1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502
|
\chapter{Sequence motif analysis using Bio.motifs}
This chapter gives an overview of the functionality of the
\verb|Bio.motifs| package included in Biopython. It is intended
for people who are involved in the analysis of sequence motifs, so I'll
assume that you are familiar with basic notions of motif analysis. In
case something is unclear, please look at Section~\ref{sec:links}
for some relevant links.
Most of this chapter describes the new \verb|Bio.motifs| package included
in Biopython 1.61 onwards, which is replacing the older \verb|Bio.Motif| package
introduced with Biopython 1.50, which was in turn based on two older former
Biopython modules, \verb|Bio.AlignAce| and \verb|Bio.MEME|. It provides
most of their functionality with a unified motif object implementation.
Speaking of other libraries, if you are reading this you might be
interested in \href{http://fraenkel-nsf.csbi.mit.edu/TAMO/}{TAMO}, another python library
designed to deal with sequence motifs. It supports more \emph{de-novo}
motif finders, but it is not a part of Biopython and has some restrictions
on commercial use.
\section{Motif objects}
\label{sec:object}
Since we are interested in motif analysis, we need to take a look at
\verb|Motif| objects in the first place. For that we need to import
the Bio.motifs library:
%doctest ../Tests/Motif
\begin{verbatim}
>>> from Bio import motifs
\end{verbatim}
and we can start creating our first motif objects. We can either create
a \verb+Motif+ object from a list of instances of the motif, or we can
obtain a \verb+Motif+ object by parsing a file from a motif database
or motif finding software.
\subsection{Creating a motif from instances}
Suppose we have these instances of a DNA motif:
%cont-doctest
\begin{verbatim}
>>> from Bio.Seq import Seq
>>> instances = [Seq("TACAA"),
... Seq("TACGC"),
... Seq("TACAC"),
... Seq("TACCC"),
... Seq("AACCC"),
... Seq("AATGC"),
... Seq("AATGC"),
... ]
\end{verbatim}
then we can create a Motif object as follows:
%cont-doctest
\begin{verbatim}
>>> m = motifs.create(instances)
\end{verbatim}
The instances are saved in an attribute \verb+m.instances+, which is essentially a Python list with some added functionality, as described below.
Printing out the Motif object shows the instances from which it was constructed:
%cont-doctest
\begin{verbatim}
>>> print(m)
TACAA
TACGC
TACAC
TACCC
AACCC
AATGC
AATGC
<BLANKLINE>
\end{verbatim}
The length of the motif is defined as the sequence length, which should be the same for all instances:
%cont-doctest
\begin{verbatim}
>>> len(m)
5
\end{verbatim}
The Motif object has an attribute \verb+.counts+ containing the counts of each
nucleotide at each position. Printing this counts matrix shows it in an easily readable format:
%cont-doctest
\begin{verbatim}
>>> print(m.counts)
0 1 2 3 4
A: 3.00 7.00 0.00 2.00 1.00
C: 0.00 0.00 5.00 2.00 6.00
G: 0.00 0.00 0.00 3.00 0.00
T: 4.00 0.00 2.00 0.00 0.00
<BLANKLINE>
\end{verbatim}
You can access these counts as a dictionary:
%cont-doctest
\begin{verbatim}
>>> m.counts["A"]
[3, 7, 0, 2, 1]
\end{verbatim}
but you can also think of it as a 2D array with the nucleotide as the first
dimension and the position as the second dimension:
%cont-doctest
\begin{verbatim}
>>> m.counts["T", 0]
4
>>> m.counts["T", 2]
2
>>> m.counts["T", 3]
0
\end{verbatim}
You can also directly access columns of the counts matrix
%Don't doctest this as dictionary order is platform dependent:
\begin{verbatim}
>>> m.counts[:, 3]
{'A': 2, 'C': 2, 'T': 0, 'G': 3}
\end{verbatim}
Instead of the nucleotide itself, you can also use the index of the nucleotide
in the sorted letters in the alphabet of the motif:
%cont-doctest
\begin{verbatim}
>>> m.alphabet
IUPACUnambiguousDNA()
>>> m.alphabet.letters
'GATC'
>>> sorted(m.alphabet.letters)
['A', 'C', 'G', 'T']
>>> m.counts["A",:]
(3, 7, 0, 2, 1)
>>> m.counts[0,:]
(3, 7, 0, 2, 1)
\end{verbatim}
The motif has an associated consensus sequence, defined as the sequence of
letters along the positions of the motif for which the largest value in the
corresponding columns of the \verb+.counts+ matrix is obtained:
%cont-doctest
\begin{verbatim}
>>> m.consensus
Seq('TACGC', IUPACUnambiguousDNA())
\end{verbatim}
as well as an anticonsensus sequence, corresponding to the smallest values in
the columns of the \verb+.counts+ matrix:
%cont-doctest
\begin{verbatim}
>>> m.anticonsensus
Seq('GGGTG', IUPACUnambiguousDNA())
\end{verbatim}
You can also ask for a degenerate consensus sequence, in which ambiguous
nucleotides are used for positions where there are multiple nucleotides with
high counts:
%cont-doctest
\begin{verbatim}
>>> m.degenerate_consensus
Seq('WACVC', IUPACAmbiguousDNA())
\end{verbatim}
Here, W and R follow the IUPAC nucleotide ambiguity codes: W is either A or T,
and V is A, C, or G \cite{cornish1985}. The degenerate consensus sequence is
constructed following the rules specified by Cavener \cite{cavener1987}.
We can also get the reverse complement of a motif:
%cont-doctest
\begin{verbatim}
>>> r = m.reverse_complement()
>>> r.consensus
Seq('GCGTA', IUPACUnambiguousDNA())
>>> r.degenerate_consensus
Seq('GBGTW', IUPACAmbiguousDNA())
>>> print(r)
TTGTA
GCGTA
GTGTA
GGGTA
GGGTT
GCATT
GCATT
<BLANKLINE>
\end{verbatim}
The reverse complement and the degenerate consensus sequence are
only defined for DNA motifs.
\subsection{Creating a sequence logo}
If we have internet access, we can create a \href{https://weblogo.berkeley.edu}{weblogo}:
\begin{verbatim}
>>> m.weblogo("mymotif.png")
\end{verbatim}
We should get our logo saved as a PNG in the specified file.
\section{Reading motifs}
\label{sec:io}
Creating motifs from instances by hand is a bit boring, so it's
useful to have some I/O functions for reading and writing
motifs. There are not any really well established standards for storing
motifs, but there are a couple of formats that are more used than
others.
\subsection{JASPAR}
One of the most popular motif databases is \href{http://jaspar.genereg.net}{JASPAR}. In addition to the motif sequence information, the JASPAR database stores a lot of meta-information for each motif. The module \verb+Bio.motifs+ contains a specialized class \verb+jaspar.Motif+ in which this meta-information is represented as attributes:
\begin{itemize}
\item \verb+matrix_id+ - the unique JASPAR motif ID, e.g. 'MA0004.1'
\item \verb+name+ - the name of the TF, e.g. 'Arnt'
\item \verb+collection+ - the JASPAR collection to which the motif belongs, e.g. 'CORE'
\item \verb+tf_class+ - the structual class of this TF, e.g. 'Zipper-Type'
\item \verb+tf_family+ - the family to which this TF belongs, e.g. 'Helix-Loop-Helix'
\item \verb+species+ - the species to which this TF belongs, may have multiple values, these are specified as taxonomy IDs, e.g. 10090
\item \verb+tax_group+ - the taxonomic supergroup to which this motif belongs, e.g. 'vertebrates'
\item \verb+acc+ - the accession number of the TF protein, e.g. 'P53762'
\item \verb+data_type+ - the type of data used to construct this motif, e.g. 'SELEX'
\item \verb+medline+ - the Pubmed ID of literature supporting this motif, may be multiple values, e.g. 7592839
\item \verb+pazar_id+ - external reference to the TF in the \href{http://pazar.info}{PAZAR} database, e.g. 'TF0000003'
\item \verb+comment+ - free form text containing notes about the construction of the motif
\end{itemize}
The \verb+jaspar.Motif+ class inherits from the generic \verb+Motif+ class and therefore provides all the facilities of any of the motif formats --- reading motifs, writing motifs, scanning sequences for motif instances etc.
