1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174
|
<HTML>
<HEAD>
<TITLE>BLAST Search Results </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" LINK="#0000FF" VLINK="#660099" ALINK="#660099">
<A HREF="http://www.ncbi.nlm.nih.gov/BLAST/blast_form.map"> <IMG SRC="http://www.ncbi.nlm.nih.gov/BLAST/blast_results.gif" BORDER=0 ISMAP></A>
<BR><BR><PRE>
<b>BLASTN 2.0.10 [Aug-26-1999]</b>
<b><a href="http://www.ncbi.nlm.nih.gov/htbin-
post/Entrez/query?uid=9254694&form=6&db=m&Dopt=r">Reference</a>:</b>
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
<p>
<b>Query=</b> gi|1348916|gb|G26684.1|G26684 human STS STS_D11570.
(285 letters)
<b>Database:</b> Non-redundant Database of GenBank STS Division
89,405 sequences; 32,867,852 total letters
<p> <p>If you have any problems or questions with the results of this search <br>please refer to the <b><a href=http://www.ncbi.nlm.nih.gov/BLAST/blast_FAQs.html>BLAST FAQs</a></b><br><p>
<FORM NAME="BLASTFORM">
</PRE>
<CENTER>
<H3><a href="/BLAST/newoptions.html#graphical-overview"> Distribution of 4 Blast Hits on the Query Sequence</a></H3>
<input name=defline size=80 value="Mouse-over to show defline and scores. Click to show alignments">
</CENTER>
<map name=img_map>
<area shape=rect coords=69,101,523,106 href="#1348916" ONMOUSEOVER='document.BLASTFORM.defline.value="G26684 human STS STS_D11570. gi|1375195|gb|G26945|G26945 huma..S= 517 E=1e-146"' ONMOUSEOUT='document.BLASTFORM.defline.value="Mouse-over to show defline and scores. Click to show alignments"' >
<area shape=rect coords=403,108,432,113 href="#6120827" ONMOUSEOVER='document.BLASTFORM.defline.value="G55508 SHGC-100856 Human Homo sapiens STS genomic, sequence tagge..S=32.2 E=1.7"' ONMOUSEOUT='document.BLASTFORM.defline.value="Mouse-over to show defline and scores. Click to show alignments"' >
<area shape=rect coords=421,115,445,120 href="#4516686" ONMOUSEOVER='document.BLASTFORM.defline.value="AU026763 Rattus norvegicus, OTSUKA clone, OT33.16/752f07, microsa..S=32.2 E=1.7"' ONMOUSEOUT='document.BLASTFORM.defline.value="Mouse-over to show defline and scores. Click to show alignments"' >
<area shape=rect coords=483,108,507,113 href="#720683" ONMOUSEOVER='document.BLASTFORM.defline.value="G03725 human STS WI-344...S=32.2 E=1.7"' ONMOUSEOUT='document.BLASTFORM.defline.value="Mouse-over to show defline and scores. Click to show alignments"' >
</map>
<CENTER>
<IMG WIDTH=529 HEIGHT=122 USEMAP=#img_map BORDER=1 SRC="nph-getgif.cgi?iblast0&207891705325813.gif" ISMAP></CENTER>
<HR>
<PRE>
<PRE>
Score E
Sequences producing significant alignments: (bits) Value
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=01348916&dopt=GenBank">gb|G26684|G26684</a> human STS STS_D11570. >gi|1375195|gb|G2694... <a href = #1348916>517</a> e-146
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04516686&dopt=GenBank">dbj|AU026763.1|AU026763</a> Rattus norvegicus, OTSUKA clone, OT... <a href = #4516686> 32</a> 1.7
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=06120827&dopt=GenBank">gb|G55508.1|G55508</a> SHGC-100856 Human Homo sapiens STS genom... <a href = #6120827> 32</a> 1.7
<a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=00720683&dopt=GenBank">gb|G03725|G03725</a> human STS WI-344. <a href = #720683> 32</a> 1.7
<PRE>
<a name = 1348916> </a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=01348916&dopt=GenBank">gb|G26684|G26684</a> human STS STS_D11570. >gi|1375195|gb|G26945|G26945 human STS
SHGC-32699.
Length = 285
Score = 517 bits (261), Expect = e-146
Identities = 285/285 (100%)
Strand = Plus / Plus
Query: 1 gatccctacccttnccgttggtctctntcgctgactcgaggcacctaacatccattcaca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gatccctacccttnccgttggtctctntcgctgactcgaggcacctaacatccattcaca 60
Query: 61 cccaacacaggccagcgacttctggggctcagccacagacatggtttgtnactnttgagc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 cccaacacaggccagcgacttctggggctcagccacagacatggtttgtnactnttgagc 120
Query: 121 ttctgttcctagagaatcctagaggcttgattggcccaggctgctgtntgtnctggaggc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ttctgttcctagagaatcctagaggcttgattggcccaggctgctgtntgtnctggaggc 180
Query: 181 aaagaatccctacctcctaggggtgaaaggaaatnaaaatggaaagttcttgtagcgcaa 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 aaagaatccctacctcctaggggtgaaaggaaatnaaaatggaaagttcttgtagcgcaa 240
Query: 241 ggcctgacatgggtagctgctcaataaatgctagtntgttatttc 285
|||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ggcctgacatgggtagctgctcaataaatgctagtntgttatttc 285
</PRE>
<PRE>
<a name = 4516686> </a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=04516686&dopt=GenBank">dbj|AU026763.1|AU026763</a> Rattus norvegicus, OTSUKA clone, OT33.16/752f07, microsatellite
sequence, sequence tagged site
Length = 307
Score = 32.2 bits (16), Expect = 1.7
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 221 ggaaagttcttgtagc 236
||||||||||||||||
Sbjct: 32 ggaaagttcttgtagc 47
</PRE>
<PRE>
<a name = 6120827> </a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=06120827&dopt=GenBank">gb|G55508.1|G55508</a> SHGC-100856 Human Homo sapiens STS genomic, sequence tagged site
Length = 711
Score = 32.2 bits (16), Expect = 1.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 210 gaaatnaaaatggaaagtt 228
||||| |||||||||||||
Sbjct: 588 gaaataaaaatggaaagtt 606
</PRE>
<PRE>
<a name = 720683> </a><a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=00720683&dopt=GenBank">gb|G03725|G03725</a> human STS WI-344.
Length = 246
Score = 32.2 bits (16), Expect = 1.7
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 260 ctcaataaatgctagt 275
||||||||||||||||
Sbjct: 178 ctcaataaatgctagt 163
</PRE>
<PRE>
Database: Non-redundant Database of GenBank STS Division
Posted date: Dec 18, 1999 7:45 PM
Number of letters in database: 32,867,852
Number of sequences in database: 89,405
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3932
Number of Sequences: 89405
Number of extensions: 3932
Number of successful extensions: 1177
Number of sequences better than 10.0: 4
length of query: 285
length of database: 32,867,852
effective HSP length: 17
effective length of query: 268
effective length of database: 31,347,967
effective search space: 8401255156
effective search space used: 8401255156
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)
</PRE>
</BODY>
</HTML>
</BODY>
</HTML>
|