1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136
|
# Copyright 2004-2008 by Sebastian Bassi.
# Copyright 2013-2018 by Markus Piotrowski.
# All rights reserved.
# This file is part of the Biopython distribution and governed by your
# choice of the "Biopython License Agreement" or the "BSD 3-Clause License".
# Please see the LICENSE file that should have been included as part of this
# package.
"""Calculate the melting temperature of nucleotide sequences.
This module contains three different methods to calculate the melting
temperature of oligonucleotides:
1. Tm_Wallace: 'Rule of thumb'
2. Tm_GC: Empirical formulas based on GC content. Salt and mismatch corrections
can be included.
3. Tm_NN: Calculation based on nearest neighbor thermodynamics. Several tables
for DNA/DNA, DNA/RNA and RNA/RNA hybridizations are included.
Correction for mismatches, dangling ends, salt concentration and other
additives are available.
Tm_staluc is the 'old' NN calculation and is kept for compatibility. It is,
however, recommended to use Tm_NN instead, since Tm_staluc may be depreceated
in the future. Also, Tm_NN has much more options. Using Tm_staluc and Tm_NN
with default parameters gives (essentially) the same results.
General parameters for most Tm methods:
- seq -- A Biopython sequence object or a string.
- check -- Checks if the sequence is valid for the given method (default=
True). In general, whitespaces and non-base characters are removed and
characters are converted to uppercase. RNA will be backtranscribed.
- strict -- Do not allow base characters or neighbor duplex keys (e.g.
'AT/NA') that could not or not unambigiously be evaluated for the respective
method (default=True). Note that W (= A or T) and S (= C or G) are not
ambiguous for Tm_Wallace and Tm_GC. If 'False', average values (if
applicable) will be used.
This module is not able to detect self-complementary and it will not use
alignment tools to align an oligonucleotide sequence to its target sequence.
Thus it can not detect dangling-ends and mismatches by itself (don't even think
about bulbs and loops). These parameters have to be handed over to the
respective method.
Other public methods of this module:
- make_table : To create a table with thermodynamic data.
- salt_correction: To adjust Tm to a given salt concentration by different
formulas. This method is called from Tm_GC and Tm_NN but may
also be accessed 'manually'. It returns a correction term, not
a corrected Tm!
- chem_correction: To adjust Tm regarding the chemical additives DMSO and
formaldehyde. The method returns a corrected Tm. Chemical
correction is not an integral part of the Tm methods and must
be called additionally.
For example:
>>> from Bio.SeqUtils import MeltingTemp as mt
>>> from Bio.Seq import Seq
>>> mystring = 'CGTTCCAAAGATGTGGGCATGAGCTTAC'
>>> myseq = Seq(mystring)
>>> print('%0.2f' % mt.Tm_Wallace(mystring))
84.00
>>> print('%0.2f' % mt.Tm_Wallace(myseq))
84.00
>>> print('%0.2f' % mt.Tm_GC(myseq))
58.73
>>> print('%0.2f' % mt.Tm_NN(myseq))
60.32
Tm_NN with default values gives same result as 'old' Tm_staluc. However, values
differ for RNA, since Tm_staluc had some errors for RNA calculation. These
errors have been fixed in this version.
New Tm_NN can do slightly more:
Using different thermodynamic tables, e.g. from Breslauer '86 or Sugimoto '96:
>>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.DNA_NN1)) # Breslauer '86
72.19
>>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.DNA_NN2)) # Sugimoto '96
65.47
Tables for RNA and RNA/DNA hybrids are included:
>>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.RNA_NN1)) # Freier '86
73.35
>>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.R_DNA_NN1)) # Sugimoto '95
57.17
Several types of salc correction (for Tm_NN and Tm_GC):
>>> for i in range(1, 8):
... print("Type: %d, Tm: %0.2f" % (i, Tm_NN(myseq, saltcorr=i)))
...
Type: 1, Tm: 54.27
Type: 2, Tm: 54.02
Type: 3, Tm: 59.60
Type: 4, Tm: 60.64
Type: 5, Tm: 60.32
Type: 6, Tm: 59.78
Type: 7, Tm: 59.78
Correction for other monovalent cations (K+, Tris), Mg2+ and dNTPs according
to von Ahsen et al. (2001) or Owczarzy et al. (2008) (for Tm_NN and Tm_GC):
>>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10))
60.79
>>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10, Mg=1.5))
67.39
>>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10, Mg=1.5, saltcorr=7))
66.81
>>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10, Mg=1.5, dNTPs=0.6,
... saltcorr=7))
66.04
Dangling ends and mismatches, e.g.::
Oligo: CGTTCCaAAGATGTGGGCATGAGCTTAC CGTTCCaAAGATGTGGGCATGAGCTTAC
::::::X::::::::::::::::::::: or ::::::X:::::::::::::::::::::
Template: GCAAGGcTTCTACACCCGTACTCGAATG TGCAAGGcTTCTACACCCGTACTCGAATGC
Here:
>>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC'))
60.32
>>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC',
... c_seq='GCAAGGcTTCTACACCCGTACTCGAATG'))
55.39
>>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC', shift=1,
... c_seq='TGCAAGGcTTCTACACCCGTACTCGAATGC'))
55.69
The same for RNA:
>>> print('%0.2f' % mt.Tm_NN('CGUUCCAAAGAUGUGGGCAUGAGCUUAC',
... c_seq='UGCAAGGcUUCUACACCCGUACUCGAAUGC',
... shift=1, nn_table=mt.RNA_NN3,
... de_table=mt.RNA_DE1))
73.00
Note, that thermodynamic data are not available for all kind of mismatches,
e.g. most double mismatches or terminal mismaches combined with danglind ends:
>>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC',
... c_seq='TtCAAGGcTTCTACACCCGTACTCGAATGC',
... shift=1))
Traceback (most recent call last):
ValueError: no thermodynamic data for neighbors '.C/TT' available
Make your own tables, or update/extend existing tables. E.g., add values for
locked nucleotides. Here, 'locked A' (and its complement) should be represented
by '1':
>>> mytable = mt.make_table(oldtable=mt.DNA_NN3,
... values={'A1/T1':(-6.608, -17.235),
... '1A/1T':(-6.893, -15.923)})
>>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC'))
60.32
>>> print('%0.2f' % mt.Tm_NN('CGTTCCA1AGATGTGGGCATGAGCTTAC',
... nn_table=mytable, check=False))
... # 'check' must be False, otherwise '1' would be discarded
62.53
"""