JASPAR stores motifs in several different ways including three different flat file formats and as an SQL database. All of these formats facilitate the construction of a counts matrix. However, the amount of meta information described above that is available varies with the format.
\subsubsection*{The JASPAR \texttt{sites} format}
The first of the three flat file formats contains a list of instances. As an example, these are the beginning and ending lines of the JASPAR \verb+Arnt.sites+ file showing known binding sites of the mouse helix-loop-helix transcription factor Arnt.
\begin{verbatim}
>MA0004 ARNT 1
CACGTGatgtcctc
>MA0004 ARNT 2
CACGTGggaggtac
>MA0004 ARNT 3
CACGTGccgcgcgc
...
>MA0004 ARNT 18
AACGTGacagccctcc
>MA0004 ARNT 19
AACGTGcacatcgtcc
>MA0004 ARNT 20
aggaatCGCGTGc
\end{verbatim}
The parts of the sequence in capital letters are the motif instances that were found to align to each other.
We can create a \verb+Motif+ object from these instances as follows:
%cont-doctest
\begin{verbatim}
>>> from Bio import motifs
>>> with open("Arnt.sites") as handle:
... arnt = motifs.read(handle, "sites")
...
\end{verbatim}
The instances from which this motif was created is stored in the \verb+.instances+ property:
%cont-doctest
\begin{verbatim}
>>> print(arnt.instances[:3])
[Seq('CACGTG', IUPACUnambiguousDNA()), Seq('CACGTG', IUPACUnambiguousDNA()), Seq('CACGTG', IUPACUnambiguousDNA())]
>>> for instance in arnt.instances:
... print(instance)
...
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
CACGTG
AACGTG
AACGTG
AACGTG
AACGTG
CGCGTG
\end{verbatim}
The counts matrix of this motif is automatically calculated from the instances:
%cont-doctest
\begin{verbatim}
>>> print(arnt.counts)
0 1 2 3 4 5
A: 4.00 19.00 0.00 0.00 0.00 0.00
C: 16.00 0.00 20.00 0.00 0.00 0.00
G: 0.00 1.00 0.00 20.00 0.00 20.00
T: 0.00 0.00 0.00 0.00 20.00 0.00
<BLANKLINE>
\end{verbatim}
This format does not store any meta information.
\subsubsection*{The JASPAR \texttt{pfm} format}
JASPAR also makes motifs available directly as a count matrix,
without the instances from which it was created. This \verb+pfm+ format only
stores the counts matrix for a single motif.
For example, this is the JASPAR file \verb+SRF.pfm+ containing the counts matrix for the human SRF transcription factor:
\begin{verbatim}
2 9 0 1 32 3 46 1 43 15 2 2
1 33 45 45 1 1 0 0 0 1 0 1
39 2 1 0 0 0 0 0 0 0 44 43
4 2 0 0 13 42 0 45 3 30 0 0
\end{verbatim}
We can create a motif for this count matrix as follows:
%cont-doctest
\begin{verbatim}
>>> with open("SRF.pfm") as handle:
... srf = motifs.read(handle, "pfm")
...
>>> print(srf.counts)
0 1 2 3 4 5 6 7 8 9 10 11
A: 2.00 9.00 0.00 1.00 32.00 3.00 46.00 1.00 43.00 15.00 2.00 2.00
C: 1.00 33.00 45.00 45.00 1.00 1.00 0.00 0.00 0.00 1.00 0.00 1.00
G: 39.00 2.00 1.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 44.00 43.00
T: 4.00 2.00 0.00 0.00 13.00 42.00 0.00 45.00 3.00 30.00 0.00 0.00
<BLANKLINE>
\end{verbatim}
As this motif was created from the counts matrix directly, it has no instances associated with it:
%cont-doctest
\begin{verbatim}
>>> print(srf.instances)
None
\end{verbatim}
We can now ask for the consensus sequence of these two motifs:
%cont-doctest
\begin{verbatim}
>>> print(arnt.counts.consensus)
CACGTG
>>> print(srf.counts.consensus)
GCCCATATATGG
\end{verbatim}
As with the instances file, no meta information is stored in this format.
\subsubsection*{The JASPAR format \texttt{jaspar}}
The \verb+jaspar+ file format allows multiple motifs to be specified in a single file. In this format each of the motif records consist of a header line followed by four lines defining the counts matrix. The header line begins with a \verb+>+ character (similar to the Fasta file format) and is followed by the unique JASPAR matrix ID and the TF name. The following example shows a \verb+jaspar+ formatted file containing the three motifs Arnt, RUNX1 and MEF2A:
\begin{verbatim}
>MA0004.1 Arnt
A [ 4 19 0 0 0 0 ]
C [16 0 20 0 0 0 ]
G [ 0 1 0 20 0 20 ]
T [ 0 0 0 0 20 0 ]
>MA0002.1 RUNX1
A [10 12 4 1 2 2 0 0 0 8 13 ]
C [ 2 2 7 1 0 8 0 0 1 2 2 ]
G [ 3 1 1 0 23 0 26 26 0 0 4 ]
T [11 11 14 24 1 16 0 0 25 16 7 ]
>MA0052.1 MEF2A
A [ 1 0 57 2 9 6 37 2 56 6 ]
C [50 0 1 1 0 0 0 0 0 0 ]
G [ 0 0 0 0 0 0 0 0 2 50 ]
T [ 7 58 0 55 49 52 21 56 0 2 ]
\end{verbatim}
The motifs are read as follows:
\begin{verbatim}
>>> fh = open("jaspar_motifs.txt")
>>> for m in motifs.parse(fh, "jaspar"))
... print(m)
TF name Arnt
Matrix ID MA0004.1
Matrix:
0 1 2 3 4 5
A: 4.00 19.00 0.00 0.00 0.00 0.00
C: 16.00 0.00 20.00 0.00 0.00 0.00
G: 0.00 1.00 0.00 20.00 0.00 20.00
T: 0.00 0.00 0.00 0.00 20.00 0.00
TF name RUNX1
Matrix ID MA0002.1
Matrix:
0 1 2 3 4 5 6 7 8 9 10
A: 10.00 12.00 4.00 1.00 2.00 2.00 0.00 0.00 0.00 8.00 13.00
C: 2.00 2.00 7.00 1.00 0.00 8.00 0.00 0.00 1.00 2.00 2.00
G: 3.00 1.00 1.00 0.00 23.00 0.00 26.00 26.00 0.00 0.00 4.00
T: 11.00 11.00 14.00 24.00 1.00 16.00 0.00 0.00 25.00 16.00 7.00
TF name MEF2A
Matrix ID MA0052.1
Matrix:
0 1 2 3 4 5 6 7 8 9
A: 1.00 0.00 57.00 2.00 9.00 6.00 37.00 2.00 56.00 6.00
C: 50.00 0.00 1.00 1.00 0.00 0.00 0.00 0.00 0.00 0.00
G: 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 2.00 50.00
T: 7.00 58.00 0.00 55.00 49.00 52.00 21.00 56.00 0.00 2.00
\end{verbatim}
Note that printing a JASPAR motif yields both the counts data and the available meta-information.
