1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809
|
HTTP/1.1 200 OK
Date: Fri, 18 Feb 2005 04:03:07 GMT
Server: Apache/1.3.27 (Unix) mod_fastcgi/2.4.0
Content-Type: text/html
Via: 1.1 www.ncbi.nih.gov
X-Cache: MISS from www.ncbi.nih.gov
Connection: close
<HTML>
<HEAD>
</HEAD>
<BODY BGCOLOR="#FFFFFF" LINK="#0000FF" VLINK="#660099" ALINK="#660099">
<IMG SRC="images/head_results.gif" ALT="Header of the page" BORDER="0"NAME="BlastHeaderGif" WIDTH="600" HEIGHT="45" ALIGN="middle">
<form action="Blast.cgi" enctype="application/x-www-form-urlencoded" method="POST"><input name="RID" type="hidden" value="1108699371-19377-201559481040.BLASTQ4"><input name="_PGR" type="hidden" value="0"><input name="_PGR" type="hidden" value="0"><input name="CMD" type="hidden" value="Get"></form>
<form action="Blast.cgi" enctype="application/x-www-form-urlencoded" method="POST" TARGET=""><input name="RID" type="hidden" value="1108699371-19377-201559481040.BLASTQ4"><input name="_PGR" type="hidden" value="0"><input name="CMD" type="hidden" value="Get"><p><!--
QBlastInfoBegin
Status=READY
QBlastInfoEnd
--><p><TITLE> RID=1108699371-19377-201559481040.BLASTQ4, gi|59709408|gb|CW882773.1|CW882773 she2h69-68.b_054.ab1 Whole-genome shotgun library of the elephant shark (aka elephant fish) Callorhinchus milii genomic, DNA sequence </TITLE>
<b>BLASTN 2.2.10 [Oct-19-2004]</b>
<pre>
<b><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Retrieve&list_uids
=9254694&dopt=Citation">Reference</a>:</b>
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
<p>
RID: 1108699371-19377-201559481040.BLASTQ4
<p>
<b>Query=</b> gi|59709408|gb|CW882773.1|CW882773 she2h69-68.b_054.ab1
Whole-genome shotgun library of the elephant shark (aka elephant fish)
Callorhinchus milii genomic, DNA sequence
(701 letters)
<p>
<b>Database:</b> All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
2,897,336 sequences; 13,306,357,995 total letters
<p> <p>If you have any problems or questions with the results of this search <br>please refer to the <b><a href=http://www.ncbi.nlm.nih.gov/blast/blast_FAQs.html>BLAST FAQs</a></b><br><p>
<a href="Blast.cgi?CMD=Get&RID=1108699371-19377-201559481040.BLASTQ4&FORMAT_OBJECT=TaxBlast" TARGET="Taxonomy BLAST Results for 1108699371-19377-201559481040.BLASTQ4">Taxonomy reports</a>
<BR>
<PRE>
Score E
Sequences producing significant alignments: (bits) Value
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=29367455&dopt=GenBank" >emb|AL844177.15|</a> Mouse DNA sequence from clone RP23-414O19 ... <a href = #29367455> 48</a> 0.030
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04753288&dopt=GenBank" >gb|AC004828.2|AC004828</a> Homo sapiens clone DJ0514A23, comple... <a href = #4753288> 48</a> 0.030
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15282121&dopt=GenBank" >emb|AL392024.3|CNS06C8K</a> Human chromosome 14 DNA sequence BA... <a href = #15282121> 48</a> 0.030
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=30425606&dopt=GenBank" >gb|AC122889.3|</a> Mus musculus BAC clone RP23-93M3 from chromo... <a href = #30425606> 46</a> 0.12
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=28014757&dopt=GenBank" >gb|AC016182.24|</a> Homo sapiens chromosome 17, clone RP11-559N... <a href = #28014757> 46</a> 0.12
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=25704382&dopt=GenBank" >gb|AC092532.17|</a> Papio anubis clone rp41-110d13, complete se... <a href = #25704382> 46</a> 0.12
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=56236314&dopt=GenBank" >gb|AC122223.4|</a> Mus musculus BAC clone RP23-130K20 from 1, c... <a href = #56236314> 46</a> 0.12
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12331453&dopt=GenBank" >gb|AC039056.7|AC039056</a> Homo sapiens chromosome 15 clone CTD... <a href = #12331453> 46</a> 0.12
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=11527449&dopt=GenBank" >gb|AC084693.2|AC084693</a> Homo sapiens chromosome 15 clone RP1... <a href = #11527449> 46</a> 0.12
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55647162&dopt=GenBank" >ref|XM_512072.1|</a> PREDICTED: Pan troglodytes similar to pota... <a href = #55647162> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=23505427&dopt=GenBank" >gb|AY130457.1|AY130456S2</a> Homo sapiens fibulin 2 (FBLN2) gen... <a href = #23505427> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20128705&dopt=GenBank" >gb|AC007996.11|</a> Homo sapiens chromosome 18, clone RP11-9E17... <a href = #20128705> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55734178&dopt=GenBank" >emb|CR759889.5|</a> Zebrafish DNA sequence from clone DKEY-172F... <a href = #55734178> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=13384355&dopt=GenBank" >gb|AC090951.1|AC090951</a> Homo sapiens chromosome 3 clone RP11... <a href = #13384355> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12718890&dopt=GenBank" >gb|AC090005.1|AC090005</a> Homo sapiens chromosome 3 clone RP11... <a href = #12718890> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12084025&dopt=GenBank" >gb|AC068319.4|AC068319</a> Homo sapiens chromosome 3 clone RP11... <a href = #12084025> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24394916&dopt=GenBank" >emb|AL645583.12|</a> Mouse DNA sequence from clone RP23-12N20 o... <a href = #24394916> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=18855217&dopt=GenBank" >emb|AL604043.11|</a> Mouse DNA sequence from clone RP23-391H8 o... <a href = #18855217> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24796741&dopt=GenBank" >gb|AC090509.2|</a> Homo sapiens chromosome 3 clone RP11-512I22 ... <a href = #24796741> 44</a> 0.48
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=29788929&dopt=GenBank" >gb|AC130206.2|</a> Mus musculus BAC clone RP24-448F6 from chrom... <a href = #29788929> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=30409940&dopt=GenBank" >gb|AC123056.4|</a> Mus musculus BAC clone RP23-182H4 from chrom... <a href = #30409940> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=38371907&dopt=GenBank" >gb|AC102652.9|</a> Mus musculus chromosome 6, clone RP23-20L3, ... <a href = #38371907> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22748560&dopt=GenBank" >gb|AC121839.3|</a> Mus musculus BAC clone RP24-76E2 from chromo... <a href = #22748560> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=29825882&dopt=GenBank" >gb|AC126263.4|</a> Mus musculus BAC clone RP23-359P12 from chro... <a href = #29825882> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=32452851&dopt=GenBank" >gb|AC116371.5|</a> Mus musculus chromosome 17, clone RP24-228A1... <a href = #32452851> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55774330&dopt=GenBank" >gb|AC130542.4|</a> Mus musculus chromosome 6 clone RP24-167F4, ... <a href = #55774330> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55368509&dopt=GenBank" >gb|AC104918.13|</a> Mus musculus chromosome 7, clone RP23-335G1... <a href = #55368509> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55251489&dopt=GenBank" >gb|AC123692.25|</a> Mus musculus chromosome 15, clone RP23-326B... <a href = #55251489> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=40994806&dopt=GenBank" >emb|BX890639.3|</a> Mouse DNA