1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99
|
# Make sure the translation functions work.
import string
# Start simple - unambiguous DNA to unambiguous protein
from Bio import Seq
from Bio import Alphabet
from Bio.Alphabet import IUPAC
s = "TCAAAAAGGTGCATCTAGATG"
print "Starting with", s
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
from Bio import Translate
# use the standard table
trans = Translate.unambiguous_dna_by_id[1]
protein = trans.translate_to_stop(dna)
assert isinstance(protein.alphabet, IUPAC.IUPACProtein)
print len(protein), "ungapped residues translated"
gapped_protein = trans.translate(dna)
assert isinstance(gapped_protein.alphabet, Alphabet.HasStopCodon)
print protein.tostring()
print len(gapped_protein), "residues translated, including gaps"
print gapped_protein.tostring()
# This has "AGG" as a stop codon
p2 = Translate.unambiguous_dna_by_id[2].translate_to_stop(dna)
print len(p2), "SGC1 has a stop codon"
print p2.tostring()
p2 = Translate.unambiguous_dna_by_id[2].translate(dna)
print "Actually, there are", string.count(p2.data, "*"), "stops."
print p2.tostring()
# Make sure I can change the stop character
p2 = Translate.unambiguous_dna_by_id[2].translate(dna, "+")
print "Yep,", string.count(p2.data, "+"), "stops."
print p2.tostring()
# back translation is not unique!
back_dna = trans.back_translate(protein)
print back_dna.tostring()
assert len(back_dna) == len(protein) * 3
assert isinstance(back_dna.alphabet, IUPAC.IUPACUnambiguousDNA)
# but forward again better give the same results
# (Note: the alphabets will differ - translate returns a gap encoding)
double_back_protein = trans.translate(back_dna)
assert double_back_protein.data == protein.data
# Try the same trick with stops
back_dna2 = trans.back_translate(gapped_protein)
assert len(back_dna2) == 3*len(gapped_protein)
double_back_protein2 = trans.translate(back_dna2)
assert gapped_protein.data == double_back_protein2.data
print repr(gapped_protein.data), "==", repr(double_back_protein2.data)
# Some of the same things, with RNA
# (The code is the same, so I'm not doing all of the tests.)
rna = Seq.Seq(string.replace(s, "T", "U"), IUPAC.unambiguous_rna)
rna_trans = Translate.unambiguous_rna_by_id[1]
print "RNA translation ...",
protein_from_rna = rna_trans.translate_to_stop(rna)
assert protein.alphabet is protein_from_rna.alphabet
assert protein.data == protein_from_rna.data
print "works."
print "RNA translation to stop ...",
gapped_protein_from_rna = rna_trans.translate(rna)
assert len(gapped_protein) == len(gapped_protein_from_rna)
assert gapped_protein.data == gapped_protein_from_rna.data
print "works."
back_rna = rna_trans.back_translate(protein_from_rna)
assert string.replace(back_dna.data, "T", "U") == back_rna.data
# some tests for "by name"
trans = Translate.unambiguous_dna_by_name[ 'Vertebrate Mitochondrial' ]
trans = Translate.unambiguous_dna_by_name[ 'SGC1' ]
# How about some forward ambiguity?
print "Forward ambiguous"
s = "RATGATTARAATYTA"
# B D * N L
dna = Seq.Seq(s, IUPAC.ambiguous_dna)
trans = Translate.ambiguous_dna_by_id[1]
protein = trans.translate(dna)
print protein.tostring()
stop_protein = trans.translate_to_stop(dna)
print stop_protein.tostring()
# XXX (Backwards with ambiguity code is unfinished!)
|