import math
import warnings
from Bio import SeqUtils, Seq
from Bio import BiopythonWarning
from Bio import BiopythonDeprecationWarning
# Thermodynamic lookup tables (dictionaries):
# Enthalpy (dH) and entropy (dS) values for nearest neighbors and initiation
# process. Calculation of duplex initiation is quite different in several
# papers; to allow for a general calculation, all different initiation
# parameters are included in all tables and non-applicable parameters are set
# to zero.
# The key is either an initiation type (e.g., 'init_A/T') or a nearest neighbor
# duplex sequence (e.g., GT/CA, to read 5'GT3'-3'CA5'). The values are tuples
# of dH (kcal/mol), dS (cal/mol K).
# Turn black code style off
# fmt: off
# DNA/DNA
# Breslauer et al. (1986), Proc Natl Acad Sci USA 83: 3746-3750
DNA_NN1 = {
"init": (0, 0), "init_A/T": (0, 0), "init_G/C": (0, 0),
"init_oneG/C": (0, -16.8), "init_allA/T": (0, -20.1), "init_5T/A": (0, 0),
"sym": (0, -1.3),
"AA/TT": (-9.1, -24.0), "AT/TA": (-8.6, -23.9), "TA/AT": (-6.0, -16.9),
"CA/GT": (-5.8, -12.9), "GT/CA": (-6.5, -17.3), "CT/GA": (-7.8, -20.8),
"GA/CT": (-5.6, -13.5), "CG/GC": (-11.9, -27.8), "GC/CG": (-11.1, -26.7),
"GG/CC": (-11.0, -26.6)}
# Sugimoto et al. (1996), Nuc Acids Res 24 : 4501-4505
DNA_NN2 = {
"init": (0.6, -9.0), "init_A/T": (0, 0), "init_G/C": (0, 0),
"init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
"sym": (0, -1.4),
"AA/TT": (-8.0, -21.9), "AT/TA": (-5.6, -15.2), "TA/AT": (-6.6, -18.4),
"CA/GT": (-8.2, -21.0), "GT/CA": (-9.4, -25.5), "CT/GA": (-6.6, -16.4),
"GA/CT": (-8.8, -23.5), "CG/GC": (-11.8, -29.0), "GC/CG": (-10.5, -26.4),
"GG/CC": (-10.9, -28.4)}
# Allawi and SantaLucia (1997), Biochemistry 36: 10581-10594
DNA_NN3 = {
"init": (0, 0), "init_A/T": (2.3, 4.1), "init_G/C": (0.1, -2.8),
"init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
"sym": (0, -1.4),
"AA/TT": (-7.9, -22.2), "AT/TA": (-7.2, -20.4), "TA/AT": (-7.2, -21.3),
"CA/GT": (-8.5, -22.7), "GT/CA": (-8.4, -22.4), "CT/GA": (-7.8, -21.0),
"GA/CT": (-8.2, -22.2), "CG/GC": (-10.6, -27.2), "GC/CG": (-9.8, -24.4),
"GG/CC": (-8.0, -19.9)}
# SantaLucia & Hicks (2004), Annu. Rev. Biophys. Biomol. Struct 33: 415-440
DNA_NN4 = {
"init": (0.2, -5.7), "init_A/T": (2.2, 6.9), "init_G/C": (0, 0),
"init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
"sym": (0, -1.4),
"AA/TT": (-7.6, -21.3), "AT/TA": (-7.2, -20.4), "TA/AT": (-7.2, -20.4),
"CA/GT": (-8.5, -22.7), "GT/CA": (-8.4, -22.4), "CT/GA": (-7.8, -21.0),
"GA/CT": (-8.2, -22.2), "CG/GC": (-10.6, -27.2), "GC/CG": (-9.8, -24.4),
"GG/CC": (-8.0, -19.0)}
# RNA/RNA
# Freier et al. (1986), Proc Natl Acad Sci USA 83: 9373-9377
RNA_NN1 = {
"init": (0, -10.8), "init_A/T": (0, 0), "init_G/C": (0, 0),
"init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
"sym": (0, -1.4),
"AA/TT": (-6.6, -18.4), "AT/TA": (-5.7, -15.5), "TA/AT": (-8.1, -22.6),
"CA/GT": (-10.5, -27.8), "GT/CA": (-10.2, -26.2), "CT/GA": (-7.6, -19.2),
"GA/CT": (-13.3, -35.5), "CG/GC": (-8.0, -19.4), "GC/CG": (-14.2, -34.9),
"GG/CC": (-12.2, -29.7)}
# Xia et al (1998), Biochemistry 37: 14719-14735
RNA_NN2 = {
"init": (3.61, -1.5), "init_A/T": (3.72, 10.5), "init_G/C": (0, 0),
"init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
"sym": (0, -1.4),
"AA/TT": (-6.82, -19.0), "AT/TA": (-9.38, -26.7), "TA/AT": (-7.69, -20.5),
"CA/GT": (-10.44, -26.9), "GT/CA": (-11.40, -29.5),
"CT/GA": (-10.48, -27.1), "GA/CT": (-12.44, -32.5),
"CG/GC": (-10.64, -26.7), "GC/CG": (-14.88, -36.9),
"GG/CC": (-13.39, -32.7)}
# Chen et al. (2012), Biochemistry 51: 3508-3522
RNA_NN3 = {
"init": (6.40, 6.99), "init_A/T": (3.85, 11.04), "init_G/C": (0, 0),
"init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
"sym": (0, -1.4),
"AA/TT": (-7.09, -19.8), "AT/TA": (-9.11, -25.8), "TA/AT": (-8.50, -22.9),
"CA/GT": (-11.03, -28.8), "GT/CA": (-11.98, -31.3),
"CT/GA": (-10.90, -28.5), "GA/CT": (-13.21, -34.9),
"CG/GC": (-10.88, -27.4), "GC/CG": (-16.04, -40.6),
"GG/CC": (-14.18, -35.0), "GT/TG": (-13.83, -46.9),
"GG/TT": (-17.82, -56.7), "AG/TT": (-3.96, -11.6),
"TG/AT": (-0.96, -1.8), "TT/AG": (-10.38, -31.8), "TG/GT": (-12.64, -38.9),
"AT/TG": (-7.39, -21.0), "CG/GT": (-5.56, -13.9), "CT/GG": (-9.44, -24.7),
"GG/CT": (-7.03, -16.8), "GT/CG": (-11.09, -28.8)}