\subsubsection*{Accessing the JASPAR database}
In addition to parsing these flat file formats, we can also retrieve motifs from a JASPAR SQL database. Unlike the flat file formats, a JASPAR database allows storing of all possible meta information defined in the JASPAR \verb+Motif+ class. It is beyond the scope of this document to describe how to set up a JASPAR database (please see the main \href{http://jaspar.genereg.net}{JASPAR} website). Motifs are read from a JASPAR database using the \verb+Bio.motifs.jaspar.db+ module. First connect to the JASPAR database using the JASPAR5 class which models the the latest JASPAR schema:
\begin{verbatim}
>>> from Bio.motifs.jaspar.db import JASPAR5
>>>
>>> JASPAR_DB_HOST = <hostname>
>>> JASPAR_DB_NAME = <db_name>
>>> JASPAR_DB_USER = <user>
>>> JASPAR_DB_PASS = <passord>
>>>
>>> jdb = JASPAR5(
... host=JASPAR_DB_HOST,
... name=JASPAR_DB_NAME,
... user=JASPAR_DB_USER,
... password=JASPAR_DB_PASS
... )
\end{verbatim}
Now we can fetch a single motif by its unique JASPAR ID with the \verb+fetch_motif_by_id+ method. Note that a JASPAR ID conists of a base ID and a version number seperated by a decimal point, e.g. 'MA0004.1'. The \verb+fetch_motif_by_id+ method allows you to use either the fully specified ID or just the base ID. If only the base ID is provided, the latest version of the motif is returned.
\begin{verbatim}
>>> arnt = jdb.fetch_motif_by_id("MA0004")
\end{verbatim}
Printing the motif reveals that the JASPAR SQL database stores much more meta-information than the flat files:
\begin{verbatim}
>>> print(arnt)
TF name Arnt
Matrix ID MA0004.1
Collection CORE
TF class Zipper-Type
TF family Helix-Loop-Helix
Species 10090
Taxonomic group vertebrates
Accession ['P53762']
Data type used SELEX
Medline 7592839
PAZAR ID TF0000003
Comments -
Matrix:
0 1 2 3 4 5
A: 4.00 19.00 0.00 0.00 0.00 0.00
C: 16.00 0.00 20.00 0.00 0.00 0.00
G: 0.00 1.00 0.00 20.00 0.00 20.00
T: 0.00 0.00 0.00 0.00 20.00 0.00
\end{verbatim}
We can also fetch motifs by name. The name must be an exact match (partial matches or database wildcards are not currently supported). Note that as the name is not guaranteed to be unique, the \verb+fetch_motifs_by_name+ method actually returns a list.
\begin{verbatim}
>>> motifs = jdb.fetch_motifs_by_name("Arnt")
>>> print(motifs[0])
TF name Arnt
Matrix ID MA0004.1
Collection CORE
TF class Zipper-Type
TF family Helix-Loop-Helix
Species 10090
Taxonomic group vertebrates
Accession ['P53762']
Data type used SELEX
Medline 7592839
PAZAR ID TF0000003
Comments -
Matrix:
0 1 2 3 4 5
A: 4.00 19.00 0.00 0.00 0.00 0.00
C: 16.00 0.00 20.00 0.00 0.00 0.00
G: 0.00 1.00 0.00 20.00 0.00 20.00
T: 0.00 0.00 0.00 0.00 20.00 0.00
\end{verbatim}
The \verb+fetch_motifs+ method allows you to fetch motifs which match a specified set of criteria. These criteria include any of the above described meta information as well as certain matrix properties such as the minimum information content (\verb+min_ic+ in the example below), the minimum length of the matrix or the minimum number of sites used to construct the matrix. Only motifs which pass ALL the specified criteria are returned. Note that selection criteria which correspond to meta information which allow for multiple values may be specified as either a single value or a list of values, e.g. \verb+tax_group+ and \verb+tf_family+ in the example below.
\begin{verbatim}
>>> motifs = jdb.fetch_motifs(
... collection = "CORE",
... tax_group = ["vertebrates", "insects"],
... tf_class = "Winged Helix-Turn-Helix",
... tf_family = ["Forkhead", "Ets"],
... min_ic = 12
... )
>>> for motif in motifs:
... pass # do something with the motif
\end{verbatim}
\subsubsection*{Compatibility with Perl TFBS modules}
An important thing to note is that the JASPAR \verb+Motif+ class was designed to be compatible with the popular \href{http://tfbs.genereg.net/}{Perl TFBS modules}. Therefore some specifics about the choice of defaults for background and pseudocounts as well as how information content is computed and sequences searched for instances is based on this compatibility criteria. These choices are noted in the specific subsections below.
\begin{itemize}
\item{\bf Choice of background:} \\
The Perl \verb+TFBS+ modules appear to allow a choice of custom background probabilities (although the documentation states that uniform background is assumed). However the default is to use a uniform background. Therefore it is recommended that you use a uniform background for computing the position-specific scoring matrix (PSSM). This is the default when using the Biopython \verb+motifs+ module.
\item{\bf Choice of pseudocounts:} \\
By default, the Perl \verb+TFBS+ modules use a pseudocount equal to $\sqrt{N} * \textrm{bg}[\textrm{nucleotide}]$, where $N$ represents the total number of sequences used to construct the matrix. To apply this same pseudocount formula, set the motif \verb+pseudocounts+ attribute using the \verb+jaspar.calculate\_pseudcounts()+ function:
\begin{verbatim}
>>> motif.pseudocounts = motifs.jaspar.calculate_pseudocounts(motif)
\end{verbatim}
Note that it is possible for the counts matrix to have an unequal number of sequences making up the columns. The pseudocount computation uses the average number of sequences making up the matrix. However, when \verb+normalize+ is called on the counts matrix, each count value in a column is divided by the total number of sequences making up that specific column, not by the average number of sequences. This differs from the Perl \verb+TFBS+ modules because the normalization is not done as a separate step and so the average number of sequences is used throughout the computation of the pssm. Therefore, for matrices with unequal column counts, the PSSM computed by the \verb+motifs+ module will differ somewhat from the pssm computed by the Perl \verb+TFBS+ modules.
\item{\bf Computation of matrix information content:} \\
The information content (IC) or specificity of a matrix is computed using the \verb+mean+ method of the \verb+PositionSpecificScoringMatrix+ class. However of note, in the Perl \verb+TFBS+ modules the default behaviour is to compute the IC without first applying pseudocounts, even though by default the PSSMs are computed using pseudocounts as described above.
\item{\bf Searching for instances:} \\
Searching for instances with the Perl \verb+TFBS+ motifs was usually performed using a relative score threshold, i.e. a score in the range 0 to 1. In order to compute the absolute PSSM score corresponding to a relative score one can use the equation:
\begin{verbatim}
>>> abs_score = (pssm.max - pssm.min) * rel_score + pssm.min
\end{verbatim}
To convert the absolute score of an instance back to a relative score, one can use the equation:
\begin{verbatim}
>>> rel_score = (abs_score - pssm.min) / (pssm.max - pssm.min)
\end{verbatim}
For example, using the Arnt motif before, let's search a sequence with a relative score threshold of 0.8.