sequence from clone RP23-290E8 on... <a href = #40994806> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=21211978&dopt=GenBank" >emb|AL645570.13|</a> Mouse DNA sequence from clone RP23-377H12 ... <a href = #21211978> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22711745&dopt=GenBank" >gb|AC107892.9|</a> Homo sapiens chromosome 18, clone RP11-100K1... <a href = #22711745> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22795232&dopt=GenBank" >gb|AC124854.2|</a> Homo sapiens chromosome 5 clone RP11-133F8, ... <a href = #22795232> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22798011&dopt=GenBank" >emb|AL691459.25|</a> Human DNA sequence from clone RP11-543D5 o... <a href = #22798011> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10277925&dopt=GenBank" >emb|AL158159.14|</a> Human DNA sequence from clone RP11-498N2 o... <a href = #10277925> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=21389294&dopt=GenBank" >gb|AC011846.16|</a> Homo sapiens chromosome 15, clone RP11-346A... <a href = #21389294> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=03132341&dopt=GenBank" >dbj|AP000031.1|</a> Homo sapiens genomic DNA, chromosome 21q22.... <a href = #3132341> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24459907&dopt=GenBank" >emb|AJ504410.1|TRU504410</a> Takifugu rubripes egln1 gene (part... <a href = #24459907> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20330981&dopt=GenBank" >gb|AC105129.4|</a> Homo sapiens chromosome 15, clone RP11-349G1... <a href = #20330981> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=28201477&dopt=GenBank" >gb|AC099489.2|</a> Homo sapiens chromosome 16 clone CTD-3088G3,... <a href = #28201477> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15431057&dopt=GenBank" >gb|AC068665.3|</a> Mus musculus chromosome 5 clone RP23-426K16 ... <a href = #15431057> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=19698711&dopt=GenBank" >gb|AC027359.7|</a> Homo sapiens chromosome 18, clone RP11-13L18... <a href = #19698711> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=08050885&dopt=GenBank" >gb|AC025416.4|AC025416</a> Genomic sequence for Arabidopsis tha... <a href = #8050885> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=26251310&dopt=GenBank" >gb|AE016753.1|</a> Mus musculus chromosome 10 high-growth regio... <a href = #26251310> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=16945890&dopt=GenBank" >gb|AF329945.1|AF329945</a> Takifugu rubripes SUN-like 1 (SUNL1)... <a href = #16945890> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=07768676&dopt=GenBank" >dbj|AP001711.1|</a> Homo sapiens genomic DNA, chromosome 21q, s... <a href = #7768676> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=33146033&dopt=GenBank" >emb|AL928889.14|</a> Mouse DNA sequence from clone RP23-271L22 ... <a href = #33146033> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15808587&dopt=GenBank" >gb|AC061961.6|</a> Homo sapiens chromosome 2, clone RP11-754B23... <a href = #15808587> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15419815&dopt=GenBank" >gb|AF296663.1|AF296663S1</a> Mus musculus NKR-P1E pseudogene, e... <a href = #15419815> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15375164&dopt=GenBank" >gb|AC026780.5|</a> Homo sapiens chromosome 5 clone CTC-529L17, ... <a href = #15375164> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=52077881&dopt=GenBank" >gb|AC133174.5|</a> Mus musculus BAC clone RP24-314N20 from 12, ... <a href = #52077881> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=53382712&dopt=GenBank" >gb|AC138025.4|</a> Mus musculus BAC clone RP24-430F5 from 8, co... <a href = #53382712> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55700248&dopt=GenBank" >gb|AC142191.5|</a> Mus musculus BAC clone RP24-530N5 from 6, co... <a href = #55700248> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10334968&dopt=GenBank" >gb|AC013447.4|AC013447</a> Homo sapiens BAC clone RP11-543D5 fr... <a href = #10334968> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51315686&dopt=GenBank" >gb|AC140110.2|</a> Mus musculus BAC clone RP23-29H6 from 6, com... <a href = #51315686> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12831362&dopt=GenBank" >gb|AC090111.1|AC090111</a> Homo sapiens chromosome 21 clone unk... <a href = #12831362> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=08886984&dopt=GenBank" >gb|AC026776.4|AC026776</a> Homo sapiens chromosome 21 clone CTC... <a href = #8886984> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=21738578&dopt=GenBank" >emb|AL731558.14|</a> Mouse DNA sequence from clone RP23-235D11 ... <a href = #21738578> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15858953&dopt=GenBank" >emb|AL590414.4|</a> Mouse DNA sequence from clone RP23-305K11 o... <a href = #15858953> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22859036&dopt=GenBank" >emb|AL663091.13|</a> Mouse DNA sequence from clone RP23-392P11 ... <a href = #22859036> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=05912108&dopt=GenBank" >emb|AL117417.1|HSM801111</a> Homo sapiens mRNA; cDNA DKFZp434E0... <a href = #5912108> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=39652680&dopt=GenBank" >gb|AC145549.3|</a> Mus musculus BAC clone RP23-21M23 from chrom... <a href = #39652680> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=39752885&dopt=GenBank" >gb|AC132957.3|</a> Mus musculus BAC clone RP23-149E9 from chrom... <a href = #39752885> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=09690320&dopt=GenBank" >gb|AC011489.6|AC011489</a> Homo sapiens chromosome 19 clone CTB... <a href = #9690320> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04835623&dopt=GenBank" >dbj|AP000254.1|</a> Homo sapiens genomic DNA, chromosome 21q22.... <a href = #4835623> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04827161&dopt=GenBank" >dbj|AP000213.1|</a> Homo sapiens genomic DNA, chromosome 21q22.... <a href = #4827161> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46092385&dopt=GenBank" >dbj|AP006274.1|</a> Papio hamadryas genomic DNA, BAC clone: RPC... <a href = #46092385> 42</a> 1.9