# RNA/DNA
# Sugimoto et al. (1995), Biochemistry 34: 11211-11216
R_DNA_NN1 = {
"init": (1.9, -3.9), "init_A/T": (0, 0), "init_G/C": (0, 0),
"init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
"sym": (0, 0),
"AA/TT": (-11.5, -36.4), "AC/TG": (-7.8, -21.6), "AG/TC": (-7.0, -19.7),
"AT/TA": (-8.3, -23.9), "CA/GT": (-10.4, -28.4), "CC/GG": (-12.8, -31.9),
"CG/GC": (-16.3, -47.1), "CT/GA": (-9.1, -23.5), "GA/CT": (-8.6, -22.9),
"GC/CG": (-8.0, -17.1), "GG/CC": (-9.3, -23.2), "GT/CA": (-5.9, -12.3),
"TA/AT": (-7.8, -23.2), "TC/AG": (-5.5, -13.5), "TG/AC": (-9.0, -26.1),
"TT/AA": (-7.8, -21.9)}
# Internal mismatch and inosine table (DNA)
# Allawi & SantaLucia (1997), Biochemistry 36: 10581-10594
# Allawi & SantaLucia (1998), Biochemistry 37: 9435-9444
# Allawi & SantaLucia (1998), Biochemistry 37: 2170-2179
# Allawi & SantaLucia (1998), Nucl Acids Res 26: 2694-2701
# Peyret et al. (1999), Biochemistry 38: 3468-3477
# Watkins & SantaLucia (2005), Nucl Acids Res 33: 6258-6267
DNA_IMM1 = {
"AG/TT": (1.0, 0.9), "AT/TG": (-2.5, -8.3), "CG/GT": (-4.1, -11.7),
"CT/GG": (-2.8, -8.0), "GG/CT": (3.3, 10.4), "GG/TT": (5.8, 16.3),
"GT/CG": (-4.4, -12.3), "GT/TG": (4.1, 9.5), "TG/AT": (-0.1, -1.7),
"TG/GT": (-1.4, -6.2), "TT/AG": (-1.3, -5.3), "AA/TG": (-0.6, -2.3),
"AG/TA": (-0.7, -2.3), "CA/GG": (-0.7, -2.3), "CG/GA": (-4.0, -13.2),
"GA/CG": (-0.6, -1.0), "GG/CA": (0.5, 3.2), "TA/AG": (0.7, 0.7),
"TG/AA": (3.0, 7.4),
"AC/TT": (0.7, 0.2), "AT/TC": (-1.2, -6.2), "CC/GT": (-0.8, -4.5),
"CT/GC": (-1.5, -6.1), "GC/CT": (2.3, 5.4), "GT/CC": (5.2, 13.5),
"TC/AT": (1.2, 0.7), "TT/AC": (1.0, 0.7),
"AA/TC": (2.3, 4.6), "AC/TA": (5.3, 14.6), "CA/GC": (1.9, 3.7),
"CC/GA": (0.6, -0.6), "GA/CC": (5.2, 14.2), "GC/CA": (-0.7, -3.8),
"TA/AC": (3.4, 8.0), "TC/AA": (7.6, 20.2),
"AA/TA": (1.2, 1.7), "CA/GA": (-0.9, -4.2), "GA/CA": (-2.9, -9.8),
"TA/AA": (4.7, 12.9), "AC/TC": (0.0, -4.4), "CC/GC": (-1.5, -7.2),
"GC/CC": (3.6, 8.9), "TC/AC": (6.1, 16.4), "AG/TG": (-3.1, -9.5),
"CG/GG": (-4.9, -15.3), "GG/CG": (-6.0, -15.8), "TG/AG": (1.6, 3.6),
"AT/TT": (-2.7, -10.8), "CT/GT": (-5.0, -15.8), "GT/CT": (-2.2, -8.4),
"TT/AT": (0.2, -1.5),
"AI/TC": (-8.9, -25.5), "TI/AC": (-5.9, -17.4), "AC/TI": (-8.8, -25.4),
"TC/AI": (-4.9, -13.9), "CI/GC": (-5.4, -13.7), "GI/CC": (-6.8, -19.1),
"CC/GI": (-8.3, -23.8), "GC/CI": (-5.0, -12.6),
"AI/TA": (-8.3, -25.0), "TI/AA": (-3.4, -11.2), "AA/TI": (-0.7, -2.6),
"TA/AI": (-1.3, -4.6), "CI/GA": (2.6, 8.9), "GI/CA": (-7.8, -21.1),
"CA/GI": (-7.0, -20.0), "GA/CI": (-7.6, -20.2),
"AI/TT": (0.49, -0.7), "TI/AT": (-6.5, -22.0), "AT/TI": (-5.6, -18.7),
"TT/AI": (-0.8, -4.3), "CI/GT": (-1.0, -2.4), "GI/CT": (-3.5, -10.6),
"CT/GI": (0.1, -1.0), "GT/CI": (-4.3, -12.1),
"AI/TG": (-4.9, -15.8), "TI/AG": (-1.9, -8.5), "AG/TI": (0.1, -1.8),
"TG/AI": (1.0, 1.0), "CI/GG": (7.1, 21.3), "GI/CG": (-1.1, -3.2),
"CG/GI": (5.8, 16.9), "GG/CI": (-7.6, -22.0),
"AI/TI": (-3.3, -11.9), "TI/AI": (0.1, -2.3), "CI/GI": (1.3, 3.0),
"GI/CI": (-0.5, -1.3)}
# Terminal mismatch table (DNA)
# SantaLucia & Peyret (2001) Patent Application WO 01/94611
DNA_TMM1 = {
"AA/TA": (-3.1, -7.8), "TA/AA": (-2.5, -6.3), "CA/GA": (-4.3, -10.7),
"GA/CA": (-8.0, -22.5),
"AC/TC": (-0.1, 0.5), "TC/AC": (-0.7, -1.3), "CC/GC": (-2.1, -5.1),
"GC/CC": (-3.9, -10.6),
"AG/TG": (-1.1, -2.1), "TG/AG": (-1.1, -2.7), "CG/GG": (-3.8, -9.5),
"GG/CG": (-0.7, -19.2),
"AT/TT": (-2.4, -6.5), "TT/AT": (-3.2, -8.9), "CT/GT": (-6.1, -16.9),
"GT/CT": (-7.4, -21.2),
"AA/TC": (-1.6, -4.0), "AC/TA": (-1.8, -3.8), "CA/GC": (-2.6, -5.9),
"CC/GA": (-2.7, -6.0), "GA/CC": (-5.0, -13.8), "GC/CA": (-3.2, -7.1),
"TA/AC": (-2.3, -5.9), "TC/AA": (-2.7, -7.0),
"AC/TT": (-0.9, -1.7), "AT/TC": (-2.3, -6.3), "CC/GT": (-3.2, -8.0),
"CT/GC": (-3.9, -10.6), "GC/CT": (-4.9, -13.5), "GT/CC": (-3.0, -7.8),
"TC/AT": (-2.5, -6.3), "TT/AC": (-0.7, -1.2),
"AA/TG": (-1.9, -4.4), "AG/TA": (-2.5, -5.9), "CA/GG": (-3.9, -9.6),
"CG/GA": (-6.0, -15.5), "GA/CG": (-4.3, -11.1), "GG/CA": (-4.6, -11.4),
"TA/AG": (-2.0, -4.7), "TG/AA": (-2.4, -5.8),
"AG/TT": (-3.2, -8.7), "AT/TG": (-3.5, -9.4), "CG/GT": (-3.8, -9.0),
"CT/GG": (-6.6, -18.7), "GG/CT": (-5.7, -15.9), "GT/CG": (-5.9, -16.1),
"TG/AT": (-3.9, -10.5), "TT/AG": (-3.6, -9.8)}
# Dangling ends table (DNA)
# Bommarito et al. (2000), Nucl Acids Res 28: 1929-1934
DNA_DE1 = {
