1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230
|
# Copyright 2012 by Wibowo Arindrarto. All rights reserved.
# This file is part of the Biopython distribution and governed by your
# choice of the "Biopython License Agreement" or the "BSD 3-Clause License".
# Please see the LICENSE file that should have been included as part of this
# package.
"""Bio.SearchIO objects to model high scoring regions between query and hit."""
import warnings
from operator import ge, le
from Bio import BiopythonWarning
from Bio.Align import MultipleSeqAlignment
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio.SearchIO._utils import (
singleitem,
allitems,
fullcascade,
fragcascade,
getattr_str,
)
from ._base import _BaseHSP
class HSP(_BaseHSP):
"""Class representing high-scoring region(s) between query and hit.
HSP (high-scoring pair) objects are contained by Hit objects (see Hit).
In most cases, HSP objects store the bulk of the statistics and results
(e.g. e-value, bitscores, query sequence, etc.) produced by a search
program.
Depending on the search output file format, a given HSP will contain one
or more HSPFragment object(s). Examples of search programs that produce HSP
with one HSPFragments are BLAST, HMMER, and FASTA. Other programs such as
BLAT or Exonerate may produce HSPs containing more than one HSPFragment.
However, their native terminologies may differ: in BLAT these fragments
are called 'blocks' while in Exonerate they are called exons or NER.
Here are examples from each type of HSP. The first one comes from a BLAST
search::
>>> from Bio import SearchIO
>>> blast_qresult = next(SearchIO.parse('Blast/mirna.xml', 'blast-xml'))
>>> blast_hsp = blast_qresult[1][0] # the first HSP from the second hit
>>> blast_hsp
HSP(hit_id='gi|301171311|ref|NR_035856.1|', query_id='33211', 1 fragments)
>>> print(blast_hsp)
Query: 33211 mir_1
Hit: gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA mir-520b ...
Query range: [1:61] (1)
Hit range: [0:60] (1)
Quick stats: evalue 1.7e-22; bitscore 109.49
Fragments: 1 (60 columns)
Query - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hit - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG
For HSPs with a single HSPFragment, you can invoke ``print`` on it and see the
underlying sequence alignment, if it exists. This is not the case for HSPs
with more than one HSPFragment. Below is an example, using an HSP from a
BLAT search. Invoking ``print`` on these HSPs will instead show a table of the
HSPFragment objects it contains::
>>> blat_qresult = SearchIO.read('Blat/mirna.pslx', 'blat-psl', pslx=True)
>>> blat_hsp = blat_qresult[1][0] # the first HSP from the second hit
>>> blat_hsp
HSP(hit_id='chr11', query_id='blat_1', 2 fragments)
>>> print(blat_hsp)
Query: blat_1 <unknown description>
Hit: chr11 <unknown description>
Query range: [42:67] (-1)
Hit range: [59018929:59018955] (1)
Quick stats: evalue ?; bitscore ?
Fragments: --- -------------- ---------------------- ----------------------
# Span Query range Hit range
--- -------------- ---------------------- ----------------------
0 6 [61:67] [59018929:59018935]
1 16 [42:58] [59018939:59018955]
Notice that in HSPs with more than one HSPFragments, the HSP's ``query_range``
``hit_range`` properties encompasses all fragments it contains.
You can check whether an HSP has more than one HSPFragments or not using the
``is_fragmented`` property::
>>> blast_hsp.is_fragmented
False
>>> blat_hsp.is_fragmented
True
Since HSP objects are also containers similar to Python lists, you can
access a single fragment in an HSP using its integer index::
>>> blat_fragment = blat_hsp[0]
>>> print(blat_fragment)
Query: blat_1 <unknown description>
Hit: chr11 <unknown description>
Query range: [61:67] (-1)
Hit range: [59018929:59018935] (1)
Fragments: 1 (6 columns)
Query - tatagt
Hit - tatagt
This applies to HSPs objects with a single fragment as well::
>>> blast_fragment = blast_hsp[0]
>>> print(blast_fragment)
Query: 33211 mir_1
Hit: gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA mir-520b ...