%TODO - Check missing ... lines, make into a doctest?
\begin{verbatim}
>>> test_seq=Seq("TAAGCGTGCACGCGCAACACGTGCATTA", unambiguous_dna)
>>> arnt.pseudocounts = motifs.jaspar.calculate_pseudocounts(arnt)
>>> pssm = arnt.pssm
>>> max_score = pssm.max
>>> min_score = pssm.min
>>> abs_score_threshold = (max_score - min_score) * 0.8 + min_score
>>> for position, score in pssm.search(test_seq,
threshold=abs_score_threshold):
... rel_score = (score - min_score) / (max_score - min_score)
... print("Position %d: score = %5.3f, rel. score = %5.3f" % (
position, score, rel_score))
...
Position 2: score = 5.362, rel. score = 0.801
Position 8: score = 6.112, rel. score = 0.831
Position -20: score = 7.103, rel. score = 0.870
Position 17: score = 10.351, rel. score = 1.000
Position -11: score = 10.351, rel. score = 1.000
\end{verbatim}
\end{itemize}
\subsection{MEME}
MEME \cite{bailey1994} is a tool for discovering motifs in a group of related
DNA or protein sequences. It takes as input a group of DNA or protein sequences
and outputs as many motifs as requested. Therefore, in contrast to JASPAR
files, MEME output files typically contain multiple motifs. This is an example.
At the top of an output file generated by MEME shows some background information
about the MEME and the version of MEME used:
\begin{verbatim}
********************************************************************************
MEME - Motif discovery tool
********************************************************************************
MEME version 3.0 (Release date: 2004/08/18 09:07:01)
...
\end{verbatim}
Further down, the input set of training sequences is recapitulated:
\begin{verbatim}
********************************************************************************
TRAINING SET
********************************************************************************
DATAFILE= INO_up800.s
ALPHABET= ACGT
Sequence name Weight Length Sequence name Weight Length
------------- ------ ------ ------------- ------ ------
CHO1 1.0000 800 CHO2 1.0000 800
FAS1 1.0000 800 FAS2 1.0000 800
ACC1 1.0000 800 INO1 1.0000 800
OPI3 1.0000 800
********************************************************************************
\end{verbatim}
and the exact command line that was used:
\begin{verbatim}
********************************************************************************
COMMAND LINE SUMMARY
********************************************************************************
This information can also be useful in the event you wish to report a
problem with the MEME software.
command: meme -mod oops -dna -revcomp -nmotifs 2 -bfile yeast.nc.6.freq INO_up800.s
...
\end{verbatim}
Next is detailed information on each motif that was found:
\begin{verbatim}
********************************************************************************
MOTIF 1 width = 12 sites = 7 llr = 95 E-value = 2.0e-001
********************************************************************************
--------------------------------------------------------------------------------
Motif 1 Description
--------------------------------------------------------------------------------
Simplified A :::9:a::::3:
pos.-specific C ::a:9:11691a
probability G ::::1::94:4:
matrix T aa:1::9::11:
\end{verbatim}
To parse this file (stored as \verb+meme.dna.oops.txt+), use
%cont-doctest
\begin{verbatim}
>>> with open("meme.dna.oops.txt") as handle:
... record = motifs.parse(handle, "meme")
...
\end{verbatim}
The \verb+motifs.parse+ command reads the complete file directly, so you can
close the file after calling \verb+motifs.parse+.
The header information is stored in attributes:
%cont-doctest
\begin{verbatim}
>>> record.version
'3.0'
>>> record.datafile
'INO_up800.s'
>>> record.command
'meme -mod oops -dna -revcomp -nmotifs 2 -bfile yeast.nc.6.freq INO_up800.s'
>>> record.alphabet
IUPACUnambiguousDNA()
>>> record.sequences
['CHO1', 'CHO2', 'FAS1', 'FAS2', 'ACC1', 'INO1', 'OPI3']
\end{verbatim}
The record is an object of the \verb+Bio.motifs.meme.Record+ class.
The class inherits from list, and you can think of \verb+record+ as a list of Motif objects:
%cont-doctest
\begin{verbatim}
>>> len(record)
2
>>> motif = record[0]
>>> print(motif.consensus)
TTCACATGCCGC
>>> print(motif.degenerate_consensus)
TTCACATGSCNC
\end{verbatim}
In addition to these generic motif attributes, each motif also stores its
specific information as calculated by MEME. For example,
%cont-doctest
\begin{verbatim}
>>> motif.num_occurrences
7
>>> motif.length
12
>>> evalue = motif.evalue
>>> print("%3.1g" % evalue)
0.2
>>> motif.name
'Motif 1'
\end{verbatim}
In addition to using an index into the record, as we did above,
you can also find it by its name:
%cont-doctest
\begin{verbatim}
>>> motif = record["Motif 1"]
\end{verbatim}
Each motif has an attribute \verb+.instances+ with the sequence instances
in which the motif was found, providing some information on each instance:
%cont-doctest
\begin{verbatim}
>>> len(motif.instances)
7
>>> motif.instances[0]
Instance('TTCACATGCCGC', IUPACUnambiguousDNA())
>>> motif.instances[0].motif_name
'Motif 1'
>>> motif.instances[0].sequence_name
'INO1'
>>> motif.instances[0].start
620
>>> motif.instances[0].strand
'-'
>>> motif.instances[0].length
12
>>> pvalue = motif.instances[0].pvalue
>>> print("%5.3g" % pvalue)
1.85e-08
\end{verbatim}
\subsubsection*{MAST}
\subsection{TRANSFAC}
TRANSFAC is a manually curated database of transcription factors, together
with their genomic binding sites and DNA binding profiles \cite{matys2003}.
While the file format used in the TRANSFAC database is nowadays also used
by others, we will refer to it as the TRANSFAC file format.
A minimal file in the TRANSFAC format looks as follows:
\begin{verbatim}
ID motif1
P0 A C G T
01 1 2 2 0 S
02 2 1 2 0 R
03 3 0 1 1 A
04 0 5 0 0 C
05 5 0 0 0 A
06 0 0 4 1 G
07 0 1 4 0 G
08 0 0 0 5 T
09 0 0 5 0 G
10 0 1 2 2 K
11 0 2 0 3 Y
12 1 0 3 1 G
//
\end{verbatim}
This file shows the frequency matrix of motif \verb+motif1+ of 12 nucleotides.
In general, one file in the TRANSFAC format can contain multiple motifs. For
example, this is the contents of the example TRANSFAC file \verb+transfac.dat+:
\begin{verbatim}
VV EXAMPLE January 15, 2013
XX
//
ID motif1
P0 A C G T
01 1 2 2 0 S
02 2 1 2 0 R
03 3 0 1 1 A
...
11 0 2 0 3 Y
12 1 0 3 1 G
//
ID motif2
P0 A C G T
01 2 1 2 0 R
02 1 2 2 0 S
...
09 0 0 0 5 T
10 0 2 0 3 Y
//
\end{verbatim}
To parse a TRANSFAC file, use
%cont-doctest
\begin{verbatim}
>>> with open("transfac.dat") as handle:
... record = motifs.parse(handle, "TRANSFAC")
...
