1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
|
# Make sure the translation functions work.
# Start simple - unambiguous DNA to unambiguous protein
from Bio import Seq
from Bio import Alphabet
from Bio.Alphabet import IUPAC
# First, test the transcription functions
s = "ATA"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
rna = dna.transcribe()
assert rna.tostring()=="AUA"
s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
rna = dna.transcribe()
assert rna.tostring()=='GAAAAUUCAUUUUCUUUGGACUUUCUCUGAAAUCCGAGUCCUAGGAAAGAUGCGUGAGAUUCUUCAUAUU'
s = "GAAAAUUCAUUUUCUUUGGACUUUCUCUGAAAUCCGAGUCCUAGGAAAGAUGCGUGAGAUUCUUCAUAUU"
rna = Seq.Seq(s, IUPAC.unambiguous_rna)
dna = rna.back_transcribe()
assert dna.tostring()=='GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT'
# use the standard table
# Do some simple tests first
s = "T"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(to_stop=True)
assert protein.tostring()==""
s = "TC"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(to_stop=True)
assert protein.tostring()==""
s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(to_stop=True)
assert protein.tostring()=='ENSFSLDFL'
s = "GAA"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(15, to_stop=True)
assert protein.tostring()=="E"
s = "ATA"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate('Vertebrate Mitochondrial', to_stop=True)
assert protein.tostring()=="M"
s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate('SGC8', to_stop=True)
assert protein.tostring()=='ENSFSLDFLWNPSPSNDAWDSSY'
# use the standard table
s = "TCAAAAAGGTGCATCTAGATG"
print "Starting with", s
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(to_stop=True)
assert isinstance(protein.alphabet, IUPAC.IUPACProtein)
print len(protein), "ungapped residues translated"
gapped_protein = dna.translate()
assert isinstance(gapped_protein.alphabet, Alphabet.HasStopCodon)
print protein.tostring()
print len(gapped_protein), "residues translated, including gaps"
print gapped_protein.tostring()
# This has "AGG" as a stop codon
p2 = dna.translate(table=2, to_stop=True)
print len(p2), "SGC1 has a stop codon"
print p2.tostring()
p2 = dna.translate(table=2)
print "Actually, there are", p2.data.count("*"), "stops."
print p2.tostring()
# Make sure I can change the stop character
p2 = dna.translate(table=2, stop_symbol="+")
print "Yep,", p2.data.count("+"), "stops."
print p2.tostring()
# Some of the same things, with RNA
# (The code is the same, so I'm not doing all of the tests.)
rna = Seq.Seq(s.replace("T", "U"), IUPAC.unambiguous_rna)
print "RNA translation ...",
protein_from_rna = rna.translate(to_stop=True)
assert protein.alphabet is protein_from_rna.alphabet
assert protein.data == protein_from_rna.data
print "works."
print "RNA translation to stop ...",
gapped_protein_from_rna = rna.translate()
assert len(gapped_protein) == len(gapped_protein_from_rna)
assert gapped_protein.data == gapped_protein_from_rna.data
print "works."
# some tests for "by name"
# How about some forward ambiguity?
print "Forward ambiguous"
s = "RATGATTARAATYTA"
# B D * N L
dna = Seq.Seq(s, IUPAC.ambiguous_dna)
protein = dna.translate('Vertebrate Mitochondrial')
print protein.tostring()
stop_protein = dna.translate('SGC1', to_stop=True)
print stop_protein.tostring()
# XXX (Backwards with ambiguity code is unfinished!)
|