Query range: [1:61] (1)
Hit range: [0:60] (1)
Fragments: 1 (60 columns)
Query - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hit - CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG
Regardless of the search output file format, HSP objects provide the
properties listed below. These properties always return values in a list,
due to the HSP object itself being a list-like container. However, for
HSP objects with a single HSPFragment, shortcut properties that fetches
the item from the list are also provided.
+----------------------+---------------------+-----------------------------+
| Property | Shortcut | Value |
+======================+=====================+=============================+
| aln_all | aln | HSP alignments as |
| | | MultipleSeqAlignment object |
+----------------------+---------------------+-----------------------------+
| aln_annotation_all | aln_annotation | dictionary of annotation(s) |
| | | of all fragments' alignments|
+----------------------+---------------------+-----------------------------+
| fragments | fragment | HSPFragment objects |
+----------------------+---------------------+-----------------------------+
| hit_all | hit | hit sequence as SeqRecord |
| | | objects |
+----------------------+---------------------+-----------------------------+
| hit_features_all | hit_features | SeqFeatures of all hit |
| | | fragments |
+----------------------+---------------------+-----------------------------+
| hit_start_all | hit_start* | start coordinates of the |
| | | hit fragments |
+----------------------+---------------------+-----------------------------+
| hit_end_all | hit_end* | end coordinates of the hit |
| | | fragments |
+----------------------+---------------------+-----------------------------+
| hit_span_all | hit_span* | sizes of each hit fragments |
+----------------------+---------------------+-----------------------------+
| hit_strand_all | hit_strand | strand orientations of the |
| | | hit fragments |
+----------------------+---------------------+-----------------------------+
| hit_frame_all | hit_frame | reading frames of the hit |
| | | fragments |
+----------------------+---------------------+-----------------------------+
| hit_range_all | hit_range | tuples of start and end |
| | | coordinates of each hit |
| | | fragment |
+----------------------+---------------------+-----------------------------+
| query_all | query | query sequence as SeqRecord |
| | | object |
+----------------------+---------------------+-----------------------------+
| query_features_all | query_features | SeqFeatures of all query |
| | | fragments |
+----------------------+---------------------+-----------------------------+
| query_start_all | query_start* | start coordinates of the |
| | | fragments |
+----------------------+---------------------+-----------------------------+
| query_end_all | query_end* | end coordinates of the |
| | | query fragments |
+----------------------+---------------------+-----------------------------+
| query_span_all | query_span* | sizes of each query |
| | | fragments |
+----------------------+---------------------+-----------------------------+
| query_strand_all | query_strand | strand orientations of the |
| | | query fragments |
+----------------------+---------------------+-----------------------------+
| query_frame_all | query_frame | reading frames of the query |
| | | fragments |
+----------------------+---------------------+-----------------------------+
| query_range_all | query_range | tuples of start and end |
| | | coordinates of each query |
| | | fragment |
+----------------------+---------------------+-----------------------------+
For all types of HSP objects, the property will return the values in a list.
Shortcuts are only applicable for HSPs with one fragment. Except the ones
noted, if they are used on an HSP with more than one fragments, an exception
will be raised.