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55657641&dopt=GenBank" >ref|XM_525492.1|</a> PREDICTED: Pan troglodytes similar to tran... <a href = #55657641> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46428559&dopt=GenBank" >emb|CR389914.1|</a> Gallus gallus finished cDNA, clone ChEST998b22 <a href = #46428559> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=23346550&dopt=GenBank" >ref|NM_153114.1|</a> Mus musculus otospiralin (Otos), mRNA <a href = #23346550> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=45752220&dopt=GenBank" >emb|BX294126.10|</a> Zebrafish DNA sequence from clone DKEYP-35... <a href = #45752220> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=52077710&dopt=GenBank" >gb|AC102714.16|</a> Mus musculus chromosome 5, clone RP24-298D1... <a href = #52077710> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51948685&dopt=GenBank" >gb|AC140038.12|</a> Mus musculus chromosome 1, clone RP24-290D1... <a href = #51948685> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51921434&dopt=GenBank" >gb|AC120863.9|</a> Mus musculus chromosome 7, clone RP23-84H3, ... <a href = #51921434> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=40994805&dopt=GenBank" >emb|BX890633.3|</a> Mouse DNA sequence from clone RP23-391L13 o... <a href = #40994805> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15131484&dopt=GenBank" >emb|AL391476.20|</a> Human DNA sequence from clone RP11-229A19 ... <a href = #15131484> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51372095&dopt=GenBank" >gb|AC093363.12|</a> Mus musculus chromosome 7, clone RP23-60O3,... <a href = #51372095> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20068308&dopt=GenBank" >emb|AL355805.20|</a> Human DNA sequence from clone RP11-29L10 o... <a href = #20068308> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24431570&dopt=GenBank" >gb|AC090058.21|</a> Homo sapiens 12 BAC RP11-112N23 (Roswell Pa... <a href = #24431570> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=34787257&dopt=GenBank" >emb|AL662922.10|</a> Mouse DNA sequence from clone RP23-195K1 o... <a href = #34787257> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=34221794&dopt=GenBank" >emb|AL773561.7|</a> Mouse DNA sequence from clone RP23-71D9 on ... <a href = #34221794> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=33942029&dopt=GenBank" >emb|AL831719.6|</a> Mouse DNA sequence from clone RP23-166I8 on... <a href = #33942029> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=50400110&dopt=GenBank" >gb|AC126600.6|</a> Mus musculus chromosome 1, clone RP23-145J9,... <a href = #50400110> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=19774329&dopt=GenBank" >gb|AC109129.3|</a> Homo sapiens 3 BAC RP11-784B9 (Roswell Park ... <a href = #19774329> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=27544972&dopt=GenBank" >gb|AC010287.9|</a> Homo sapiens chromosome 16 clone CTA-331F8, ... <a href = #27544972> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=48675503&dopt=GenBank" >gb|AC134561.5|</a> Mus musculus BAC clone RP24-111C16 from chro... <a href = #48675503> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15873099&dopt=GenBank" >emb|AJ328681.1|HSA328681</a> Homo sapiens genomic sequence surr... <a href = #15873099> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=19347615&dopt=GenBank" >gb|AY078071.1|</a> Mus musculus organ of Corti 10 kDa protein m... <a href = #19347615> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=17223203&dopt=GenBank" >gb|AC091643.6|</a> Homo sapiens chromosome 18, clone RP11-727B4... <a href = #17223203> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=50839064&dopt=GenBank" >gb|AC139155.3|</a> Mus musculus BAC clone RP24-209E3 from 13, c... <a href = #50839064> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46810384&dopt=GenBank" >gb|AC091458.5|</a> Mus musculus chromosome 12, clone RP23-68M8,... <a href = #46810384> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=50897460&dopt=GenBank" >gb|AC134598.3|</a> Mus musculus BAC clone RP23-175C23 from 8, c... <a href = #50897460> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55168543&dopt=GenBank" >gb|AC145168.5|</a> Mus musculus BAC clone RP23-398K14 from 3, c... <a href = #55168543> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=56847894&dopt=GenBank" >gb|AC154372.1|</a> Mus musculus BAC clone RP23-113F18 from 16, ... <a href = #56847894> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46358465&dopt=GenBank" >gb|AC148682.1|</a> Macaca mulatta Major Histocompatibility Comp... <a href = #46358465> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=45774037&dopt=GenBank" >gb|AC120150.9|</a> Mus musculus chromosome 16, clone RP24-241C1... <a href = #45774037> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55700762&dopt=GenBank" >dbj|AB128049.1|</a> Macaca mulatta genes, MHC class I region, p... <a href = #55700762> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=45504247&dopt=GenBank" >gb|AC147784.3|</a> Canis Familiaris, clone XX-25F3, complete se... <a href = #45504247> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20386827&dopt=GenBank" >emb|AL591884.11|</a> Mouse DNA sequence from clone RP23-183N8 o... <a href = #20386827> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15142995&dopt=GenBank" >emb|AL512293.2|LMFP696</a> Leishmania major Friedlin chromosome... <a href = #15142995> 40</a> 7.4
<a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=26101057&dopt=GenBank" >dbj|AK083090.1|</a> Mus musculus adult male hippocampus cDNA, R... <a href = #26101057> 40</a> 7.4
</PRE>
</form>
<CENTER><b><FONT color="green">Alignments</FONT></b></CENTER>
<PRE>
><a name = 29367455></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=29367455&dopt=GenBank" >emb|AL844177.15|</a> Mouse DNA sequence from clone RP23-414O19 on chromosome 4, complete
sequence
Length = 144217
Score = 48.1 bits (24), Expect = 0.030
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 103 ttctgacagatgaagcaatgtgtg 126
||||||||||||||||||||||||
Sbjct: 69425 ttctgacagatgaagcaatgtgtg 69402
</PRE>
<PRE>
><a name = 4753288></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04753288&dopt=GenBank" >gb|AC004828.2|AC004828</a> Homo sapiens clone DJ0514A23, complete sequence
Length = 183249
Score = 48.1 bits (24), Expect = 0.030
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 651 cccccacccccccacccatctgatgacc 678
||||||||||||||||| ||||||||||
Sbjct: 96010 cccccacccccccacccctctgatgacc 96037
</PRE>
<PRE>
><a name = 15282121></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15282121&dopt=GenBank" >emb|AL392024.3|CNS06C8K</a> Human chromosome 14 DNA sequence BAC R-182E21 of library RPCI-11 from
chromosome 14 of Homo sapiens (Human), complete sequence
Length = 146235
Score = 48.1 bits (24), Expect = 0.030
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 651 cccccacccccccacccatctgatgacc 678
||||||||||||||||| ||||||||||
Sbjct: 15220 cccccacccccccacccctctgatgacc 15193
</PRE>
<PRE>
><a name = 30425606></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=30425606&dopt=GenBank" >gb|AC122889.3|</a> Mus musculus BAC clone RP23-93M3 from chromosome 1, complete sequence
Length = 125681
Score = 46.1 bits (23), Expect = 0.12
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccaccc 667
|||||||||||||||||||||||
Sbjct: 24519 ccactccccccacccccccaccc 24541
</PRE>
<PRE>
><a name = 28014757></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=28014757&dopt=GenBank" >gb|AC016182.24|</a> Homo sapiens chromosome 17, clone RP11-559N14, complete sequence
Length = 181971
Score = 46.1 bits (23), Expect = 0.12
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccatctg 672
|||||||||||||||||||||||
Sbjct: 113649 ccccccacccccccacccatctg 113627
</PRE>
<PRE>
><a name = 25704382></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=25704382&dopt=GenBank" >gb|AC092532.17|</a> Papio anubis clone rp41-110d13, complete sequence
Length = 157944
Score = 46.1 bits (23), Expect = 0.12
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 646 cactccccccacccccccacccatctg 672
|||||||||| ||||||||||||||||
Sbjct: 139737 cactccccccgcccccccacccatctg 139711
</PRE>
<PRE>
><a name = 56236314></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=56236314&dopt=GenBank" >gb|AC122223.4|</a> Mus musculus BAC clone RP23-130K20 from 1, complete sequence
