1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540
|
# Copyright 2012 by Wibowo Arindrarto. All rights reserved.
# This file is part of the Biopython distribution and governed by your
# choice of the "Biopython License Agreement" or the "BSD 3-Clause License".
# Please see the LICENSE file that should have been included as part of this
# package.
"""Bio.SearchIO parser for Exonerate plain text output format."""
import re
from itertools import chain
from ._base import (
_BaseExonerateParser,
_BaseExonerateIndexer,
_STRAND_MAP,
_parse_hit_or_query_line,
)
from .exonerate_vulgar import _RE_VULGAR
__all__ = ("ExonerateTextParser", "ExonerateTextIndexer")
# for capturing sequences in alignment blocks
# e.g. ' 529 : ATCCCTTATCTCTTTATCTTGTA : 472'
_RE_ALN_ROW = re.compile(r"\s*\d+\s+: (.*) :\s+\d+")
# for splitting the line based on intron annotations
# e.g. ' >>>> Target Intron 1 >>>> ' or 'gt.........................ag'
_RE_EXON = re.compile(
r"[atgc ]{2}?(?:(?:[<>]+ \w+ Intron \d+ [<>]+)|(?:\.+))[atgc ]{2}?"
)
# captures the intron length
# from e.g. '61 bp // 154295 bp' (joint intron lengths) or '177446 bp'
_RE_EXON_LEN = re.compile(r"(?:(\d+) bp // (\d+) bp)|(?:(\d+) bp)")
# for splitting lines in the NER model
_RE_NER = re.compile(r"--<\s+\d+\s+>--")
# for capturing NER gap lengths
_RE_NER_LEN = re.compile(r"--<\s+(\d+)\s+>--")
# regexes for capturing the letters inside curly braces
# no. of letters is either 1 or 2, since they are split codons
_RE_SCODON_START = re.compile(r"\{(\w{1,2})\}$")
_RE_SCODON_END = re.compile(r"^\{(\w{1,2})\}")
def _flip_codons(codon_seq, target_seq):
"""Flips the codon characters from one seq to another (PRIVATE)."""
a, b = "", ""
for char1, char2 in zip(codon_seq, target_seq):
# no need to do anything if the codon seq line has nothing
if char1 == " ":
a += char1
b += char2
else:
a += char2
b += char1
return a, b
def _get_block_coords(parsed_seq, row_dict, has_ner=False):
"""Return a list of start, end coordinates for each given block in the sequence (PRIVATE)."""
start = 0
coords = []
if not has_ner:
splitter = _RE_EXON
else:
splitter = _RE_NER
# use the query line for reference
seq = parsed_seq[row_dict["query"]]
for block in re.split(splitter, seq):
start += seq[start:].find(block)
end = start + len(block)
coords.append((start, end))
return coords
def _get_inter_coords(coords, strand=1):
"""Return list of pairs covering intervening ranges (PRIVATE).
From the given pairs of coordinates, returns a list of pairs
covering the intervening ranges.
"""
# adapted from Python's itertools guide
# if strand is -1, adjust coords to the ends and starts are chained
if strand == -1:
sorted_coords = [(max(a, b), min(a, b)) for a, b in coords]
inter_coords = list(chain(*sorted_coords))[1:-1]
return list(zip(inter_coords[1::2], inter_coords[::2]))
else:
inter_coords = list(chain(*coords))[1:-1]
return list(zip(inter_coords[::2], inter_coords[1::2]))
def _stitch_rows(raw_rows):
"""Stitches together the parsed alignment rows and returns them in a list (PRIVATE)."""
# deal with possible codon surprise!
# (i.e. alignments with codons using cdna2genome model)
# by creating additional rows to contain the codons
try:
max_len = max(len(x) for x in raw_rows)
for row in raw_rows:
assert len(row) == max_len
except AssertionError:
for idx, row in enumerate(raw_rows):
if len(row) != max_len:
# codons must be present in the query and hit (so +2)
assert len(row) + 2 == max_len
# add additional empty lines to contain codons
raw_rows[idx] = [" " * len(row[0])] + row + [" " * len(row[0])]
cmbn_rows = []
for idx, row in enumerate(raw_rows[0]):
cmbn_row = "".join(aln_row[idx] for aln_row in raw_rows)
cmbn_rows.append(cmbn_row)
# the real aligned sequence is always the 'outer' one, so we want
# to flip them with their 'inner' pairs
if len(cmbn_rows) == 5:
# flip query sequence
cmbn_rows[0], cmbn_rows[1] = _flip_codons(cmbn_rows[0], cmbn_rows[1])
# flip hit sequence
cmbn_rows[4], cmbn_rows[3] = _flip_codons(cmbn_rows[4], cmbn_rows[3])
return cmbn_rows
def _get_row_dict(row_len, model):
"""Return a dictionary of row indices for parsing alignment blocks (PRIVATE)."""
