden" NAME="ALIGNMENTS" VALUE ="50"><INPUT TYPE="hidden" NAME="AUTO_FORMAT" VALUE ="yes"><a href="blast.cgi?RID=984887321-25017-7612&ALIGNMENT_VIEW=17" TARGET="Taxonomy BLAST Results for 984887321-25017-7612">Taxonomy reports</a>
<BR>
<b>Query=</b> gi|8332116|gb|BE037100.1|BE037100 MP14H09 MP
Mesembryanthemum crystallinum cDNA 5' similar to cold acclimation
protein, mRNA sequence
(1111 letters)
<PRE>
Score E
Sequences producing significant alignments: (bits) Value
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10121840&dopt=GenBank">gb|AF283004.1|AF283004</a> Arabidopsis thaliana cold acclimatio... <a href = #10121840> 46</a> 0.042
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=06598567&dopt=GenBank">gb|AC006438.3|AC006438</a> Arabidopsis thaliana chromosome II s... <a href = #6598567> 46</a> 0.042
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=11127594&dopt=GenBank">dbj|AB044404.1|AB044404</a> Arabidopsis thaliana FL3-5A3 mRNA f... <a href = #11127594> 46</a> 0.042
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04376087&dopt=GenBank">emb|Z99707.1|ATAP21</a> Arabidopsis thaliana DNA chromosome 4, ... <a href = #4376087> 44</a> 0.17
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=07270703&dopt=GenBank">emb|AL161591.2|ATCHRIV87</a> Arabidopsis thaliana DNA chromosom... <a href = #7270703> 44</a> 0.17
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10121844&dopt=GenBank">gb|AF283006.1|AF283006</a> Oryza sativa cold acclimation protei... <a href = #10121844> 42</a> 0.66
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=11190569&dopt=GenBank">emb|AL359511.16|AL359511</a> Human DNA sequence from clone RP1-... <a href = #11190569> 42</a> 0.66
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12545282&dopt=GenBank">gb|AC008529.4|AC008529</a> Homo sapiens chromosome 5 clone CTC-... <a href = #12545282> 40</a> 2.6
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10727724&dopt=GenBank">gb|AE003837.2|AE003837</a> Drosophila melanogaster genomic scaf... <a href = #10727724> 40</a> 2.6
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10121842&dopt=GenBank">gb|AF283005.1|AF283005</a> Arabidopsis thaliana cold acclimatio... <a href = #10121842> 40</a> 2.6
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04165334&dopt=GenBank">gb|AC006421.1|AC006421</a> Drosophila melanogaster, chromosome ... <a href = #4165334> 40</a> 2.6
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04140591&dopt=GenBank">gb|AF087457.1|AF087457</a> Mesocricetus auratus N-acetylglucosa... <a href = #4140591> 40</a> 2.6
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04140589&dopt=GenBank">gb|AF087456.1|AF087456</a> Mesocricetus auratus N-acetylglucosa... <a href = #4140589> 40</a> 2.6
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=01531640&dopt=GenBank">gb|U65792.1|CGU65792</a> Cricetulus griseus mutant N-acetylgluc... <a href = #1531640> 40</a> 2.6
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=01531638&dopt=GenBank">gb|U65791.1|CGU65791</a> Cricetulus griseus N-acetylglucoaminyl... <a href = #1531638> 40</a> 2.6
</PRE>
<CENTER><b><FONT color="green">Alignments</FONT></b></CENTER>
<PRE>
><a name = 10121840></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10121840&dopt=GenBank">gb|AF283004.1|AF283004</a> Arabidopsis thaliana cold acclimation protein WCOR413-like protein
alpha form mRNA, complete cds
Length = 783
Score = 46.1 bits (23), Expect = 0.042
Identities = 68/83 (81%)
Strand = Plus / Plus
Query: 249 tacttgttgatattggatcgaacaaactggagaaccaacatgctcacgtcacttttagtc 308
||||||||| | ||||||||||| || |||| || || |||||||| |||||| | |
Sbjct: 237 tacttgttggtgttggatcgaaccaattggaagacgaatatgctcacatcacttctcatt 296