\end{verbatim}
The overall version number, if available, is stored as \verb+record.version+:
%cont-doctest
\begin{verbatim}
>>> record.version
'EXAMPLE January 15, 2013'
\end{verbatim}
Each motif in \verb+record+ is in instance of the \verb+Bio.motifs.transfac.Motif+
class, which inherits both from the \verb+Bio.motifs.Motif+ class and
from a Python dictionary. The dictionary uses the two-letter keys to
store any additional information about the motif:
%cont-doctest
\begin{verbatim}
>>> motif = record[0]
>>> motif.degenerate_consensus # Using the Bio.motifs.Motif method
Seq('SRACAGGTGKYG', IUPACAmbiguousDNA())
>>> motif["ID"] # Using motif as a dictionary
'motif1'
\end{verbatim}
TRANSFAC files are typically much more elaborate than this example, containing
lots of additional information about the motif. Table \ref{table:transfaccodes}
lists the two-letter field codes that are commonly found in TRANSFAC files:
\begin{table}[h]
\label{table:transfaccodes}
\begin{center}
\caption{Fields commonly found in TRANSFAC files}
\begin{tabular}{|l|l||}
\verb+AC+ & Accession number \\
\verb+AS+ & Accession numbers, secondary \\
\verb+BA+ & Statistical basis \\
\verb+BF+ & Binding factors \\
\verb+BS+ & Factor binding sites underlying the matrix \\
\verb+CC+ & Comments \\
\verb+CO+ & Copyright notice \\
\verb+DE+ & Short factor description \\
\verb+DR+ & External databases \\
\verb+DT+ & Date created/updated \\
\verb+HC+ & Subfamilies \\
\verb+HP+ & Superfamilies \\
\verb+ID+ & Identifier \\
\verb+NA+ & Name of the binding factor \\
\verb+OC+ & Taxonomic classification \\
\verb+OS+ & Species/Taxon \\
\verb+OV+ & Older version \\
\verb+PV+ & Preferred version \\
\verb+TY+ & Type \\
\verb+XX+ & Empty line; these are not stored in the Record. \\
\end{tabular}
\end{center}
\end{table}
Each motif also has an attribute \verb+.references+ containing the
references associated with the motif, using these two-letter keys:
\begin{table}[h]
\begin{center}
\caption{Fields used to store references in TRANSFAC files}
\begin{tabular}{|l|l||}
\verb+RN+ & Reference number \\
\verb+RA+ & Reference authors \\
\verb+RL+ & Reference data \\
\verb+RT+ & Reference title \\
\verb+RX+ & PubMed ID \\
\end{tabular}
\end{center}
\end{table}
Printing the motifs writes them out in their native TRANSFAC format:
%cont-doctest
\begin{verbatim}
>>> print(record)
VV EXAMPLE January 15, 2013
XX
//
ID motif1
XX
P0 A C G T
01 1 2 2 0 S
02 2 1 2 0 R
03 3 0 1 1 A
04 0 5 0 0 C
05 5 0 0 0 A
06 0 0 4 1 G
07 0 1 4 0 G
08 0 0 0 5 T
09 0 0 5 0 G
10 0 1 2 2 K
11 0 2 0 3 Y
12 1 0 3 1 G
XX
//
ID motif2
XX
P0 A C G T
01 2 1 2 0 R
02 1 2 2 0 S
03 0 5 0 0 C
04 3 0 1 1 A
05 0 0 4 1 G
06 5 0 0 0 A
07 0 1 4 0 G
08 0 0 5 0 G
09 0 0 0 5 T
10 0 2 0 3 Y
XX
//
<BLANKLINE>
\end{verbatim}
You can export the motifs in the TRANSFAC format by capturing this output
in a string and saving it in a file:
\begin{verbatim}
>>> text = str(record)
>>> with open("mytransfacfile.dat", "w") as out_handle:
... out_handle.write(text)
...
\end{verbatim}
\section{Writing motifs}
Speaking of exporting, let's look at export functions in general.
We can use the \verb+format+ method to write the motif in the simple JASPAR \verb+pfm+ format:
%the tabs in the output confuse doctest; don't test
\begin{verbatim}
>>> print(arnt.format("pfm"))
4.00 19.00 0.00 0.00 0.00 0.00
16.00 0.00 20.00 0.00 0.00 0.00
0.00 1.00 0.00 20.00 0.00 20.00
0.00 0.00 0.00 0.00 20.00 0.00
\end{verbatim}
Similarly, we can use \verb+format+ to write the motif in the JASPAR \verb+jaspar+ format:
\begin{verbatim}
>>> print(arnt.format("jaspar"))
>MA0004.1 Arnt
A [ 4.00 19.00 0.00 0.00 0.00 0.00]
C [ 16.00 0.00 20.00 0.00 0.00 0.00]
G [ 0.00 1.00 0.00 20.00 0.00 20.00]
T [ 0.00 0.00 0.00 0.00 20.00 0.00]
\end{verbatim}
To write the motif in a TRANSFAC-like matrix format, use
%cont-doctest
\begin{verbatim}
>>> print(m.format("transfac"))
P0 A C G T
01 3 0 0 4 W
02 7 0 0 0 A
03 0 5 0 2 C
04 2 2 3 0 V
05 1 6 0 0 C
XX
//
<BLANKLINE>
\end{verbatim}
To write out multiple motifs, you can use \verb+motifs.write+.
This function can be used regardless of whether the motifs originated from a TRANSFAC file. For example,
%cont-doctest
\begin{verbatim}
>>> two_motifs = [arnt, srf]
>>> print(motifs.write(two_motifs, "transfac"))
P0 A C G T
01 4 16 0 0 C
02 19 0 1 0 A
03 0 20 0 0 C
04 0 0 20 0 G
05 0 0 0 20 T
06 0 0 20 0 G
XX
//
P0 A C G T
01 2 1 39 4 G
02 9 33 2 2 C
03 0 45 1 0 C
04 1 45 0 0 C
05 32 1 0 13 A
06 3 1 0 42 T
07 46 0 0 0 A
08 1 0 0 45 T
09 43 0 0 3 A
10 15 1 0 30 W
11 2 0 44 0 G
12 2 1 43 0 G
XX
//
<BLANKLINE>
\end{verbatim}
Or, to write multiple motifs in the \verb+jaspar+ format:
\begin{verbatim}
>>> two_motifs = [arnt, mef2a]
>>> print(motifs.write(two_motifs, "jaspar"))
>MA0004.1 Arnt
A [ 4.00 19.00 0.00 0.00 0.00 0.00]
C [ 16.00 0.00 20.00 0.00 0.00 0.00]
G [ 0.00 1.00 0.00 20.00 0.00 20.00]
T [ 0.00 0.00 0.00 0.00 20.00 0.00]
>MA0052.1 MEF2A
A [ 1.00 0.00 57.00 2.00 9.00 6.00 37.00 2.00 56.00 6.00]
C [ 50.00 0.00 1.00 1.00 0.00 0.00 0.00 0.00 0.00 0.00]
G [ 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 2.00 50.00]
T [ 7.00 58.00 0.00 55.00 49.00 52.00 21.00 56.00 0.00 2.00]
\end{verbatim}
\section{Position-Weight Matrices}
The \verb+.counts+ attribute of a Motif object shows how often each
nucleotide appeared at each position along the alignment. We can
normalize this matrix by dividing by the number of instances in the
alignment, resulting in the probability of each nucleotide at each
position along the alignment. We refer to these probabilities as
the position-weight matrix. However, beware that in the literature
this term may also be used to refer to the position-specific scoring
matrix, which we discuss below.
Usually, pseudocounts are added to each position before normalizing.