"AA/.T": (0.2, 2.3), "AC/.G": (-6.3, -17.1), "AG/.C": (-3.7, -10.0),
"AT/.A": (-2.9, -7.6), "CA/.T": (0.6, 3.3), "CC/.G": (-4.4, -12.6),
"CG/.C": (-4.0, -11.9), "CT/.A": (-4.1, -13.0), "GA/.T": (-1.1, -1.6),
"GC/.G": (-5.1, -14.0), "GG/.C": (-3.9, -10.9), "GT/.A": (-4.2, -15.0),
"TA/.T": (-6.9, -20.0), "TC/.G": (-4.0, -10.9), "TG/.C": (-4.9, -13.8),
"TT/.A": (-0.2, -0.5),
".A/AT": (-0.7, -0.8), ".C/AG": (-2.1, -3.9), ".G/AC": (-5.9, -16.5),
".T/AA": (-0.5, -1.1), ".A/CT": (4.4, 14.9), ".C/CG": (-0.2, -0.1),
".G/CC": (-2.6, -7.4), ".T/CA": (4.7, 14.2), ".A/GT": (-1.6, -3.6),
".C/GG": (-3.9, -11.2), ".G/GC": (-3.2, -10.4), ".T/GA": (-4.1, -13.1),
".A/TT": (2.9, 10.4), ".C/TG": (-4.4, -13.1), ".G/TC": (-5.2, -15.0),
".T/TA": (-3.8, -12.6)}
# Dangling ends table (RNA)
# Turner & Mathews (2010), Nucl Acids Res 38: D280-D282
RNA_DE1 = {
".T/AA": (-4.9, -13.2), ".T/CA": (-0.9, -1.3), ".T/GA": (-5.5, -15.1),
".T/TA": (-2.3, -5.5),
".G/AC": (-9.0, -23.5), ".G/CC": (-4.1, -10.6), ".G/GC": (-8.6, -22.2),
".G/TC": (-7.5, -20.31),
".C/AG": (-7.4, -20.3), ".C/CG": (-2.8, -7.7), ".C/GG": (-6.4, -16.4),
".C/TG": (-3.6, -9.7),
".T/AG": (-4.9, -13.2), ".T/CG": (-0.9, -1.3), ".T/GG": (-5.5, -15.1),
".T/TG": (-2.3, -5.5),
".A/AT": (-5.7, -16.1), ".A/CT": (-0.7, -1.9), ".A/GT": (-5.8, -16.4),
".A/TT": (-2.2, -6.8),
".G/AT": (-5.7, -16.1), ".G/CT": (-0.7, -1.9), ".G/GT": (-5.8, -16.4),
".G/TT": (-2.2, -6.8),
"AT/.A": (-0.5, -0.6), "CT/.A": (6.9, 22.6), "GT/.A": (0.6, 2.6),
"TT/.A": (0.6, 2.6),
"AG/.C": (-1.6, -4.5), "CG/.C": (0.7, 3.2), "GG/.C": (-4.6, -14.8),
"TG/.C": (-0.4, -1.3),
"AC/.G": (-2.4, -6.1), "CC/.G": (3.3, 11.6), "GC/.G": (0.8, 3.2),
"TC/.G": (-1.4, -4.2),
"AT/.G": (-0.5, -0.6), "CT/.G": (6.9, 22.6), "GT/.G": (0.6, 2.6),
"TT/.G": (0.6, 2.6),
"AA/.T": (1.6, 6.1), "CA/.T": (2.2, 8.1), "GA/.T": (0.7, 3.5),
"TA/.T": (3.1, 10.6),
"AG/.T": (1.6, 6.1), "CG/.T": (2.2, 8.1), "GG/.T": (0.7, 3.5),
"TG/.T": (3.1, 10.6)}
# Turn black code style on
# fmt: on
def make_table(oldtable=None, values=None):
"""Return a table with thermodynamic parameters (as dictionary).
Parameters:
oldtable: An existing dictionary with thermodynamic parameters.
values: A dictionary with new or updated values.
E.g., to replace the initiation parameters in the Sugimoto '96 dataset with
the initiation parameters from Allawi & SantaLucia '97:
>>> from Bio.SeqUtils.MeltingTemp import make_table, DNA_NN2
>>> table = DNA_NN2 # Sugimoto '96
>>> table['init_A/T']
(0, 0)
>>> newtable = make_table(oldtable=DNA_NN2, values={'init': (0, 0),
... 'init_A/T': (2.3, 4.1),
... 'init_G/C': (0.1, -2.8)})
>>> print("%0.1f, %0.1f" % newtable['init_A/T'])
2.3, 4.1
"""
if oldtable is None:
table = {
"init": (0, 0),
"init_A/T": (0, 0),
"init_G/C": (0, 0),
"init_oneG/C": (0, 0),
"init_allA/T": (0, 0),
"init_5T/A": (0, 0),
"sym": (0, 0),
"AA/TT": (0, 0),
"AT/TA": (0, 0),
"TA/AT": (0, 0),
"CA/GT": (0, 0),
"GT/CA": (0, 0),
"CT/GA": (0, 0),
"GA/CT": (0, 0),
"CG/GC": (0, 0),
"GC/CG": (0, 0),
"GG/CC": (0, 0),
}
else:
table = oldtable.copy()
if values:
table.update(values)
return table
def _check(seq, method):
"""Return a sequence which fullfils the requirements of the given method (PRIVATE).
All Tm methods in this package require the sequence in uppercase format.
Most methods make use of the length of the sequence (directly or
indirectly), which can only be expressed as len(seq) if the sequence does
not contain whitespaces and other non-base characters. RNA sequences are
backtranscribed to DNA. This method is PRIVATE.
Arguments:
seq: The sequence as given by the user (passed as string).
method: Tm_Wallace, Tm_GC or Tm_NN.
>>> from Bio.SeqUtils import MeltingTemp as mt
>>> mt._check('10 ACGTTGCAAG tccatggtac', 'Tm_NN')
'ACGTTGCAAGTCCATGGTAC'
"""
seq = "".join(seq.split()).upper()
seq = str(Seq.Seq(seq).back_transcribe())
if method == "Tm_Wallace":
return seq
if method == "Tm_GC":
baseset = (
"A",
"B",
"C",
"D",
"G",
"H",
"I",
"K",
"M",
"N",
"R",
"S",
"T",
"V",
"W",
"X",
"Y",
)
if method == "Tm_NN":
baseset = ("A", "C", "G", "T", "I")
seq = "".join([base for base in seq if base in baseset])
return seq
def salt_correction(Na=0, K=0, Tris=0, Mg=0, dNTPs=0, method=1, seq=None):
"""Calculate a term to correct Tm for salt ions.