Query: 309 ccttacatattcctcagtcttcc 331
|||||||| ||| ||||||||||
Sbjct: 297 ccttacatcttcttcagtcttcc 319
</PRE>
<PRE>
><a name = 6598567></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=06598567&dopt=GenBank">gb|AC006438.3|AC006438</a> Arabidopsis thaliana chromosome II section 92 of 255 of the complete
sequence. Sequence from clones F19G14, F7H1
Length = 87803
Score = 46.1 bits (23), Expect = 0.042
Identities = 68/83 (81%)
Strand = Plus / Plus
Query: 249 tacttgttgatattggatcgaacaaactggagaaccaacatgctcacgtcacttttagtc 308
||||||||| | ||||||||||| || |||| || || |||||||| |||||| | |
Sbjct: 85104 tacttgttggtgttggatcgaaccaattggaagacgaatatgctcacatcacttctcatt 85163
Query: 309 ccttacatattcctcagtcttcc 331
|||||||| ||| ||||||||||
Sbjct: 85164 ccttacatcttcttcagtcttcc 85186
</PRE>
<PRE>
><a name = 11127594></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=11127594&dopt=GenBank">dbj|AB044404.1|AB044404</a> Arabidopsis thaliana FL3-5A3 mRNA for cold acclimation protein
homolog, complete cds
Length = 820
Score = 46.1 bits (23), Expect = 0.042
Identities = 68/83 (81%)
Strand = Plus / Plus
Query: 249 tacttgttgatattggatcgaacaaactggagaaccaacatgctcacgtcacttttagtc 308
||||||||| | ||||||||||| || |||| || || |||||||| |||||| | |
Sbjct: 244 tacttgttggtgttggatcgaaccaattggaagacgaatatgctcacatcacttctcatt 303
Query: 309 ccttacatattcctcagtcttcc 331
|||||||| ||| ||||||||||
Sbjct: 304 ccttacatcttcttcagtcttcc 326
</PRE>
<PRE>
><a name = 4376087></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04376087&dopt=GenBank">emb|Z99707.1|ATAP21</a> Arabidopsis thaliana DNA chromosome 4, ESSA I AP2 contig fragment No. 1
Length = 206420
Score = 44.1 bits (22), Expect = 0.17
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 253 tgttgatattggatcgaacaaactggagaaccaa 286
|||||||||||||||| || ||||||| ||||||
Sbjct: 52308 tgttgatattggatcgtaccaactggaaaaccaa 52275
</PRE>
<PRE>
><a name = 7270703></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=07270703&dopt=GenBank">emb|AL161591.2|ATCHRIV87</a> Arabidopsis thaliana DNA chromosome 4, contig fragment No. 87
Length = 196339
Score = 44.1 bits (22), Expect = 0.17
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 253 tgttgatattggatcgaacaaactggagaaccaa 286
|||||||||||||||| || ||||||| ||||||
Sbjct: 9146 tgttgatattggatcgtaccaactggaaaaccaa 9179
</PRE>
<PRE>
><a name = 10121844></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10121844&dopt=GenBank">gb|AF283006.1|AF283006</a> Oryza sativa cold acclimation protein WCOR413-like protein mRNA,
complete cds
Length = 1057
Score = 42.1 bits (21), Expect = 0.66
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 256 tgatattggatcgaacaaactggagaaccaacatgct 292
||||||||||| | |||||||||| |||||||||||
Sbjct: 316 tgatattggataggacaaactggaagaccaacatgct 352
</PRE>
<PRE>
><a name = 11190569></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=11190569&dopt=GenBank">emb|AL359511.16|AL359511</a> Human DNA sequence from clone RP1-298M8 on chromosome 20, complete
sequence [Homo sapiens]
Length = 63264
Score = 42.1 bits (21), Expect = 0.66
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 61 agaaaatggggagagaaatga 81
|||||||||||||||||||||
Sbjct: 9450 agaaaatggggagagaaatga 9430
</PRE>
<PRE>
><a name = 12545282></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12545282&dopt=GenBank">gb|AC008529.4|AC008529</a> Homo sapiens chromosome 5 clone CTC-475P15, complete sequence
Length = 169557
Score = 40.1 bits (20), Expect = 2.6
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 207 ggcactcatttcctcaaatg 226
||||||||||||||||||||
Sbjct: 33167 ggcactcatttcctcaaatg 33186
</PRE>
<PRE>