This avoids overfitting of the position-weight matrix to the limited
number of motif instances in the alignment, and can also prevent
probabilities from becoming zero. To add a fixed pseudocount to all
nucleotides at all positions, specify a number for the
\verb+pseudocounts+ argument:
%cont-doctest
\begin{verbatim}
>>> pwm = m.counts.normalize(pseudocounts=0.5)
>>> print(pwm)
0 1 2 3 4
A: 0.39 0.83 0.06 0.28 0.17
C: 0.06 0.06 0.61 0.28 0.72
G: 0.06 0.06 0.06 0.39 0.06
T: 0.50 0.06 0.28 0.06 0.06
<BLANKLINE>
\end{verbatim}
Alternatively, \verb+pseudocounts+ can be a dictionary specifying the
pseudocounts for each nucleotide. For example, as the GC content of
the human genome is about 40\%, you may want to choose the
pseudocounts accordingly:
%cont-doctest
\begin{verbatim}
>>> pwm = m.counts.normalize(pseudocounts={"A":0.6, "C": 0.4, "G": 0.4, "T": 0.6})
>>> print(pwm)
0 1 2 3 4
A: 0.40 0.84 0.07 0.29 0.18
C: 0.04 0.04 0.60 0.27 0.71
G: 0.04 0.04 0.04 0.38 0.04
T: 0.51 0.07 0.29 0.07 0.07
<BLANKLINE>
\end{verbatim}
The position-weight matrix has its own methods to calculate the
consensus, anticonsensus, and degenerate consensus sequences:
%cont-doctest
\begin{verbatim}
>>> pwm.consensus
Seq('TACGC', IUPACUnambiguousDNA())
>>> pwm.anticonsensus
Seq('GGGTG', IUPACUnambiguousDNA())
>>> pwm.degenerate_consensus
Seq('WACNC', IUPACAmbiguousDNA())
\end{verbatim}
Note that due to the pseudocounts, the degenerate consensus sequence
calculated from the position-weight matrix is slightly different
from the degenerate consensus sequence calculated from the instances
in the motif:
%cont-doctest
\begin{verbatim}
>>> m.degenerate_consensus
Seq('WACVC', IUPACAmbiguousDNA())
\end{verbatim}
The reverse complement of the position-weight matrix can be calculated directly from the \verb+pwm+:
%cont-doctest
\begin{verbatim}
>>> rpwm = pwm.reverse_complement()
>>> print(rpwm)
0 1 2 3 4
A: 0.07 0.07 0.29 0.07 0.51
C: 0.04 0.38 0.04 0.04 0.04
G: 0.71 0.27 0.60 0.04 0.04
T: 0.18 0.29 0.07 0.84 0.40
<BLANKLINE>
\end{verbatim}
\section{Position-Specific Scoring Matrices}
Using the background distribution and PWM with pseudo-counts added,
it's easy to compute the log-odds ratios, telling us what are the log
odds of a particular symbol to be coming from a motif against the
background. We can use the \verb|.log_odds()| method on the position-weight
matrix:
%cont-doctest
\begin{verbatim}
>>> pssm = pwm.log_odds()
>>> print(pssm)
0 1 2 3 4
A: 0.68 1.76 -1.91 0.21 -0.49
C: -2.49 -2.49 1.26 0.09 1.51
G: -2.49 -2.49 -2.49 0.60 -2.49
T: 1.03 -1.91 0.21 -1.91 -1.91
<BLANKLINE>
\end{verbatim}
Here we can see positive values for symbols more frequent in the motif
than in the background and negative for symbols more frequent in the
background. $0.0$ means that it's equally likely to see a symbol in the
background and in the motif.
This assumes that A, C, G, and T are equally likely in the background. To
calculate the position-specific scoring matrix against a background with
unequal probabilities for A, C, G, T, use the \verb+background+ argument.
For example, against a background with a 40\% GC content, use
%cont-doctest
\begin{verbatim}
>>> background = {"A":0.3,"C":0.2,"G":0.2,"T":0.3}
>>> pssm = pwm.log_odds(background)
>>> print(pssm)
0 1 2 3 4
A: 0.42 1.49 -2.17 -0.05 -0.75
C: -2.17 -2.17 1.58 0.42 1.83
G: -2.17 -2.17 -2.17 0.92 -2.17
T: 0.77 -2.17 -0.05 -2.17 -2.17
<BLANKLINE>
\end{verbatim}
The maximum and minimum score obtainable from the PSSM are stored in the
\verb+.max+ and \verb+.min+ properties:
%cont-doctest
\begin{verbatim}
>>> print("%4.2f" % pssm.max)
6.59
>>> print("%4.2f" % pssm.min)
-10.85
\end{verbatim}
The mean and standard deviation of the PSSM scores with respect to a specific
background are calculated by the \verb+.mean+ and \verb+.std+ methods.
%cont-doctest
\begin{verbatim}
>>> mean = pssm.mean(background)
>>> std = pssm.std(background)
>>> print("mean = %0.2f, standard deviation = %0.2f" % (mean, std))
mean = 3.21, standard deviation = 2.59
\end{verbatim}
A uniform background is used if \verb+background+ is not specified.
The mean is particularly important, as its value is equal to the
Kullback-Leibler divergence or relative entropy, and is a measure for the
information content of the motif compared to the background. As in Biopython
the base-2 logarithm is used in the calculation of the log-odds scores, the
information content has units of bits.
The \verb+.reverse_complement+, \verb+.consensus+, \verb+.anticonsensus+, and
\verb+.degenerate_consensus+ methods can be applied directly to PSSM objects.
\section{Searching for instances}
\label{sec:search}
The most frequent use for a motif is to find its instances in some
sequence. For the sake of this section, we will use an artificial sequence like this:
%cont-doctest
\begin{verbatim}
>>> test_seq=Seq("TACACTGCATTACAACCCAAGCATTA", m.alphabet)
>>> len(test_seq)
26
\end{verbatim}
\subsection{Searching for exact matches}
The simplest way to find instances, is to look for exact matches of
the true instances of the motif:
%cont-doctest
\begin{verbatim}
>>> for pos, seq in m.instances.search(test_seq):
... print("%i %s" % (pos, seq))
...
0 TACAC
10 TACAA
13 AACCC
\end{verbatim}
We can do the same with the reverse complement (to find instances on the complementary strand):
%cont-doctest
\begin{verbatim}
>>> for pos, seq in r.instances.search(test_seq):
... print("%i %s" % (pos, seq))
...
6 GCATT
20 GCATT
\end{verbatim}
\subsection{Searching for matches using the PSSM score}
It's just as easy to look for positions, giving rise to high log-odds scores against our motif:
%cont-doctest
\begin{verbatim}
>>> for position, score in pssm.search(test_seq, threshold=3.0):
... print("Position %d: score = %5.3f" % (position, score))
...
Position 0: score = 5.622
Position -20: score = 4.601
Position 10: score = 3.037
Position 13: score = 5.738
Position -6: score = 4.601
\end{verbatim}
The negative positions refer to instances of the motif found on the
reverse strand of the test sequence, and follow the Python convention
on negative indices. Therefore, the instance of the motif at \verb|pos|
is located at \verb|test_seq[pos:pos+len(m)]| both for positive and for
negative values of \verb|pos|.
You may notice the threshold parameter, here set arbitrarily to
$3.0$. This is in $log_2$, so we are now looking only for words, which
are eight times more likely to occur under the motif model than in the
background. The default threshold is $0.0$, which selects everything
that looks more like the motif than the background.
You can also calculate the scores at all positions along the sequence:
%Don't use a doc test for this as the spacing can differ
\begin{verbatim}
>>> pssm.calculate(test_seq)
array([ 5.62230396, -5.6796999 , -3.43177247, 0.93827754,
-6.84962511, -2.04066086, -10.84962463, -3.65614533,
-0.03370807, -3.91102552, 3.03734159, -2.14918518,
-0.6016975 , 5.7381525 , -0.50977498, -3.56422281,
-8.73414803, -0.09919716, -0.6016975 , -2.39429784,
-10.84962463, -3.65614533], dtype=float32)
\end{verbatim}
In general, this is the fastest way to calculate PSSM scores.