Depending on the Tm calculation, the term will correct Tm or entropy. To
calculate corrected Tm values, different operations need to be applied:
- methods 1-4: Tm(new) = Tm(old) + corr
- method 5: deltaS(new) = deltaS(old) + corr
- methods 6+7: Tm(new) = 1/(1/Tm(old) + corr)
Parameters:
- Na, K, Tris, Mg, dNTPS: Millimolar concentration of respective ion. To
have a simple 'salt correction', just pass Na. If any of K, Tris, Mg and
dNTPS is non-zero, a 'sodium-equivalent' concentration is calculated
according to von Ahsen et al. (2001, Clin Chem 47: 1956-1961):
[Na_eq] = [Na+] + [K+] + [Tris]/2 + 120*([Mg2+] - [dNTPs])^0.5
If [dNTPs] >= [Mg2+]: [Na_eq] = [Na+] + [K+] + [Tris]/2
- method: Which method to be applied. Methods 1-4 correct Tm, method 5
corrects deltaS, methods 6 and 7 correct 1/Tm. The methods are:
1. 16.6 x log[Na+]
(Schildkraut & Lifson (1965), Biopolymers 3: 195-208)
2. 16.6 x log([Na+]/(1.0 + 0.7*[Na+]))
(Wetmur (1991), Crit Rev Biochem Mol Biol 126: 227-259)
3. 12.5 x log(Na+]
(SantaLucia et al. (1996), Biochemistry 35: 3555-3562
4. 11.7 x log[Na+]
(SantaLucia (1998), Proc Natl Acad Sci USA 95: 1460-1465
5. Correction for deltaS: 0.368 x (N-1) x ln[Na+]
(SantaLucia (1998), Proc Natl Acad Sci USA 95: 1460-1465)
6. (4.29(%GC)-3.95)x1e-5 x ln[Na+] + 9.40e-6 x ln[Na+]^2
(Owczarzy et al. (2004), Biochemistry 43: 3537-3554)
7. Complex formula with decision tree and 7 empirical constants.
Mg2+ is corrected for dNTPs binding (if present)
(Owczarzy et al. (2008), Biochemistry 47: 5336-5353)
Examples
--------
>>> from Bio.SeqUtils import MeltingTemp as mt
>>> print('%0.2f' % mt.salt_correction(Na=50, method=1))
-21.60
>>> print('%0.2f' % mt.salt_correction(Na=50, method=2))
-21.85
>>> print('%0.2f' % mt.salt_correction(Na=100, Tris=20, method=2))
-16.45
>>> print('%0.2f' % mt.salt_correction(Na=100, Tris=20, Mg=1.5, method=2))
-10.99
"""
if method in (5, 6, 7) and not seq:
raise ValueError(
"sequence is missing (is needed to calculate GC content or sequence length)."
)
if seq:
seq = str(seq)
corr = 0
if not method:
return corr
Mon = Na + K + Tris / 2.0 # Note: all these values are millimolar
mg = Mg * 1e-3 # Lowercase ions (mg, mon, dntps) are molar
# Na equivalent according to von Ahsen et al. (2001):
if sum((K, Mg, Tris, dNTPs)) > 0 and not method == 7 and dNTPs < Mg:
# dNTPs bind Mg2+ strongly. If [dNTPs] is larger or equal than
# [Mg2+], free Mg2+ is considered not to be relevant.
Mon += 120 * math.sqrt(Mg - dNTPs)
mon = Mon * 1e-3
# Note: math.log = ln(), math.log10 = log()
if method in range(1, 7) and not mon:
raise ValueError(
"Total ion concentration of zero is not allowed in this method."
)
if method == 1:
corr = 16.6 * math.log10(mon)
if method == 2:
corr = 16.6 * math.log10((mon) / (1.0 + 0.7 * (mon)))
if method == 3:
corr = 12.5 * math.log10(mon)
if method == 4:
corr = 11.7 * math.log10(mon)
if method == 5:
corr = 0.368 * (len(seq) - 1) * math.log(mon)
if method == 6:
corr = (
(4.29 * SeqUtils.GC(seq) / 100 - 3.95) * 1e-5 * math.log(mon)
) + 9.40e-6 * math.log(mon) ** 2
# Turn black code style off
# fmt: off
if method == 7:
a, b, c, d = 3.92, -0.911, 6.26, 1.42
e, f, g = -48.2, 52.5, 8.31
if dNTPs > 0:
dntps = dNTPs * 1e-3
ka = 3e4 # Dissociation constant for Mg:dNTP
# Free Mg2+ calculation:
mg = (-(ka * dntps - ka * mg + 1.0)
+ math.sqrt((ka * dntps - ka * mg + 1.0) ** 2
+ 4.0 * ka * mg)) / (2.0 * ka)
if Mon > 0:
R = math.sqrt(mg) / mon
if R < 0.22:
corr = (4.29 * SeqUtils.GC(seq) / 100 - 3.95) * \
1e-5 * math.log(mon) + 9.40e-6 * math.log(mon) ** 2
return corr
elif R < 6.0:
a = 3.92 * (0.843 - 0.352 * math.sqrt(mon) * math.log(mon))
d = 1.42 * (1.279 - 4.03e-3 * math.log(mon)
- 8.03e-3 * math.log(mon) ** 2)
g = 8.31 * (0.486 - 0.258 * math.log(mon)
+ 5.25e-3 * math.log(mon) ** 3)
corr = (a + b * math.log(mg) + (SeqUtils.GC(seq) / 100)
* (c + d * math.log(mg)) + (1 / (2.0 * (len(seq) - 1)))
* (e + f * math.log(mg) + g * math.log(mg) ** 2)) * 1e-5
# Turn black code style on
# fmt: on
if method > 7:
raise ValueError("Allowed values for parameter 'method' are 1-7.")
return corr
def chem_correction(
melting_temp, DMSO=0, fmd=0, DMSOfactor=0.75, fmdfactor=0.65, fmdmethod=1, GC=None
):
"""Correct a given Tm for DMSO and formamide.
Please note that these corrections are +/- rough approximations.
Arguments:
- melting_temp: Melting temperature.
- DMSO: Percent DMSO.
- fmd: Formamide concentration in %(fmdmethod=1) or molar (fmdmethod=2).
- DMSOfactor: How much should Tm decreases per percent DMSO. Default=0.65
(von Ahsen et al. 2001). Other published values are 0.5, 0.6 and 0.675.
- fmdfactor: How much should Tm decrease per percent formamide.
Default=0.65. Several papers report factors between 0.6 and 0.72.