Length = 233830
Score = 46.1 bits (23), Expect = 0.12
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccaccc 667
|||||||||||||||||||||||
Sbjct: 217750 ccactccccccacccccccaccc 217772
</PRE>
<PRE>
><a name = 12331453></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12331453&dopt=GenBank" >gb|AC039056.7|AC039056</a> Homo sapiens chromosome 15 clone CTD-2382E5 map 15q14, complete sequence
Length = 176708
Score = 46.1 bits (23), Expect = 0.12
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccaccc 667
|||||||||||||||||||||||
Sbjct: 112690 ccactccccccacccccccaccc 112712
</PRE>
<PRE>
><a name = 11527449></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=11527449&dopt=GenBank" >gb|AC084693.2|AC084693</a> Homo sapiens chromosome 15 clone RP11-35K2 map 15q15, complete sequence
Length = 173660
Score = 46.1 bits (23), Expect = 0.12
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccaccc 667
|||||||||||||||||||||||
Sbjct: 34025 ccactccccccacccccccaccc 34047
</PRE>
<PRE>
><a name = 55647162></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55647162&dopt=GenBank" >ref|XM_512072.1|</a> PREDICTED: Pan troglodytes similar to potassium channel
tetramerisation domain containing 1; chromosome 18 open
reading frame 5 (LOC455348), mRNA
Length = 3474
Score = 44.1 bits (22), Expect = 0.48
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccacccatc 670
|||||||| |||||||||||||||||
Sbjct: 1182 ccactcccaccacccccccacccatc 1207
</PRE>
<PRE>
><a name = 23505427></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=23505427&dopt=GenBank" >gb|AY130457.1|AY130456S2</a> Homo sapiens fibulin 2 (FBLN2) gene, exons 3 through 9
Length = 14972
Score = 44.1 bits (22), Expect = 0.48
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 644 tccactccccccacccccccacccat 669
||||| ||||||||||||||||||||
Sbjct: 10226 tccaccccccccacccccccacccat 10251
</PRE>
<PRE>
><a name = 20128705></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20128705&dopt=GenBank" >gb|AC007996.11|</a> Homo sapiens chromosome 18, clone RP11-9E17, complete sequence
Length = 182884
Score = 44.1 bits (22), Expect = 0.48
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 645 ccactccccccacccccccacccatc 670
|||||||| |||||||||||||||||
Sbjct: 164692 ccactcccaccacccccccacccatc 164667
</PRE>
<PRE>
><a name = 55734178></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55734178&dopt=GenBank" >emb|CR759889.5|</a> Zebrafish DNA sequence from clone DKEY-172F14 in linkage group 5,
complete sequence
Length = 129171
Score = 44.1 bits (22), Expect = 0.48
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 639 tgtcctccactccccccacccc 660
||||||||||||||||||||||
Sbjct: 61444 tgtcctccactccccccacccc 61423
</PRE>
<PRE>
><a name = 13384355></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=13384355&dopt=GenBank" >gb|AC090951.1|AC090951</a> Homo sapiens chromosome 3 clone RP11-488M6 map 3p, complete sequence
Length = 181394
Score = 44.1 bits (22), Expect = 0.48
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 644 tccactccccccacccccccacccat 669
||||| ||||||||||||||||||||
Sbjct: 159376 tccaccccccccacccccccacccat 159401
</PRE>
<PRE>
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccaccca 668
|||||||||||||||| |||||||
Sbjct: 100018 ccactccccccaccccgccaccca 100041
</PRE>
<PRE>
><a name = 12718890></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12718890&dopt=GenBank" >gb|AC090005.1|AC090005</a> Homo sapiens chromosome 3 clone RP11-9D10 map 3p, complete sequence
Length = 177626
Score = 44.1 bits (22), Expect = 0.48
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 644 tccactccccccacccccccacccat 669
||||| ||||||||||||||||||||
Sbjct: 127952 tccaccccccccacccccccacccat 127977
</PRE>
<PRE>
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccaccca 668
|||||||||||||||| |||||||
Sbjct: 68583 ccactccccccaccccgccaccca 68606
</PRE>
<PRE>
><a name = 12084025></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12084025&dopt=GenBank" >gb|AC068319.4|AC068319</a> Homo sapiens chromosome 3 clone RP11-470I10 map 3p, complete sequence
Length = 217456
Score = 44.1 bits (22), Expect = 0.48
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 644 tccactccccccacccccccacccat 669
||||| ||||||||||||||||||||
Sbjct: 41223 tccaccccccccacccccccacccat 41198
</PRE>
<PRE>
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 645 ccactccccccacccccccaccca 668
|||||||||||||||| |||||||
Sbjct: 100583 ccactccccccaccccgccaccca 100560
</PRE>
<PRE>
><a name = 24394916></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24394916&dopt=GenBank" >emb|AL645583.12|</a> Mouse DNA sequence from clone RP23-12N20 on chromosome 11, complete
sequence
Length = 67643
Score = 44.1 bits (22), Expect = 0.48
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 646 cactccccccacccccccaccc 667
||||||||||||||||||||||
Sbjct: 1942 cactccccccacccccccaccc 1963
</PRE>
<PRE>
><a name = 18855217></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=18855217&dopt=GenBank" >emb|AL604043.11|</a> Mouse DNA sequence from clone RP23-391H8 on chromosome 11, complete
sequence
Length = 221374
Score = 44.1 bits (22), Expect = 0.48
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 646 cactccccccacccccccaccc 667
||||||||||||||||||||||
Sbjct: 221316 cactccccccacccccccaccc 221337
</PRE>
<PRE>
><a name = 24796741></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24796741&dopt=GenBank" >gb|AC090509.2|</a> Homo sapiens chromosome 3 clone RP11-512I22 map 3p, complete sequence
Length = 166000
Score = 44.1 bits (22), Expect = 0.48
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 644 tccactccccccacccccccacccat 669
||||| ||||||||||||||||||||
Sbjct: 41225 tccaccccccccacccccccacccat 41200
</PRE>
<PRE>
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 645 ccactccccccacccccccaccca 668
|||||||||||||||| |||||||
Sbjct: 100584 ccactccccccaccccgccaccca 100561
</PRE>
<PRE>
><a name = 29788929></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=29788929&dopt=GenBank" >gb|AC130206.2|</a> Mus musculus BAC clone RP24-448F6 from chromosome 13, complete sequence
Length = 155659
Score = 42.1 bits (21), Expect = 1.9
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 643 ctccactccccccacccccccaccc 667
|||||| ||||||||||||||||||
Sbjct: 13770 ctccaccccccccacccccccaccc 13794
</PRE>
<PRE>
><a name = 30409940></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=30409940&dopt=GenBank" >gb|AC123056.4|</a> Mus musculus BAC clone RP23-182H4 from chromosome 13, complete sequence
Length = 183076
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 171955 ccccccacccccccacccatc 171935
</PRE>
<PRE>
><a name = 38371907></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=38371907&dopt=GenBank" >gb|AC102652.9|</a> Mus musculus chromosome 6, clone RP23-20L3, complete sequence
Length = 229752
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 200 gtaagttattgttggttcttt 220
|||||||||||||||||||||
Sbjct: 84546 gtaagttattgttggttcttt 84526
</PRE>
<PRE>
><a name = 22748560></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22748560&dopt=GenBank" >gb|AC121839.3|</a> Mus musculus BAC clone RP24-76E2 from chromosome 13, complete
sequence
Length = 182835