idx = {}
# 3 lines, usually in dna vs dna models
if row_len == 3:
idx["query"] = 0
idx["midline"] = 1
idx["hit"] = 2
idx["qannot"], idx["hannot"] = None, None
# 4 lines, in protein vs dna models or dna vs protein models
# TODO: currently we check this from the model string; is there
# a better way to do it?
elif row_len == 4:
if "protein2" in model:
idx["query"] = 0
idx["midline"] = 1
idx["hit"] = 2
idx["hannot"] = 3
idx["qannot"] = None
elif "2protein" in model:
idx["query"] = 1
idx["midline"] = 2
idx["hit"] = 3
idx["hannot"] = None
idx["qannot"] = 0
else:
raise ValueError("Unexpected model: " + model)
# 5 lines, translated dna vs translated dna
elif row_len == 5:
# set sequence indexes
idx["qannot"] = 0
idx["query"] = 1
idx["midline"] = 2
idx["hit"] = 3
idx["hannot"] = 4
else:
raise ValueError("Unexpected row count in alignment block: %i" % row_len)
return idx
def _get_blocks(rows, coords, idx):
"""Return a list of dictionaries of sequences split by the coordinates (PRIVATE)."""
for idx_name in ("query", "hit", "midline", "qannot", "hannot"):
assert idx_name in idx
blocks = []
for start, end in coords:
block = {}
# get seqs according to index
block["query"] = rows[idx["query"]][start:end]
block["hit"] = rows[idx["hit"]][start:end]
block["similarity"] = rows[idx["midline"]][start:end]
if idx["qannot"] is not None:
block["query_annotation"] = rows[idx["qannot"]][start:end]
if idx["hannot"] is not None:
block["hit_annotation"] = rows[idx["hannot"]][start:end]
blocks.append(block)
return blocks
def _get_scodon_moves(tmp_seq_blocks):
"""Get a dictionary of split codon locations relative to each fragment end (PRIVATE)."""
scodon_moves = {"query": [], "hit": []}
for seq_type in scodon_moves:
scoords = []
for block in tmp_seq_blocks:
# check both ends of the sequence for residues in curly braces
m_start = re.search(_RE_SCODON_START, block[seq_type])
m_end = re.search(_RE_SCODON_END, block[seq_type])
if m_start:
m_start = len(m_start.group(1))
scoords.append((m_start, 0))
else:
scoords.append((0, 0))
if m_end:
m_end = len(m_end.group(1))
scoords.append((0, m_end))
else:
scoords.append((0, 0))
scodon_moves[seq_type] = scoords
return scodon_moves
def _clean_blocks(tmp_seq_blocks):
"""Remove curly braces (split codon markers) from the given sequences (PRIVATE)."""
seq_blocks = []
for seq_block in tmp_seq_blocks:
for line_name in seq_block:
seq_block[line_name] = (
seq_block[line_name].replace("{", "").replace("}", "")
)
seq_blocks.append(seq_block)
return seq_blocks
def _comp_intron_lens(seq_type, inter_blocks, raw_inter_lens):
"""Return the length of introns between fragments (PRIVATE)."""
# set opposite type, for setting introns
opp_type = "hit" if seq_type == "query" else "query"
# list of flags to denote if an intron follows a block
# it reads e.g. this line:
# "ATGTT{TT} >>>> Target Intron 1 >>>> {G}TGTGTGTACATT"
# and sets the opposing sequence type's intron (since this
# line is present on the opposite sequence type line)
has_intron_after = ["Intron" in x[seq_type] for x in inter_blocks]
assert len(has_intron_after) == len(raw_inter_lens)
# create list containing coord adjustments incorporating
# intron lengths
inter_lens = []
for flag, parsed_len in zip(has_intron_after, raw_inter_lens):
if flag:
# joint introns
if all(parsed_len[:2]):
# intron len is [0] if opp_type is query, otherwise it's [1]
intron_len = (
int(parsed_len[0]) if opp_type == "query" else int(parsed_len[1])
)
# single hit/query introns
elif parsed_len[2]:
intron_len = int(parsed_len[2])
else:
raise ValueError("Unexpected intron parsing result: %r" % parsed_len)
else:
intron_len = 0
inter_lens.append(intron_len)
return inter_lens
def _comp_coords(hsp, seq_type, inter_lens):
"""Fill the block coordinates of the given hsp dictionary (PRIVATE)."""