- fmdmethod:
1. Tm = Tm - factor(%formamide) (Default)
2. Tm = Tm + (0.453(f(GC)) - 2.88) x [formamide]
Here f(GC) is fraction of GC.
Note (again) that in fmdmethod=1 formamide concentration is given in %,
while in fmdmethod=2 it is given in molar.
- GC: GC content in percent.
Examples:
>>> from Bio.SeqUtils import MeltingTemp as mt
>>> mt.chem_correction(70)
70
>>> print('%0.2f' % mt.chem_correction(70, DMSO=3))
67.75
>>> print('%0.2f' % mt.chem_correction(70, fmd=5))
66.75
>>> print('%0.2f' % mt.chem_correction(70, fmdmethod=2, fmd=1.25,
... GC=50))
66.68
"""
if DMSO:
melting_temp -= DMSOfactor * DMSO
if fmd:
# McConaughy et al. (1969), Biochemistry 8: 3289-3295
if fmdmethod == 1:
# Note: Here fmd is given in percent
melting_temp -= fmdfactor * fmd
# Blake & Delcourt (1996), Nucl Acids Res 11: 2095-2103
if fmdmethod == 2:
if GC is None or GC < 0:
raise ValueError("'GC' is missing or negative")
# Note: Here fmd is given in molar
melting_temp += (0.453 * (GC / 100.0) - 2.88) * fmd
if fmdmethod not in (1, 2):
raise ValueError("'fmdmethod' must be 1 or 2")
return melting_temp
def Tm_Wallace(seq, check=True, strict=True):
"""Calculate and return the Tm using the 'Wallace rule'.
Tm = 4 degC * (G + C) + 2 degC * (A+T)
The Wallace rule (Thein & Wallace 1986, in Human genetic diseases: a
practical approach, 33-50) is often used as rule of thumb for approximate
Tm calculations for primers of 14 to 20 nt length.
Non-DNA characters (e.g., E, F, J, !, 1, etc) are ignored by this method.
Examples:
>>> from Bio.SeqUtils import MeltingTemp as mt
>>> mt.Tm_Wallace('ACGTTGCAATGCCGTA')
48.0
>>> mt.Tm_Wallace('ACGT TGCA ATGC CGTA')
48.0
>>> mt.Tm_Wallace('1ACGT2TGCA3ATGC4CGTA')
48.0
"""
seq = str(seq)
if check:
seq = _check(seq, "Tm_Wallace")
melting_temp = 2 * (sum(map(seq.count, ("A", "T", "W")))) + 4 * (
sum(map(seq.count, ("C", "G", "S")))
)
# Intermediate values for ambiguous positions:
tmp = (
3 * (sum(map(seq.count, ("K", "M", "N", "R", "Y"))))
+ 10 / 3.0 * (sum(map(seq.count, ("B", "V"))))
+ 8 / 3.0 * (sum(map(seq.count, ("D", "H"))))
)
if strict and tmp:
raise ValueError(
"ambiguous bases B, D, H, K, M, N, R, V, Y not allowed when strict=True"
)
else:
melting_temp += tmp
return melting_temp
def Tm_GC(
seq,
check=True,
strict=True,
valueset=7,
userset=None,
Na=50,
K=0,
Tris=0,
Mg=0,
dNTPs=0,
saltcorr=0,
mismatch=True,
):
"""Return the Tm using empirical formulas based on GC content.
General format: Tm = A + B(%GC) - C/N + salt correction - D(%mismatch)
A, B, C, D: empirical constants, N: primer length
D (amount of decrease in Tm per % mismatch) is often 1, but sometimes other
values have been used (0.6-1.5). Use 'X' to indicate the mismatch position
in the sequence. Note that this mismatch correction is a rough estimate.
>>> from Bio.SeqUtils import MeltingTemp as mt
>>> print("%0.2f" % mt.Tm_GC('CTGCTGATXGCACGAGGTTATGG', valueset=2))
69.20
Arguments:
- valueset: A few often cited variants are included:
1. Tm = 69.3 + 0.41(%GC) - 650/N
(Marmur & Doty 1962, J Mol Biol 5: 109-118; Chester & Marshak 1993),
Anal Biochem 209: 284-290)
2. Tm = 81.5 + 0.41(%GC) - 675/N - %mismatch
'QuikChange' formula. Recommended (by the manufacturer) for the
design of primers for QuikChange mutagenesis.
3. Tm = 81.5 + 0.41(%GC) - 675/N + 16.6 x log[Na+]
(Marmur & Doty 1962, J Mol Biol 5: 109-118; Schildkraut & Lifson
1965, Biopolymers 3: 195-208)
4. Tm = 81.5 + 0.41(%GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x
[Na+])) - %mismatch
(Wetmur 1991, Crit Rev Biochem Mol Biol 126: 227-259). This is the
standard formula in approximative mode of MELTING 4.3.
5. Tm = 78 + 0.7(%GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+]))
- %mismatch
(Wetmur 1991, Crit Rev Biochem Mol Biol 126: 227-259). For RNA.
6. Tm = 67 + 0.8(%GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+]))
- %mismatch
(Wetmur 1991, Crit Rev Biochem Mol Biol 126: 227-259). For RNA/DNA
hybrids.
7. Tm = 81.5 + 0.41(%GC) - 600/N + 16.6 x log[Na+]
Used by Primer3Plus to calculate the product Tm. Default set.
8. Tm = 77.1 + 0.41(%GC) - 528/N + 11.7 x log[Na+]
(von Ahsen et al. 2001, Clin Chem 47: 1956-1961). Recommended 'as a
tradeoff between accuracy and ease of use'.
- userset: Tuple of four values for A, B, C, and D. Usersets override
valuesets.
- Na, K, Tris, Mg, dNTPs: Concentration of the respective ions [mM]. If
any of K, Tris, Mg and dNTPS is non-zero, a 'sodium-equivalent'
concentration is calculated and used for salt correction (von Ahsen et
al., 2001).
- saltcorr: Type of salt correction (see method salt_correction).
Default=5. 0 or None means no salt correction.
- mismatch: If 'True' (default) every 'X' in the sequence is counted as
mismatch.