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 2038 ccccccacccccccacccatc 2018
</PRE>
<PRE>
><a name = 29825882></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=29825882&dopt=GenBank" >gb|AC126263.4|</a> Mus musculus BAC clone RP23-359P12 from chromosome 8, complete sequence
Length = 223991
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 396 ggaatgtctctgtactcacct 416
|||||||||||||||||||||
Sbjct: 43351 ggaatgtctctgtactcacct 43331
</PRE>
<PRE>
><a name = 32452851></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=32452851&dopt=GenBank" >gb|AC116371.5|</a> Mus musculus chromosome 17, clone RP24-228A1, complete sequence
Length = 109222
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 599 ttaatgacactaacattgcta 619
|||||||||||||||||||||
Sbjct: 25068 ttaatgacactaacattgcta 25048
</PRE>
<PRE>
><a name = 55774330></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55774330&dopt=GenBank" >gb|AC130542.4|</a> Mus musculus chromosome 6 clone RP24-167F4, complete sequence
Length = 192106
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 19058 actccccccacccccccaccc 19078
</PRE>
<PRE>
><a name = 55368509></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55368509&dopt=GenBank" >gb|AC104918.13|</a> Mus musculus chromosome 7, clone RP23-335G1, complete sequence
Length = 204099
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 641 tcctccactccccccaccccc 661
|||||||||||||||||||||
Sbjct: 144689 tcctccactccccccaccccc 144669
</PRE>
<PRE>
><a name = 55251489></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55251489&dopt=GenBank" >gb|AC123692.25|</a> Mus musculus chromosome 15, clone RP23-326B14, complete sequence
Length = 202833
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccca 668
|||||||||||||||||||||
Sbjct: 149526 ctccccccacccccccaccca 149506
</PRE>
<PRE>
><a name = 40994806></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=40994806&dopt=GenBank" >emb|BX890639.3|</a> Mouse DNA sequence from clone RP23-290E8 on chromosome X, complete
sequence
Length = 150029
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 648 ctccccccacccccccaccca 668
|||||||||||||||||||||
Sbjct: 52395 ctccccccacccccccaccca 52415
</PRE>
<PRE>
><a name = 21211978></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=21211978&dopt=GenBank" >emb|AL645570.13|</a> Mouse DNA sequence from clone RP23-377H12 on chromosome 11 Contains two
novel genes, the 3' end of the Meis1 gene for myeloid
ecotropic viral integration site 1 and two CpG islands,
complete sequence
Length = 190198
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 73310 actccccccacccccccaccc 73330
</PRE>
<PRE>
><a name = 22711745></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22711745&dopt=GenBank" >gb|AC107892.9|</a> Homo sapiens chromosome 18, clone RP11-100K18, complete sequence
Length = 173744
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 648 ctccccccacccccccaccca 668
|||||||||||||||||||||
Sbjct: 39115 ctccccccacccccccaccca 39135
</PRE>
<PRE>
><a name = 22795232></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22795232&dopt=GenBank" >gb|AC124854.2|</a> Homo sapiens chromosome 5 clone RP11-133F8, complete sequence
Length = 149205
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 552 tgaaaggcactatagaaatgt 572
|||||||||||||||||||||
Sbjct: 58451 tgaaaggcactatagaaatgt 58471
</PRE>
<PRE>
><a name = 22798011></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22798011&dopt=GenBank" >emb|AL691459.25|</a> Human DNA sequence from clone RP11-543D5 on chromosome 1 Contains four
novel genes and a CpG island, complete sequence
Length = 139890
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 651 cccccacccccccacccatct 671
|||||||||||||||||||||
Sbjct: 70667 cccccacccccccacccatct 70647
</PRE>
<PRE>
><a name = 10277925></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10277925&dopt=GenBank" >emb|AL158159.14|</a> Human DNA sequence from clone RP11-498N2 on chromosome 9 Contains the 3'
end of the CHAC gene for chorea acanthocytosis, the 3' end
of the GNA14 gene for guanine nucleotide binding protein (G
protein) alpha 14 and the 5' end of a novel gene, complete
sequence
Length = 167006
Score = 42.1 bits (21), Expect = 1.9
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 447 gtttctagagagcctgaaaaccaag 471
||||||||||||||||||| |||||
Sbjct: 117461 gtttctagagagcctgaaatccaag 117485
</PRE>
<PRE>
><a name = 21389294></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=21389294&dopt=GenBank" >gb|AC011846.16|</a> Homo sapiens chromosome 15, clone RP11-346A8, complete sequence
Length = 147760
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 67 ggccctgggctgtgagagcac 87
|||||||||||||||||||||
Sbjct: 15298 ggccctgggctgtgagagcac 15318
</PRE>
<PRE>
><a name = 3132341></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=03132341&dopt=GenBank" >dbj|AP000031.1|</a> Homo sapiens genomic DNA, chromosome 21q22.1, segment 2/28, complete
sequence
Length = 149298
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 80969 ccccccacccccccacccatc 80949
</PRE>
<PRE>
><a name = 24459907></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24459907&dopt=GenBank" >emb|AJ504410.1|TRU504410</a> Takifugu rubripes egln1 gene (partial), trax gene and disc1 gene
Length = 44904
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccac 665
|||||||||||||||||||||
Sbjct: 38985 ccactccccccacccccccac 39005
</PRE>
<PRE>
><a name = 20330981></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20330981&dopt=GenBank" >gb|AC105129.4|</a> Homo sapiens chromosome 15, clone RP11-349G13, complete sequence
Length = 198295
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 67 ggccctgggctgtgagagcac 87
|||||||||||||||||||||
Sbjct: 59585 ggccctgggctgtgagagcac 59565
</PRE>
<PRE>
><a name = 28201477></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=28201477&dopt=GenBank" >gb|AC099489.2|</a> Homo sapiens chromosome 16 clone CTD-3088G3, complete sequence
Length = 204493
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 77957 ccccccacccccccacccatc 77977
</PRE>
<PRE>
><a name = 15431057></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15431057&dopt=GenBank" >gb|AC068665.3|</a> Mus musculus chromosome 5 clone RP23-426K16 strain C57BL6/J, complete
sequence
Length = 205937
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 95513 actccccccacccccccaccc 95493
</PRE>
<PRE>
><a name = 19698711></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=19698711&dopt=GenBank" >gb|AC027359.7|</a> Homo sapiens chromosome 18, clone RP11-13L18, complete sequence
Length = 159043
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 648 ctccccccacccccccaccca 668
|||||||||||||||||||||
Sbjct: 60329 ctccccccacccccccaccca 60349
</PRE>
<PRE>
><a name = 8050885></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=08050885&dopt=GenBank" >gb|AC025416.4|AC025416</a> Genomic sequence for Arabidopsis thaliana BAC F5O11 from chromosome I,
complete sequence
Length = 118374
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 574 catttgtgtcctattgtctac 594
|||||||||||||||||||||
Sbjct: 47113 catttgtgtcctattgtctac 47133
</PRE>
<PRE>
><a name = 26251310></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=26251310&dopt=GenBank" >gb|AE016753.1|</a> Mus musculus chromosome 10 high-growth region, section 1 of 2 of the