assert seq_type in ("hit", "query")
# manually fill the first coord
seq_step = 1 if hsp["%s_strand" % seq_type] >= 0 else -1
fstart = hsp["%s_start" % seq_type]
# fend is fstart + number of residues in the sequence, minus gaps
fend = (
fstart
+ len(hsp[seq_type][0].replace("-", "").replace(">", "").replace("<", ""))
* seq_step
)
coords = [(fstart, fend)]
# and start from the second block, after the first inter seq
for idx, block in enumerate(hsp[seq_type][1:]):
bstart = coords[-1][1] + inter_lens[idx] * seq_step
bend = bstart + seq_step * len(block.replace("-", ""))
coords.append((bstart, bend))
# adjust the coords so the smallest is [0], if strand is -1
# couldn't do this in the previous steps since we need the initial
# block ordering
if seq_step != 1:
for idx, coord in enumerate(coords):
coords[idx] = coords[idx][1], coords[idx][0]
return coords
def _comp_split_codons(hsp, seq_type, scodon_moves):
"""Compute positions of split codons, store in given HSP dictionary (PRIVATE)."""
scodons = []
for idx in range(len(scodon_moves[seq_type])):
pair = scodon_moves[seq_type][idx]
if not any(pair):
continue
else:
assert not all(pair)
a, b = pair
anchor_pair = hsp["%s_ranges" % seq_type][idx // 2]
strand = 1 if hsp["%s_strand" % seq_type] >= 0 else -1
if a:
func = max if strand == 1 else min
anchor = func(anchor_pair)
start_c, end_c = anchor + a * strand * -1, anchor
elif b:
func = min if strand == 1 else max
anchor = func(anchor_pair)
start_c, end_c = anchor + b * strand, anchor
scodons.append((min(start_c, end_c), max(start_c, end_c)))
return scodons
class ExonerateTextParser(_BaseExonerateParser):
"""Parser for Exonerate plain text output."""
_ALN_MARK = "C4 Alignment:"
def parse_alignment_block(self, header):
"""Parse alignment block, return query result, hits, hsps."""
qresult = header["qresult"]
hit = header["hit"]
hsp = header["hsp"]
# check for values that must have been set by previous methods
for val_name in (
"query_start",
"query_end",
"hit_start",
"hit_end",
"query_strand",
"hit_strand",
):
assert val_name in hsp, hsp
# get the alignment rows
# and stitch them so we have the full sequences in single strings
raw_aln_blocks, vulgar_comp = self._read_alignment()
# cmbn_rows still has split codon markers (curly braces)
cmbn_rows = _stitch_rows(raw_aln_blocks)
row_dict = _get_row_dict(len(cmbn_rows), qresult["model"])
# get the sequence blocks
has_ner = "NER" in qresult["model"].upper()
seq_coords = _get_block_coords(cmbn_rows, row_dict, has_ner)
tmp_seq_blocks = _get_blocks(cmbn_rows, seq_coords, row_dict)
# get split codon temp coords for later use
# this result in pairs of base movement for both ends of each row
scodon_moves = _get_scodon_moves(tmp_seq_blocks)
# remove the split codon markers
seq_blocks = _clean_blocks(tmp_seq_blocks)
# adjust strands
hsp["query_strand"] = _STRAND_MAP[hsp["query_strand"]]
hsp["hit_strand"] = _STRAND_MAP[hsp["hit_strand"]]
# cast coords into ints
hsp["query_start"] = int(hsp["query_start"])
hsp["query_end"] = int(hsp["query_end"])
hsp["hit_start"] = int(hsp["hit_start"])
hsp["hit_end"] = int(hsp["hit_end"])
# cast score into ints
hsp["score"] = int(hsp["score"])
# set sequences
hsp["query"] = [x["query"] for x in seq_blocks]
hsp["hit"] = [x["hit"] for x in seq_blocks]
hsp["aln_annotation"] = {}
# set the molecule type
# currently only limited to models with protein queries
if (
"protein2" in qresult["model"]
or "coding2" in qresult["model"]
or "2protein" in qresult["model"]
):
hsp["molecule_type"] = "protein"
# get the annotations if they exist
for annot_type in ("similarity", "query_annotation", "hit_annotation"):
try:
hsp["aln_annotation"][annot_type] = [x[annot_type] for x in seq_blocks]
except KeyError:
pass
# use vulgar coordinates if vulgar line is present and return
# if vulgar_comp is not None:
# hsp = parse_vulgar_comp(hsp, vulgar_comp)
# return {'qresult': qresult, 'hit': hit, 'hsp': hsp}
# otherwise we need to get the coordinates from the alignment
# get the intervening blocks first, so we can use them
# to adjust the coordinates
if not has_ner:
# get intervening coordinates and blocks, only if model is not ner
# ner models have a much more simple coordinate calculation
inter_coords = _get_inter_coords(seq_coords)
inter_blocks = _get_blocks(cmbn_rows, inter_coords, row_dict)