"""
if saltcorr == 5:
raise ValueError("salt-correction method 5 not applicable to Tm_GC")
seq = str(seq)
if check:
seq = _check(seq, "Tm_GC")
percent_gc = SeqUtils.GC(seq)
# Ambiguous bases: add 0.5, 0.67 or 0.33% depending on G+C probability:
tmp = (
sum(map(seq.count, ("K", "M", "N", "R", "Y"))) * 50.0 / len(seq)
+ sum(map(seq.count, ("B", "V"))) * 66.67 / len(seq)
+ sum(map(seq.count, ("D", "H"))) * 33.33 / len(seq)
)
if strict and tmp:
raise ValueError(
"ambiguous bases B, D, H, K, M, N, R, V, Y not allowed when 'strict=True'"
)
else:
percent_gc += tmp
if userset:
A, B, C, D = userset
else:
if valueset == 1:
A, B, C, D = (69.3, 0.41, 650, 1)
saltcorr = 0
if valueset == 2:
A, B, C, D = (81.5, 0.41, 675, 1)
saltcorr = 0
if valueset == 3:
A, B, C, D = (81.5, 0.41, 675, 1)
saltcorr = 2
if valueset == 4:
A, B, C, D = (81.5, 0.41, 500, 1)
saltcorr = 3
if valueset == 5:
A, B, C, D = (78.0, 0.7, 500, 1)
saltcorr = 3
if valueset == 6:
A, B, C, D = (67.0, 0.8, 500, 1)
saltcorr = 3
if valueset == 7:
A, B, C, D = (81.5, 0.41, 600, 1)
saltcorr = 2
if valueset == 8:
A, B, C, D = (77.1, 0.41, 528, 1)
saltcorr = 4
if valueset > 8:
raise ValueError("allowed values for parameter 'valueset' are 0-8.")
melting_temp = A + B * percent_gc - C / (len(seq) * 1.0)
if saltcorr:
melting_temp += salt_correction(
Na=Na, K=K, Tris=Tris, Mg=Mg, dNTPs=dNTPs, seq=seq, method=saltcorr
)
if mismatch:
melting_temp -= D * (seq.count("X") * 100.0 / len(seq))
return melting_temp
def _key_error(neighbors, strict):
"""Throw an error or a warning if there is no data for the neighbors (PRIVATE)."""
# We haven't found the key in the tables
if strict:
raise ValueError("no thermodynamic data for neighbors %r available" % neighbors)
else:
warnings.warn(
"no themodynamic data for neighbors %r available. "
"Calculation will be wrong" % neighbors,
BiopythonWarning,
)
def Tm_NN(
seq,
check=True,
strict=True,
c_seq=None,
shift=0,
nn_table=None,
tmm_table=None,
imm_table=None,
de_table=None,
dnac1=25,
dnac2=25,
selfcomp=False,
Na=50,
K=0,
Tris=0,
Mg=0,
dNTPs=0,
saltcorr=5,
):
"""Return the Tm using nearest neighbor thermodynamics.
Arguments:
- seq: The primer/probe sequence as string or Biopython sequence object.
For RNA/DNA hybridizations seq must be the RNA sequence.
- c_seq: Complementary sequence. The sequence of the template/target in
3'->5' direction. c_seq is necessary for mismatch correction and
dangling-ends correction. Both corrections will automatically be
applied if mismatches or dangling ends are present. Default=None.
- shift: Shift of the primer/probe sequence on the template/target
sequence, e.g.::
shift=0 shift=1 shift= -1
Primer (seq): 5' ATGC... 5' ATGC... 5' ATGC...
Template (c_seq): 3' TACG... 3' CTACG... 3' ACG...
The shift parameter is necessary to align seq and c_seq if they have
different lengths or if they should have dangling ends. Default=0
- table: Thermodynamic NN values, eight tables are implemented:
For DNA/DNA hybridizations:
- DNA_NN1: values from Breslauer et al. (1986)
- DNA_NN2: values from Sugimoto et al. (1996)
- DNA_NN3: values from Allawi & SantaLucia (1997) (default)
- DNA_NN4: values from SantaLucia & Hicks (2004)
For RNA/RNA hybridizations:
- RNA_NN1: values from Freier et al. (1986)
- RNA_NN2: values from Xia et al. (1998)
- RNA_NN3: valuse from Chen et al. (2012)
For RNA/DNA hybridizations:
- R_DNA_NN1: values from Sugimoto et al. (1995)
Note that ``seq`` must be the RNA sequence.
Use the module's maketable method to make a new table or to update one
one of the implemented tables.
- tmm_table: Thermodynamic values for terminal mismatches.
Default: DNA_TMM1 (SantaLucia & Peyret, 2001)
- imm_table: Thermodynamic values for internal mismatches, may include
insosine mismatches. Default: DNA_IMM1 (Allawi & SantaLucia, 1997-1998;
Peyret et al., 1999; Watkins & SantaLucia, 2005)
- de_table: Thermodynamic values for dangling ends:
- DNA_DE1: for DNA. Values from Bommarito et al. (2000) (default)
- RNA_DE1: for RNA. Values from Turner & Mathews (2010)
- dnac1: Concentration of the higher concentrated strand [nM]. Typically
this will be the primer (for PCR) or the probe. Default=25.
- dnac2: Concentration of the lower concentrated strand [nM]. In PCR this
is the template strand which concentration is typically very low and may
be ignored (dnac2=0). In oligo/oligo hybridization experiments, dnac1
equals dnac1. Default=25.
MELTING and Primer3Plus use k = [Oligo(Total)]/4 by default. To mimic
this behaviour, you have to divide [Oligo(Total)] by 2 and assign this
concentration to dnac1 and dnac2. E.g., Total oligo concentration of
50 nM in Primer3Plus means dnac1=25, dnac2=25.
- selfcomp: Is the sequence self-complementary? Default=False. If 'True'
the primer is thought binding to itself, thus dnac2 is not considered.
- Na, K, Tris, Mg, dNTPs: See method 'Tm_GC' for details. Defaults: Na=50,
K=0, Tris=0, Mg=0, dNTPs=0.
- saltcorr: See method 'Tm_GC'. Default=5. 0 means no salt correction.
"""
# Set defaults
if not nn_table:
nn_table = DNA_NN3
if not tmm_table:
tmm_table = DNA_TMM1
if not imm_table:
imm_table = DNA_IMM1
if not de_table:
de_table = DNA_DE1
seq = str(seq)
if not c_seq:
# c_seq must be provided by user if dangling ends or mismatches should
# be taken into account. Otherwise take perfect complement.
c_seq = Seq.Seq(seq).complement()
c_seq = str(c_seq)
if check:
seq = _check(seq, "Tm_NN")
c_seq = _check(c_seq, "Tm_NN")
tmp_seq = seq
tmp_cseq = c_seq
delta_h = 0
delta_s = 0
d_h = 0 # Names for indexes
d_s = 1 # 0 and 1
# Dangling ends?
if shift or len(seq) != len(c_seq):
# Align both sequences using the shift parameter
if shift > 0:
tmp_seq = "." * shift + seq
if shift < 0:
tmp_cseq = "." * abs(shift) + c_seq
if len(tmp_cseq) > len(tmp_seq):
tmp_seq += (len(tmp_cseq) - len(tmp_seq)) * "."
if len(tmp_cseq) < len(tmp_seq):
tmp_cseq += (len(tmp_seq) - len(tmp_cseq)) * "."