complete sequence
Length = 350029
Score = 42.1 bits (21), Expect = 1.9
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 643 ctccactccccccacccccccaccc 667
|||||| ||||||||||||||||||
Sbjct: 261736 ctccaccccccccacccccccaccc 261760
</PRE>
<PRE>
><a name = 16945890></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=16945890&dopt=GenBank" >gb|AF329945.1|AF329945</a> Takifugu rubripes SUN-like 1 (SUNL1), chromosome 17 open reading frame 27
(C17orf27), transcription factor SOX9 (SOX9), and
somatostatin receptor 2 (SSTR2) genes, complete cds; and
ubiquitin-specific-protease-3-like protein (USP3L) gene,
partial cds
Length = 194498
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 113678 actccccccacccccccaccc 113698
</PRE>
<PRE>
><a name = 7768676></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=07768676&dopt=GenBank" >dbj|AP001711.1|</a> Homo sapiens genomic DNA, chromosome 21q, section 55/105
Length = 340000
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 327975 ccccccacccccccacccatc 327955
</PRE>
<PRE>
><a name = 33146033></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=33146033&dopt=GenBank" >emb|AL928889.14|</a> Mouse DNA sequence from clone RP23-271L22 on chromosome 2, complete
sequence
Length = 197191
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 641 tcctccactccccccaccccc 661
|||||||||||||||||||||
Sbjct: 8834 tcctccactccccccaccccc 8854
</PRE>
<PRE>
><a name = 15808587></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15808587&dopt=GenBank" >gb|AC061961.6|</a> Homo sapiens chromosome 2, clone RP11-754B23, complete sequence
Length = 91734
Score = 42.1 bits (21), Expect = 1.9
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 4 atttgtttagcctttcatgtcaaaa 28
||||||||||||||| |||||||||
Sbjct: 13915 atttgtttagccttttatgtcaaaa 13891
</PRE>
<PRE>
><a name = 15419815></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15419815&dopt=GenBank" >gb|AF296663.1|AF296663S1</a> Mus musculus NKR-P1E pseudogene, exon 1
Length = 1923
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccca 668
|||||||||||||||||||||
Sbjct: 1274 ctccccccacccccccaccca 1254
</PRE>
<PRE>
><a name = 15375164></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15375164&dopt=GenBank" >gb|AC026780.5|</a> Homo sapiens chromosome 5 clone CTC-529L17, complete sequence
Length = 170059
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 552 tgaaaggcactatagaaatgt 572
|||||||||||||||||||||
Sbjct: 154122 tgaaaggcactatagaaatgt 154142
</PRE>
<PRE>
><a name = 52077881></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=52077881&dopt=GenBank" >gb|AC133174.5|</a> Mus musculus BAC clone RP24-314N20 from 12, complete sequence
Length = 208222
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 113420 actccccccacccccccaccc 113440
</PRE>
<PRE>
><a name = 53382712></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=53382712&dopt=GenBank" >gb|AC138025.4|</a> Mus musculus BAC clone RP24-430F5 from 8, complete sequence
Length = 165737
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 396 ggaatgtctctgtactcacct 416
|||||||||||||||||||||
Sbjct: 53215 ggaatgtctctgtactcacct 53235
</PRE>
<PRE>
><a name = 55700248></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55700248&dopt=GenBank" >gb|AC142191.5|</a> Mus musculus BAC clone RP24-530N5 from 6, complete sequence
Length = 197971
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccca 668
|||||||||||||||||||||
Sbjct: 4968 ctccccccacccccccaccca 4948
</PRE>
<PRE>
><a name = 10334968></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=10334968&dopt=GenBank" >gb|AC013447.4|AC013447</a> Homo sapiens BAC clone RP11-543D5 from 1, complete sequence
Length = 166143
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 651 cccccacccccccacccatct 671
|||||||||||||||||||||
Sbjct: 96519 cccccacccccccacccatct 96499
</PRE>
<PRE>
><a name = 51315686></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51315686&dopt=GenBank" >gb|AC140110.2|</a> Mus musculus BAC clone RP23-29H6 from 6, complete sequence
Length = 214089
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 149671 actccccccacccccccaccc 149691
</PRE>
<PRE>
><a name = 12831362></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=12831362&dopt=GenBank" >gb|AC090111.1|AC090111</a> Homo sapiens chromosome 21 clone unknown, complete sequence
Length = 136653
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 99741 ccccccacccccccacccatc 99761
</PRE>
<PRE>
><a name = 8886984></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=08886984&dopt=GenBank" >gb|AC026776.4|AC026776</a> Homo sapiens chromosome 21 clone CTC-304G18, complete sequence
Length = 136653
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 99741 ccccccacccccccacccatc 99761
</PRE>
<PRE>
><a name = 21738578></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=21738578&dopt=GenBank" >emb|AL731558.14|</a> Mouse DNA sequence from clone RP23-235D11 on chromosome 2, complete
sequence
Length = 222163
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 642 cctccactccccccacccccc 662
|||||||||||||||||||||
Sbjct: 172587 cctccactccccccacccccc 172607
</PRE>
<PRE>
><a name = 15858953></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15858953&dopt=GenBank" >emb|AL590414.4|</a> Mouse DNA sequence from clone RP23-305K11 on chromosome 2, complete
sequence
Length = 79126
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 316 tctgttaaatctcccctccct 336
|||||||||||||||||||||
Sbjct: 74096 tctgttaaatctcccctccct 74076
</PRE>
<PRE>
><a name = 22859036></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=22859036&dopt=GenBank" >emb|AL663091.13|</a> Mouse DNA sequence from clone RP23-392P11 on chromosome 2, complete
sequence
Length = 196078
Score = 42.1 bits (21), Expect = 1.9
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 643 ctccactccccccacccccccaccc 667
||||||||||||||| |||||||||
Sbjct: 104587 ctccactccccccacacccccaccc 104611
</PRE>
<PRE>
><a name = 5912108></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=05912108&dopt=GenBank" >emb|AL117417.1|HSM801111</a> Homo sapiens mRNA; cDNA DKFZp434E098 (from clone DKFZp434E098)
Length = 3005
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 1965 ccccccacccccccacccatc 1985
</PRE>
<PRE>
><a name = 39652680></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=39652680&dopt=GenBank" >gb|AC145549.3|</a> Mus musculus BAC clone RP23-21M23 from chromosome 19, complete sequence
Length = 247655
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 135556 actccccccacccccccaccc 135536
</PRE>
<PRE>
><a name = 39752885></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=39752885&dopt=GenBank" >gb|AC132957.3|</a> Mus musculus BAC clone RP23-149E9 from chromosome 19, complete sequence
Length = 246177
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 647 actccccccacccccccaccc 667
|||||||||||||||||||||
Sbjct: 195760 actccccccacccccccaccc 195740
</PRE>
<PRE>
><a name = 9690320></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=09690320&dopt=GenBank" >gb|AC011489.6|AC011489</a> Homo sapiens chromosome 19 clone CTB-179K24, complete sequence
Length = 164034
Score = 42.1 bits (21), Expect = 1.9