# returns a three-component tuple of intron lengths
# first two component filled == intron in hit and query
# last component filled == intron in hit or query
raw_inter_lens = re.findall(_RE_EXON_LEN, cmbn_rows[row_dict["midline"]])
# compute start and end coords for each block
for seq_type in ("query", "hit"):
# ner blocks and intron blocks require different adjustments
if not has_ner:
opp_type = "hit" if seq_type == "query" else "query"
inter_lens = _comp_intron_lens(seq_type, inter_blocks, raw_inter_lens)
else:
# for NER blocks, the length of the inter-fragment gaps is
# written on the same strand, so opp_type is seq_type
opp_type = seq_type
inter_lens = [
int(x)
for x in re.findall(_RE_NER_LEN, cmbn_rows[row_dict[seq_type]])
]
# check that inter_lens's length is len opp_type block - 1
if len(inter_lens) != len(hsp[opp_type]) - 1:
raise ValueError(
"Length mismatch: %r vs %r"
% (len(inter_lens), len(hsp[opp_type]) - 1)
)
# fill the hsp query and hit coordinates
hsp["%s_ranges" % opp_type] = _comp_coords(hsp, opp_type, inter_lens)
# and fill the split codon coordinates, if model != ner
# can't do this in the if-else clause above since we need to
# compute the ranges first
if not has_ner:
hsp["%s_split_codons" % opp_type] = _comp_split_codons(
hsp, opp_type, scodon_moves
)
# now that we've finished parsing coords, we can set the hit and start
# coord according to Biopython's convention (start <= end)
for seq_type in ("query", "hit"):
if hsp["%s_strand" % seq_type] == -1:
n_start = "%s_start" % seq_type
n_end = "%s_end" % seq_type
hsp[n_start], hsp[n_end] = hsp[n_end], hsp[n_start]
return {"qresult": qresult, "hit": hit, "hsp": hsp}
def _read_alignment(self):
"""Read the raw alignment block strings, returns them in a list (PRIVATE)."""
raw_aln_blocks = []
# flag to check whether we're in an alignment row
in_aln_row = False
# flag for vulgar line, if present, we can parse coordinates from it
vulgar_comp = None
while True:
match = re.search(_RE_ALN_ROW, self.line.strip())
# if we have a match, set flags and values
if match and not in_aln_row:
start_idx = self.line.index(match.group(1))
row_len = len(match.group(1))
in_aln_row = True
raw_aln_block = []
# if we're in an alignment row, grab the sequence
if in_aln_row:
raw_aln_block.append(self.line[start_idx : start_idx + row_len])
# reset flags and values if the line matches, we're in an alignment
# row, and there are more than 1 line in rows
if match and in_aln_row and len(raw_aln_block) > 1:
raw_aln_blocks.append(raw_aln_block)
start_idx = None
row_len = None
in_aln_row = False
self.line = self.handle.readline()
# try to parse vulgar line if present
if self.line.startswith("vulgar"):
vulgar = re.search(_RE_VULGAR, self.line)
vulgar_comp = vulgar.group(10)
if not self.line or self.line.startswith(self._ALN_MARK):
# HACK: this is so that the parse_qresult method does not
# yield the objects before appending the last HSP. We are doing
# this to keep the parser compatible with outputs without
# human-readable alignment outputs. This also relies on the
# fact that repeated readline() always returns '' on EOF.
if not self.line:
self.line = "mock"
break
return raw_aln_blocks, vulgar_comp
class ExonerateTextIndexer(_BaseExonerateIndexer):
"""Indexer class for Exonerate plain text."""
_parser = ExonerateTextParser
_query_mark = b"C4 Alignment"
def get_qresult_id(self, pos):
"""Return the query ID from the nearest "Query:" line."""
handle = self._handle
handle.seek(pos)
sentinel = b"Query:"
while True:
line = handle.readline().strip()
if line.startswith(sentinel):
break
if not line:
raise StopIteration
qid, desc = _parse_hit_or_query_line(line.decode())
return qid
def get_raw(self, offset):
"""Return the raw string of a QueryResult object from the given offset."""
handle = self._handle
handle.seek(offset)
qresult_key = None
qresult_raw = b""
while True:
line = handle.readline()
if not line:
break
elif line.startswith(self._query_mark):
cur_pos = handle.tell()
if qresult_key is None:
qresult_key = self.get_qresult_id(cur_pos)
else:
curr_key = self.get_qresult_id(cur_pos)
if curr_key != qresult_key:
break
handle.seek(cur_pos)
qresult_raw += line
return qresult_raw
# if not used as a module, run the doctest
if __name__ == "__main__":
from Bio._utils import run_doctest
run_doctest()
|