><a name = 10727724></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10727724&dopt=GenBank">gb|AE003837.2|AE003837</a> Drosophila melanogaster genomic scaffold 142000013386047 section 6 of
52, complete sequence
Length = 234905
Score = 40.1 bits (20), Expect = 2.6
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 156 gcaacaatgaggctcatcaa 175
||||||||||||||||||||
Sbjct: 20459 gcaacaatgaggctcatcaa 20478
</PRE>
<PRE>
><a name = 10121842></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10121842&dopt=GenBank">gb|AF283005.1|AF283005</a> Arabidopsis thaliana cold acclimation protein WCOR413-like protein
beta form mRNA, complete cds
Length = 884
Score = 40.1 bits (20), Expect = 2.6
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 246 atttacttgttgatattggatcgaacaaactggagaaccaacatgctcacgtcact 301
||||||||||| || |||||||| || || |||| |||||| ||||| || |||||
Sbjct: 212 atttacttgttaattttggatcgtaccaattggaaaaccaagatgcttacatcact 267
</PRE>
<PRE>
><a name = 4165334></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04165334&dopt=GenBank">gb|AC006421.1|AC006421</a> Drosophila melanogaster, chromosome 2R, region 44C1-44C5, P1 clones
DS08614 and DS00667, complete sequence
Length = 100575
Score = 40.1 bits (20), Expect = 2.6
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 156 gcaacaatgaggctcatcaa 175
||||||||||||||||||||
Sbjct: 8902 gcaacaatgaggctcatcaa 8921
</PRE>
<PRE>
><a name = 4140591></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04140591&dopt=GenBank">gb|AF087457.1|AF087457</a> Mesocricetus auratus N-acetylglucosaminyltransferase I mutant mRNA,
complete cds
Length = 1344
Score = 40.1 bits (20), Expect = 2.6
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 462 ctggtggtggcaccagacttcttt 485
|||| |||||||||||||||||||
Sbjct: 640 ctggaggtggcaccagacttcttt 663
</PRE>
<PRE>
><a name = 4140589></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04140589&dopt=GenBank">gb|AF087456.1|AF087456</a> Mesocricetus auratus N-acetylglucosaminyltransferase I mRNA,
complete cds
Length = 1344
Score = 40.1 bits (20), Expect = 2.6
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 462 ctggtggtggcaccagacttcttt 485
|||| |||||||||||||||||||
Sbjct: 640 ctggaggtggcaccagacttcttt 663
</PRE>
<PRE>
><a name = 1531640></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=01531640&dopt=GenBank">gb|U65792.1|CGU65792</a> Cricetulus griseus mutant N-acetylglucosaminyltransferase I mRNA,
complete cds
Length = 1344
Score = 40.1 bits (20), Expect = 2.6
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 462 ctggtggtggcaccagacttcttt 485
|||| |||||||||||||||||||
Sbjct: 640 ctggaggtggcaccagacttcttt 663
</PRE>
<PRE>
><a name = 1531638></a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=01531638&dopt=GenBank">gb|U65791.1|CGU65791</a> Cricetulus griseus N-acetylglucoaminyltransferase I mRNA, complete
cds
Length = 1344
Score = 40.1 bits (20), Expect = 2.6
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 462 ctggtggtggcaccagacttcttt 485
|||| |||||||||||||||||||
Sbjct: 640 ctggaggtggcaccagacttcttt 663
</PRE>
<PRE>
Database: nt
Posted date: Mar 17, 2001 1:49 AM
Number of letters in database: 2,928,690,202
Number of sequences in database: 816,659
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1106713
Number of Sequences: 816659
Number of extensions: 1106713
Number of successful extensions: 5784
Number of sequences better than 10.0: 15
length of query: 1111
length of database: 2,928,690,202
effective HSP length: 21
effective length of query: 1090
effective length of database: 2,911,540,363
effective search space: 3173578995670
effective search space used: 3173578995670
T: 0
A: 30
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
</PRE>
</BODY>
</HTML>
</FORM>
|