The scores returned by \verb+pssm.calculate+ are for the forward strand
only. To obtain the scores on the reverse strand, you can take the reverse
complement of the PSSM:
\begin{verbatim}
>>> rpssm = pssm.reverse_complement()
>>> rpssm.calculate(test_seq)
array([ -9.43458748, -3.06172252, -7.18665981, -7.76216221,
-2.04066086, -4.26466274, 4.60124254, -4.2480607 ,
-8.73414803, -2.26503372, -6.49598789, -5.64668512,
-8.73414803, -10.84962463, -4.82356262, -4.82356262,
-5.64668512, -8.73414803, -4.15613794, -5.6796999 ,
4.60124254, -4.2480607 ], dtype=float32)
\end{verbatim}
\subsection{Selecting a score threshold}
If you want to use a less arbitrary way of selecting thresholds, you
can explore the distribution of PSSM scores. Since the space for a score
distribution grows exponentially with motif length, we are using an
approximation with a given precision to keep computation cost manageable:
%cont-doctest
\begin{verbatim}
>>> distribution = pssm.distribution(background=background, precision=10**4)
\end{verbatim}
The \verb+distribution+ object can be used to determine a number of different thresholds.
We can specify the requested false-positive rate (probability of ``finding'' a motif instance in background generated sequence):
%cont-doctest
\begin{verbatim}
>>> threshold = distribution.threshold_fpr(0.01)
>>> print("%5.3f" % threshold)
4.009
\end{verbatim}
or the false-negative rate (probability of ``not finding'' an instance generated from the motif):
%cont-doctest
\begin{verbatim}
>>> threshold = distribution.threshold_fnr(0.1)
>>> print("%5.3f" % threshold)
-0.510
\end{verbatim}
or a threshold (approximately) satisfying some relation between the false-positive rate and the false-negative rate ($\frac{\textrm{fnr}}{\textrm{fpr}}\simeq t$):
%cont-doctest
\begin{verbatim}
>>> threshold = distribution.threshold_balanced(1000)
>>> print("%5.3f" % threshold)
6.241
\end{verbatim}
or a threshold satisfying (roughly) the equality between the $-log$ of the
false-positive rate and the information content (as used in patser software by
Hertz and Stormo):
%cont-doctest
\begin{verbatim}
>>> threshold = distribution.threshold_patser()
>>> print("%5.3f" % threshold)
0.346
\end{verbatim}
For example, in case of our motif, you can get the threshold giving
you exactly the same results (for this sequence) as searching for
instances with balanced threshold with rate of $1000$.
%cont-doctest
\begin{verbatim}
>>> threshold = distribution.threshold_fpr(0.01)
>>> print("%5.3f" % threshold)
4.009
>>> for position, score in pssm.search(test_seq, threshold=threshold):
... print("Position %d: score = %5.3f" % (position, score))
...
Position 0: score = 5.622
Position -20: score = 4.601
Position 13: score = 5.738
Position -6: score = 4.601
\end{verbatim}
\section{Each motif object has an associated Position-Specific Scoring Matrix}
To facilitate searching for potential TFBSs using PSSMs, both the position-weight matrix and the position-specific scoring matrix are associated with each motif. Using the Arnt motif as an example:
%TODO - Start a new doctest here?
%cont-doctest
\begin{verbatim}
>>> from Bio import motifs
>>> with open("Arnt.sites") as handle:
... motif = motifs.read(handle, "sites")
...
>>> print(motif.counts)
0 1 2 3 4 5
A: 4.00 19.00 0.00 0.00 0.00 0.00
C: 16.00 0.00 20.00 0.00 0.00 0.00
G: 0.00 1.00 0.00 20.00 0.00 20.00
T: 0.00 0.00 0.00 0.00 20.00 0.00
<BLANKLINE>
>>> print(motif.pwm)
0 1 2 3 4 5
A: 0.20 0.95 0.00 0.00 0.00 0.00
C: 0.80 0.00 1.00 0.00 0.00 0.00
G: 0.00 0.05 0.00 1.00 0.00 1.00
T: 0.00 0.00 0.00 0.00 1.00 0.00
<BLANKLINE>
\end{verbatim}
%Can't use next bit in doctest, Windows Python 2.5 and 2.6 put -1.$ not -inf
\begin{verbatim}
>>> print(motif.pssm)
0 1 2 3 4 5
A: -0.32 1.93 -inf -inf -inf -inf
C: 1.68 -inf 2.00 -inf -inf -inf
G: -inf -2.32 -inf 2.00 -inf 2.00
T: -inf -inf -inf -inf 2.00 -inf
<BLANKLINE>
\end{verbatim}
The negative infinities appear here because the corresponding entry in the frequency matrix is 0, and we are using zero pseudocounts by default:
%cont-doctest
\begin{verbatim}
>>> for letter in "ACGT":
... print("%s: %4.2f" % (letter, motif.pseudocounts[letter]))
...
A: 0.00
C: 0.00
G: 0.00
T: 0.00
\end{verbatim}
If you change the \verb+.pseudocounts+ attribute, the position-frequency matrix and the position-specific scoring matrix are recalculated automatically:
%cont-doctest
\begin{verbatim}
>>> motif.pseudocounts = 3.0
>>> for letter in "ACGT":
... print("%s: %4.2f" % (letter, motif.pseudocounts[letter]))
...
A: 3.00
C: 3.00
G: 3.00
T: 3.00
\end{verbatim}
%Can't use this in doctest, Windows Python 2.5 and 2.6 give G/1 as 0.13 not 0.12
%TODO - Check why...
\begin{verbatim}
>>> print(motif.pwm)
0 1 2 3 4 5
A: 0.22 0.69 0.09 0.09 0.09 0.09
C: 0.59 0.09 0.72 0.09 0.09 0.09
G: 0.09 0.12 0.09 0.72 0.09 0.72
T: 0.09 0.09 0.09 0.09 0.72 0.09
<BLANKLINE>
\end{verbatim}
%cont-doctest
\begin{verbatim}
>>> print(motif.pssm)
0 1 2 3 4 5
A: -0.19 1.46 -1.42 -1.42 -1.42 -1.42
C: 1.25 -1.42 1.52 -1.42 -1.42 -1.42
G: -1.42 -1.00 -1.42 1.52 -1.42 1.52
T: -1.42 -1.42 -1.42 -1.42 1.52 -1.42
<BLANKLINE>
\end{verbatim}
You can also set the \verb+.pseudocounts+ to a dictionary over the four nucleotides if you want to use different pseudocounts for them. Setting \verb+motif.pseudocounts+ to \verb+None+ resets it to its default value of zero.
The position-specific scoring matrix depends on the background distribution, which is uniform by default:
%cont-doctest
\begin{verbatim}
>>> for letter in "ACGT":
... print("%s: %4.2f" % (letter, motif.background[letter]))
...