# Remove 'over-dangling' ends
while tmp_seq.startswith("..") or tmp_cseq.startswith(".."):
tmp_seq = tmp_seq[1:]
tmp_cseq = tmp_cseq[1:]
while tmp_seq.endswith("..") or tmp_cseq.endswith(".."):
tmp_seq = tmp_seq[:-1]
tmp_cseq = tmp_cseq[:-1]
# Now for the dangling ends
if tmp_seq.startswith(".") or tmp_cseq.startswith("."):
left_de = tmp_seq[:2] + "/" + tmp_cseq[:2]
try:
delta_h += de_table[left_de][d_h]
delta_s += de_table[left_de][d_s]
except KeyError:
_key_error(left_de, strict)
tmp_seq = tmp_seq[1:]
tmp_cseq = tmp_cseq[1:]
if tmp_seq.endswith(".") or tmp_cseq.endswith("."):
right_de = tmp_cseq[-2:][::-1] + "/" + tmp_seq[-2:][::-1]
try:
delta_h += de_table[right_de][d_h]
delta_s += de_table[right_de][d_s]
except KeyError:
_key_error(right_de, strict)
tmp_seq = tmp_seq[:-1]
tmp_cseq = tmp_cseq[:-1]
# Now for terminal mismatches
left_tmm = tmp_cseq[:2][::-1] + "/" + tmp_seq[:2][::-1]
if left_tmm in tmm_table:
delta_h += tmm_table[left_tmm][d_h]
delta_s += tmm_table[left_tmm][d_s]
tmp_seq = tmp_seq[1:]
tmp_cseq = tmp_cseq[1:]
right_tmm = tmp_seq[-2:] + "/" + tmp_cseq[-2:]
if right_tmm in tmm_table:
delta_h += tmm_table[right_tmm][d_h]
delta_s += tmm_table[right_tmm][d_s]
tmp_seq = tmp_seq[:-1]
tmp_cseq = tmp_cseq[:-1]
# Now everything 'unusual' at the ends is handled and removed and we can
# look at the initiation.
# One or several of the following initiation types may apply:
# Type: General initiation value
delta_h += nn_table["init"][d_h]
delta_s += nn_table["init"][d_s]
# Type: Duplex with no (allA/T) or at least one (oneG/C) GC pair
if SeqUtils.GC(seq) == 0:
delta_h += nn_table["init_allA/T"][d_h]
delta_s += nn_table["init_allA/T"][d_s]
else:
delta_h += nn_table["init_oneG/C"][d_h]
delta_s += nn_table["init_oneG/C"][d_s]
# Type: Penalty if 5' end is T
if seq.startswith("T"):
delta_h += nn_table["init_5T/A"][d_h]
delta_s += nn_table["init_5T/A"][d_s]
if seq.endswith("A"):
delta_h += nn_table["init_5T/A"][d_h]
delta_s += nn_table["init_5T/A"][d_s]
# Type: Different values for G/C or A/T terminal basepairs
ends = seq[0] + seq[-1]
AT = ends.count("A") + ends.count("T")
GC = ends.count("G") + ends.count("C")
delta_h += nn_table["init_A/T"][d_h] * AT
delta_s += nn_table["init_A/T"][d_s] * AT
delta_h += nn_table["init_G/C"][d_h] * GC
delta_s += nn_table["init_G/C"][d_s] * GC
# Finally, the 'zipping'
for basenumber in range(len(tmp_seq) - 1):
neighbors = (
tmp_seq[basenumber : basenumber + 2]
+ "/"
+ tmp_cseq[basenumber : basenumber + 2]
)
if neighbors in imm_table:
delta_h += imm_table[neighbors][d_h]
delta_s += imm_table[neighbors][d_s]
elif neighbors[::-1] in imm_table:
delta_h += imm_table[neighbors[::-1]][d_h]
delta_s += imm_table[neighbors[::-1]][d_s]
elif neighbors in nn_table:
delta_h += nn_table[neighbors][d_h]
delta_s += nn_table[neighbors][d_s]
elif neighbors[::-1] in nn_table:
delta_h += nn_table[neighbors[::-1]][d_h]
delta_s += nn_table[neighbors[::-1]][d_s]
else:
# We haven't found the key...
_key_error(neighbors, strict)
k = (dnac1 - (dnac2 / 2.0)) * 1e-9
if selfcomp:
k = dnac1 * 1e-9
delta_h += nn_table["sym"][d_h]
delta_s += nn_table["sym"][d_s]
R = 1.987 # universal gas constant in Cal/degrees C*Mol
if saltcorr:
corr = salt_correction(
Na=Na, K=K, Tris=Tris, Mg=Mg, dNTPs=dNTPs, method=saltcorr, seq=seq
)
if saltcorr == 5:
delta_s += corr
melting_temp = (1000 * delta_h) / (delta_s + (R * (math.log(k)))) - 273.15
if saltcorr in (1, 2, 3, 4):
melting_temp += corr
if saltcorr in (6, 7):
# Tm = 1/(1/Tm + corr)
melting_temp = 1 / (1 / (melting_temp + 273.15) + corr) - 273.15
return melting_temp
def Tm_staluc(s, dnac=50, saltc=50, rna=0):
"""Return DNA/DNA Tm using nearest neighbor thermodynamics (OBSOLETE).
This method may be depreceated in the future. Use Tm_NN instead. Tm_NN
with default values gives the same result as Tm_staluc.
s is the sequence as string or Seq object
dnac is DNA concentration [nM]
saltc is salt concentration [mM].
rna=0 is for DNA/DNA (default), use 1 for RNA/RNA hybridisation.
For DNA/DNA, see Allawi & SantaLucia (1997), Biochemistry 36: 10581-10594
For RNA/RNA, see Xia et al (1998), Biochemistry 37: 14719-14735
Examples
--------
>>> print("%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA'))
59.87
>>> print("%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA', rna=True))
77.90
You can also use a Seq object instead of a string,
>>> from Bio.Seq import Seq
>>> s = Seq('CAGTCAGTACGTACGTGTACTGCCGTA')
>>> print("%0.2f" % Tm_staluc(s))
59.87
>>> print("%0.2f" % Tm_staluc(s, rna=True))
77.90
"""
# Original method was by Sebastian Bassi <sbassi@genesdigitales.com>. It is
# now superseded by Tm_NN.
warnings.warn(
"Tm_staluc is deprecated; please use Tm_NN instead.",
BiopythonDeprecationWarning,
)
if not rna:
return Tm_NN(s, dnac1=dnac / 2.0, dnac2=dnac / 2.0, Na=saltc)
elif rna == 1:
return Tm_NN(s, dnac1=dnac / 2.0, dnac2=dnac / 2.0, Na=saltc, nn_table=RNA_NN2)
else:
raise ValueError(f"rna={rna} not supported")
if __name__ == "__main__":
from Bio._utils import run_doctest
run_doctest()
|