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 85 cactcagggaggtgacctttctgac 109
|||||||||| ||||||||||||||
Sbjct: 146955 cactcagggatgtgacctttctgac 146979
</PRE>
<PRE>
><a name = 4835623></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04835623&dopt=GenBank" >dbj|AP000254.1|</a> Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
clone:S322, complete sequence
Length = 25737
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 20853 ccccccacccccccacccatc 20833
</PRE>
<PRE>
><a name = 4827161></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04827161&dopt=GenBank" >dbj|AP000213.1|</a> Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
f43D11-119B8, segment 11/12, complete sequence
Length = 100000
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccatc 670
|||||||||||||||||||||
Sbjct: 40963 ccccccacccccccacccatc 40943
</PRE>
<PRE>
><a name = 46092385></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46092385&dopt=GenBank" >dbj|AP006274.1|</a> Papio hamadryas genomic DNA, BAC clone: RPCI41-217F13, chromosome 3,
complete sequence
Length = 178968
Score = 42.1 bits (21), Expect = 1.9
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 642 cctccactccccccacccccc 662
|||||||||||||||||||||
Sbjct: 97821 cctccactccccccacccccc 97841
</PRE>
<PRE>
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 642 cctccactccccccaccccc 661
||||||||||||||||||||
Sbjct: 98245 cctccactccccccaccccc 98264
</PRE>
<PRE>
><a name = 55657641></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55657641&dopt=GenBank" >ref|XM_525492.1|</a> PREDICTED: Pan troglodytes similar to transcriptional activator-like
(LOC470108), mRNA
Length = 3942
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 63 ccagggccctgggctgtgag 82
||||||||||||||||||||
Sbjct: 2093 ccagggccctgggctgtgag 2112
</PRE>
<PRE>
><a name = 46428559></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46428559&dopt=GenBank" >emb|CR389914.1|</a> Gallus gallus finished cDNA, clone ChEST998b22
Length = 1613
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 552 tgaaaggcactatagaaatg 571
||||||||||||||||||||
Sbjct: 1463 tgaaaggcactatagaaatg 1482
</PRE>
<PRE>
><a name = 23346550></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=23346550&dopt=GenBank" >ref|NM_153114.1|</a> Mus musculus otospiralin (Otos), mRNA
Length = 476
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 643 ctccactccccccacccccc 662
||||||||||||||||||||
Sbjct: 420 ctccactccccccacccccc 401
</PRE>
<PRE>
><a name = 45752220></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=45752220&dopt=GenBank" >emb|BX294126.10|</a> Zebrafish DNA sequence from clone DKEYP-35B8 in linkage group 2, complete
sequence
Length = 179476
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 650 ccccccacccccccacccat 669
||||||||||||||||||||
Sbjct: 153736 ccccccacccccccacccat 153717
</PRE>
<PRE>
><a name = 52077710></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=52077710&dopt=GenBank" >gb|AC102714.16|</a> Mus musculus chromosome 5, clone RP24-298D13, complete sequence
Length = 165774
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 642 cctccactccccccaccccc 661
||||||||||||||||||||
Sbjct: 159658 cctccactccccccaccccc 159639
</PRE>
<PRE>
><a name = 51948685></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51948685&dopt=GenBank" >gb|AC140038.12|</a> Mus musculus chromosome 1, clone RP24-290D14, complete sequence
Length = 172019
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 34389 ctccccccacccccccaccc 34370
</PRE>
<PRE>
><a name = 51921434></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51921434&dopt=GenBank" >gb|AC120863.9|</a> Mus musculus chromosome 7, clone RP23-84H3, complete sequence
Length = 241742
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 199085 ctccccccacccccccaccc 199066
</PRE>
<PRE>
><a name = 40994805></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=40994805&dopt=GenBank" >emb|BX890633.3|</a> Mouse DNA sequence from clone RP23-391L13 on chromosome X, complete
sequence
Length = 33624
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 26061 ctccccccacccccccaccc 26042
</PRE>
<PRE>
><a name = 15131484></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15131484&dopt=GenBank" >emb|AL391476.20|</a> Human DNA sequence from clone RP11-229A19 on chromosome 1 Contains the
3' end of the TTF2 gene for RNA polymerase II
transcription termination factor, the TRIM45 gene for
tripartite motif-containing 45, a ribosomal protein S15a
(RPS15A) pseudogene, the gene for immune costimulatory
protein B7-H4 and a CpG island, complete sequence
Length = 171595
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 107 gacagatgaagcaatgtgtg 126
||||||||||||||||||||
Sbjct: 62784 gacagatgaagcaatgtgtg 62765
</PRE>
<PRE>
><a name = 51372095></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=51372095&dopt=GenBank" >gb|AC093363.12|</a> Mus musculus chromosome 7, clone RP23-60O3, complete sequence
Length = 254081
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 156336 ctccccccacccccccaccc 156317
</PRE>
<PRE>
><a name = 20068308></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20068308&dopt=GenBank" >emb|AL355805.20|</a> Human DNA sequence from clone RP11-29L10 on chromosome Xq21.1-21.33
Contains a ribosomal protein L6 (RPL6) pseudogene,
complete sequence
Length = 76507
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 556 aggcactatagaaatgtaca 575
||||||||||||||||||||
Sbjct: 39991 aggcactatagaaatgtaca 40010
</PRE>
<PRE>
><a name = 24431570></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=24431570&dopt=GenBank" >gb|AC090058.21|</a> Homo sapiens 12 BAC RP11-112N23 (Roswell Park Cancer Institute Human BAC
Library) complete sequence
Length = 181102
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 645 ccactccccccacccccccaccca 668
|||| |||||||||||||||||||
Sbjct: 136236 ccaccccccccacccccccaccca 136213
</PRE>
<PRE>
><a name = 34787257></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=34787257&dopt=GenBank" >emb|AL662922.10|</a> Mouse DNA sequence from clone RP23-195K1 on chromosome X, complete
sequence
Length = 215916
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 311 acacttctgttaaatctccc 330
||||||||||||||||||||
Sbjct: 153890 acacttctgttaaatctccc 153871
</PRE>
<PRE>
><a name = 34221794></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=34221794&dopt=GenBank" >emb|AL773561.7|</a> Mouse DNA sequence from clone RP23-71D9 on chromosome X, complete
sequence
Length = 174072
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 86245 ctccccccacccccccaccc 86264
</PRE>
<PRE>
><a name = 33942029></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=33942029&dopt=GenBank" >emb|AL831719.6|</a> Mouse DNA sequence from clone RP23-166I8 on chromosome 4, complete
sequence
Length = 194025
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 645 ccactccccccacccccccaccca 668
|||| |||||||||||||||||||
Sbjct: 88030 ccaccccccccacccccccaccca 88053
</PRE>
<PRE>
><a name = 50400110></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=50400110&dopt=GenBank" >gb|AC126600.6|</a> Mus musculus chromosome 1, clone RP23-145J9, complete sequence
Length = 219130
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 643 ctccactccccccacccccc 662