A: 0.25
C: 0.25
G: 0.25
T: 0.25
\end{verbatim}
Again, if you modify the background distribution, the position-specific scoring matrix is recalculated:
%cont-doctest
\begin{verbatim}
>>> motif.background = {"A": 0.2, "C": 0.3, "G": 0.3, "T": 0.2}
>>> print(motif.pssm)
0 1 2 3 4 5
A: 0.13 1.78 -1.09 -1.09 -1.09 -1.09
C: 0.98 -1.68 1.26 -1.68 -1.68 -1.68
G: -1.68 -1.26 -1.68 1.26 -1.68 1.26
T: -1.09 -1.09 -1.09 -1.09 1.85 -1.09
<BLANKLINE>
\end{verbatim}
Setting \verb+motif.background+ to \verb+None+ resets it to a uniform distribution:
%cont-doctest
\begin{verbatim}
>>> motif.background = None
>>> for letter in "ACGT":
... print("%s: %4.2f" % (letter, motif.background[letter]))
...
A: 0.25
C: 0.25
G: 0.25
T: 0.25
\end{verbatim}
If you set \verb+motif.background+ equal to a single value, it will be interpreted as the GC content:
%cont-doctest
\begin{verbatim}
>>> motif.background = 0.8
>>> for letter in "ACGT":
... print("%s: %4.2f" % (letter, motif.background[letter]))
...
A: 0.10
C: 0.40
G: 0.40
T: 0.10
\end{verbatim}
Note that you can now calculate the mean of the PSSM scores over the background against which it was computed:
%cont-doctest
\begin{verbatim}
>>> print("%f" % motif.pssm.mean(motif.background))
4.703928
\end{verbatim}
as well as its standard deviation:
%cont-doctest
\begin{verbatim}
>>> print("%f" % motif.pssm.std(motif.background))
3.290900
\end{verbatim}
and its distribution:
%cont-doctest
\begin{verbatim}
>>> distribution = motif.pssm.distribution(background=motif.background)
>>> threshold = distribution.threshold_fpr(0.01)
>>> print("%f" % threshold)
3.854375
\end{verbatim}
Note that the position-weight matrix and the position-specific scoring matrix are recalculated each time you call \verb+motif.pwm+ or \verb+motif.pssm+, respectively. If speed is an issue and you want to use the PWM or PSSM repeatedly, you can save them as a variable, as in
\begin{verbatim}
>>> pssm = motif.pssm
\end{verbatim}
\section{Comparing motifs}
\label{sec:comp}
Once we have more than one motif, we might want to compare them.
Before we start comparing motifs, I should point out that motif
boundaries are usually quite arbitrary. This means we often need
to compare motifs of different lengths, so comparison needs to involve
some kind of alignment. This means we have to take into account two things:
\begin{itemize}
\item alignment of motifs
\item some function to compare aligned motifs
\end{itemize}
To align the motifs, we use ungapped alignment of PSSMs and substitute zeros
for any missing columns at the beginning and end of the matrices. This means
that effectively we are using the background distribution for columns missing
from the PSSM.
The distance function then returns the minimal distance between motifs, as
well as the corresponding offset in their alignment.
To give an example, let us first load another motif,
which is similar to our test motif \verb|m|:
%TODO - Start a new doctest here?
%cont-doctest
\begin{verbatim}
>>> with open("REB1.pfm") as handle:
... m_reb1 = motifs.read(handle, "pfm")
...
>>> m_reb1.consensus
Seq('GTTACCCGG', IUPACUnambiguousDNA())
>>> print(m_reb1.counts)
0 1 2 3 4 5 6 7 8
A: 30.00 0.00 0.00 100.00 0.00 0.00 0.00 0.00 15.00
C: 10.00 0.00 0.00 0.00 100.00 100.00 100.00 0.00 15.00
G: 50.00 0.00 0.00 0.00 0.00 0.00 0.00 60.00 55.00
T: 10.00 100.00 100.00 0.00 0.00 0.00 0.00 40.00 15.00
<BLANKLINE>
\end{verbatim}
To make the motifs comparable, we choose the same values for the pseudocounts and the background distribution as our motif \verb|m|:
%cont-doctest
\begin{verbatim}
>>> m_reb1.pseudocounts = {"A":0.6, "C": 0.4, "G": 0.4, "T": 0.6}
>>> m_reb1.background = {"A":0.3,"C":0.2,"G":0.2,"T":0.3}
>>> pssm_reb1 = m_reb1.pssm
>>> print(pssm_reb1)
0 1 2 3 4 5 6 7 8
A: 0.00 -5.67 -5.67 1.72 -5.67 -5.67 -5.67 -5.67 -0.97
C: -0.97 -5.67 -5.67 -5.67 2.30 2.30 2.30 -5.67 -0.41
G: 1.30 -5.67 -5.67 -5.67 -5.67 -5.67 -5.67 1.57 1.44
T: -1.53 1.72 1.72 -5.67 -5.67 -5.67 -5.67 0.41 -0.97
<BLANKLINE>
\end{verbatim}
We'll compare these motifs using the Pearson correlation.
Since we want it to resemble a distance measure, we actually take
$1-r$, where $r$ is the Pearson correlation coefficient (PCC):
%cont-doctest
\begin{verbatim}
>>> distance, offset = pssm.dist_pearson(pssm_reb1)
>>> print("distance = %5.3g" % distance)
distance = 0.239
>>> print(offset)
-2
\end{verbatim}
This means that the best PCC between motif \verb|m| and \verb|m_reb1| is obtained with the following alignment:
\begin{verbatim}
m: bbTACGCbb
m_reb1: GTTACCCGG
\end{verbatim}
where \verb|b| stands for background distribution. The PCC itself is
roughly $1-0.239=0.761$.
\section{\emph{De novo} motif finding}
\label{sec:find}
Currently, Biopython has only limited support for \emph{de novo} motif
finding. Namely, we support running \verb|xxmotif| and also parsing of
MEME. Since the number of motif finding tools is growing rapidly,
contributions of new parsers are welcome.
\subsection{MEME}
\label{sec:meme}
Let's assume, you have run MEME on sequences of your choice with your
favorite parameters and saved the output in the file
\verb|meme.out|. You can retrieve the motifs reported by MEME by
running the following piece of code:
%doctest ../Tests/Motif
\begin{verbatim}
>>> from Bio import motifs
>>> with open("meme.out") as handle:
... motifsM = motifs.parse(handle, "meme")
...
\end{verbatim}
\begin{verbatim}
>>> motifsM
[<Bio.motifs.meme.Motif object at 0xc356b0>]
\end{verbatim}
Besides the most wanted list of motifs, the result object contains more useful information, accessible through properties with self-explanatory names:
\begin{itemize}
\item \verb|.alphabet|
\item \verb|.datafile|
\item \verb|.sequence_names|
\item \verb|.version|
\item \verb|.command|
\end{itemize}
The motifs returned by the MEME Parser can be treated exactly like regular
Motif objects (with instances), they also provide some extra
functionality, by adding additional information about the instances.
%cont-doctest
\begin{verbatim}
>>> motifsM[0].consensus
Seq('CTCAATCGTA', IUPACUnambiguousDNA())
>>> motifsM[0].instances[0].sequence_name
'SEQ10;'
>>> motifsM[0].instances[0].start
3
>>> motifsM[0].instances[0].strand
'+'
\end{verbatim}
\begin{verbatim}
>>> motifsM[0].instances[0].pvalue
8.71e-07
\end{verbatim}
\section{Useful links}
\label{sec:links}
\begin{itemize}
\item \href{https://en.wikipedia.org/wiki/Sequence_motif}{Sequence motif} in wikipedia
\item \href{https://en.wikipedia.org/wiki/Position_weight_matrix}{PWM} in wikipedia
\item \href{https://en.wikipedia.org/wiki/Consensus_sequence}{Consensus sequence} in wikipedia
\item \href{http://bio.cs.washington.edu/assessment/}{Comparison of different motif finding programs}
\end{itemize}
|