||||||||||||||||||||
Sbjct: 130440 ctccactccccccacccccc 130421
</PRE>
<PRE>
><a name = 19774329></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=19774329&dopt=GenBank" >gb|AC109129.3|</a> Homo sapiens 3 BAC RP11-784B9 (Roswell Park Cancer Institute Human BAC
Library) complete sequence
Length = 181158
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 308 tgaacacttctgttaaatct 327
||||||||||||||||||||
Sbjct: 24817 tgaacacttctgttaaatct 24836
</PRE>
<PRE>
><a name = 27544972></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=27544972&dopt=GenBank" >gb|AC010287.9|</a> Homo sapiens chromosome 16 clone CTA-331F8, complete sequence
Length = 198949
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 649 tccccccacccccccaccca 668
||||||||||||||||||||
Sbjct: 37248 tccccccacccccccaccca 37229
</PRE>
<PRE>
><a name = 48675503></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=48675503&dopt=GenBank" >gb|AC134561.5|</a> Mus musculus BAC clone RP24-111C16 from chromosome 8, complete sequence
Length = 179978
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 60073 ctccccccacccccccaccc 60054
</PRE>
<PRE>
><a name = 15873099></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15873099&dopt=GenBank" >emb|AJ328681.1|HSA328681</a> Homo sapiens genomic sequence surrounding NotI site, clone
NR1-MC11R
Length = 914
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 167 ctccccccacccccccaccc 186
</PRE>
<PRE>
><a name = 19347615></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=19347615&dopt=GenBank" >gb|AY078071.1|</a> Mus musculus organ of Corti 10 kDa protein mRNA, complete cds
Length = 476
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 643 ctccactccccccacccccc 662
||||||||||||||||||||
Sbjct: 420 ctccactccccccacccccc 401
</PRE>
<PRE>
><a name = 17223203></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=17223203&dopt=GenBank" >gb|AC091643.6|</a> Homo sapiens chromosome 18, clone RP11-727B4, complete sequence
Length = 169944
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 517 ggcaaaaatgatcagttgat 536
||||||||||||||||||||
Sbjct: 80771 ggcaaaaatgatcagttgat 80752
</PRE>
<PRE>
><a name = 50839064></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=50839064&dopt=GenBank" >gb|AC139155.3|</a> Mus musculus BAC clone RP24-209E3 from 13, complete sequence
Length = 161907
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 631 agaaattctgtcctccactccccc 654
||||||||||||| ||||||||||
Sbjct: 96360 agaaattctgtcccccactccccc 96337
</PRE>
<PRE>
><a name = 46810384></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46810384&dopt=GenBank" >gb|AC091458.5|</a> Mus musculus chromosome 12, clone RP23-68M8, complete sequence
Length = 289751
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 178302 ctccccccacccccccaccc 178283
</PRE>
<PRE>
><a name = 50897460></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=50897460&dopt=GenBank" >gb|AC134598.3|</a> Mus musculus BAC clone RP23-175C23 from 8, complete sequence
Length = 205622
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 608 ctaacattgctaaatcttac 627
||||||||||||||||||||
Sbjct: 5281 ctaacattgctaaatcttac 5262
</PRE>
<PRE>
><a name = 55168543></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55168543&dopt=GenBank" >gb|AC145168.5|</a> Mus musculus BAC clone RP23-398K14 from 3, complete sequence
Length = 217058
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 96172 ctccccccacccccccaccc 96153
</PRE>
<PRE>
><a name = 56847894></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=56847894&dopt=GenBank" >gb|AC154372.1|</a> Mus musculus BAC clone RP23-113F18 from 16, complete sequence
Length = 183227
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 560 actatagaaatgtacatttgtgtc 583
||||||| ||||||||||||||||
Sbjct: 49354 actatagcaatgtacatttgtgtc 49377
</PRE>
<PRE>
><a name = 46358465></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=46358465&dopt=GenBank" >gb|AC148682.1|</a> Macaca mulatta Major Histocompatibility Complex MMU151L13, complete
sequence
Length = 199819
Score = 40.1 bits (20), Expect = 7.4
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 636 ttctgtcctccactccccccacccccccaccc 667
|||||| |||| | ||||||||||||||||||
Sbjct: 98736 ttctgtgctccccgccccccacccccccaccc 98767
</PRE>
<PRE>
><a name = 45774037></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=45774037&dopt=GenBank" >gb|AC120150.9|</a> Mus musculus chromosome 16, clone RP24-241C15, complete sequence
Length = 166172
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 645 ccactccccccacccccccaccca 668
||||||||||||||| ||||||||
Sbjct: 79048 ccactccccccacccacccaccca 79025
</PRE>
<PRE>
><a name = 55700762></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=55700762&dopt=GenBank" >dbj|AB128049.1|</a> Macaca mulatta genes, MHC class I region, partial and complete cds
Length = 3284914
Score = 40.1 bits (20), Expect = 7.4
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 636 ttctgtcctccactccccccacccccccaccc 667
|||||| |||| | ||||||||||||||||||
Sbjct: 3167015 ttctgtgctccccgccccccacccccccaccc 3166984
</PRE>
<PRE>
><a name = 45504247></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=45504247&dopt=GenBank" >gb|AC147784.3|</a> Canis Familiaris, clone XX-25F3, complete sequence
Length = 176851
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 45541 ctccccccacccccccaccc 45522
</PRE>
<PRE>
><a name = 20386827></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=20386827&dopt=GenBank" >emb|AL591884.11|</a> Mouse DNA sequence from clone RP23-183N8 on chromosome 2, complete
sequence
Length = 204495
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 648 ctccccccacccccccaccc 667
||||||||||||||||||||
Sbjct: 74912 ctccccccacccccccaccc 74893
</PRE>
<PRE>
><a name = 15142995></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=15142995&dopt=GenBank" >emb|AL512293.2|LMFP696</a> Leishmania major Friedlin chromosome 14 PAC P696, PREFINAL
Length = 172148
Score = 40.1 bits (20), Expect = 7.4
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 642 cctccactccccccacccccccac 665
||||| ||||||||||||||||||
Sbjct: 160711 cctcccctccccccacccccccac 160688
</PRE>
<PRE>
><a name = 26101057></a><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=26101057&dopt=GenBank" >dbj|AK083090.1|</a> Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched
library, clone:C630001J02 product:unclassifiable, full
insert sequence
Length = 2991
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 643 ctccactccccccacccccc 662
||||||||||||||||||||
Sbjct: 2960 ctccactccccccacccccc 2941
</PRE>
<form>
<PRE>
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 2897336
Number of Hits to DB: 9,733,526
Number of extensions: 530735
Number of successful extensions: 12794
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's gapped: 12794
Number of HSP's successfully gapped: 18
Number of extra gapped extensions for HSPs above 10.0: 12739
Length of query: 701
Length of database: 13,306,357,995
Length adjustment: 22
Effective length of query: 679
Effective length of database: 13,242,616,603
Effective search space: 8991736673437
Effective search space used: 8991736673437
A: 0
X1: 11 (21.8 bits)
X2: 15 (30.0 bits)
X3: 25 (50.0 bits)
S1: 14 (25.0 bits)
S2: 20 (40.1 bits)
</form>
|