For properties that may be used in HSPs with multiple or single fragments
(``*_start``, ``*_end``, and ``*_span`` properties), their interpretation depends
on how many fragment the HSP has:
+------------+---------------------------------------------------+
| Property | Value |
+============+===================================================+
| hit_start | smallest coordinate value of all hit fragments |
+------------+---------------------------------------------------+
| hit_end | largest coordinate value of all hit fragments |
+------------+---------------------------------------------------+
| hit_span | difference between ``hit_start`` and ``hit_end`` |
+------------+---------------------------------------------------+
| query_start| smallest coordinate value of all query fragments |
+------------+---------------------------------------------------+
| query_end | largest coordinate value of all query fragments |
+------------+---------------------------------------------------+
| query_span | difference between ``query_start`` and |
| | ``query_end`` |
+------------+---------------------------------------------------+
In addition to the objects listed above, HSP objects also provide the
following properties and/or attributes:
+--------------------+------------------------------------------------------+
| Property | Value |
+====================+======================================================+
| aln_span | total number of residues in all HSPFragment objects |
+--------------------+------------------------------------------------------+
| molecule_type | molecule_type of the hit and query SeqRecord objects |
+--------------------+------------------------------------------------------+
| is_fragmented | boolean, whether there are multiple fragments or not |
+--------------------+------------------------------------------------------+
| hit_id | ID of the hit sequence |
+--------------------+------------------------------------------------------+
| hit_description | description of the hit sequence |
+--------------------+------------------------------------------------------+
| hit_inter_ranges | list of hit sequence coordinates of the regions |
| | between fragments |
+--------------------+------------------------------------------------------+
| hit_inter_spans | list of lengths of the regions between hit fragments |
+--------------------+------------------------------------------------------+
| output_index | 0-based index for storing the order by which the HSP |
| | appears in the output file (default: -1). |
+--------------------+------------------------------------------------------+
| query_id | ID of the query sequence |
+--------------------+------------------------------------------------------+
| query_description | description of the query sequence |
+--------------------+------------------------------------------------------+
| query_inter_ranges | list of query sequence coordinates of the regions |
| | between fragments |
+--------------------+------------------------------------------------------+
| query_inter_spans | list of lengths of the regions between query |
| | fragments |
+--------------------+------------------------------------------------------+
.. [1] may be used in HSPs with multiple fragments
"""
# attributes we don't want to transfer when creating a new Hit class
# from this one
_NON_STICKY_ATTRS = ("_items",)
def __init__(self, fragments=(), output_index=-1):
"""Initialize an HSP object.
:param fragments: fragments contained in the HSP object
:type fragments: iterable yielding HSPFragment
:param output_index: optional index / ordering of the HSP fragment in
the original input file.
:type output_index: integer
HSP objects must be initialized with a list containing at least one
HSPFragment object. If multiple HSPFragment objects are used for
initialization, they must all have the same ``query_id``,
``query_description``, ``hit_id``, ``hit_description``, and
``molecule_type`` properties.
"""
if not fragments:
raise ValueError("HSP objects must have at least one HSPFragment object.")
# TODO - Move this into the for look in case hsps is a single use
# iterable?
# check that all fragments contain the same IDs, descriptions,
# molecule_type
for attr in (
"query_id",
"query_description",
"hit_id",
"hit_description",
"molecule_type",
):
if len({getattr(frag, attr) for frag in fragments}) != 1:
raise ValueError(
"HSP object can not contain fragments with more than one %s." % attr
)
self.output_index = output_index
self._items = []
for fragment in fragments:
self._validate_fragment(fragment)
self._items.append(fragment)
def __repr__(self):
"""Return string representation of HSP object."""
return "%s(hit_id=%r, query_id=%r, %r fragments)" % (
self.__class__.__name__,
self.hit_id,
self.query_id,
len(self),
)
def __iter__(self):
"""Iterate over HSP items."""
return iter(self._items)
def __contains__(self, fragment):
"""Return True if HSPFragment is on HSP items."""
return fragment in self._items
def __len__(self):
"""Return number of HSPs items."""
return len(self._items)
def __bool__(self):
"""Return True if it has HSPs."""
return bool(self._items)
def __str__(self):
"""Return a human readable summary of the HSP object."""
lines = []
# set hsp info line
statline = []
# evalue
evalue = getattr_str(self, "evalue", fmt="%.2g")
statline.append("evalue " + evalue)
# bitscore
bitscore = getattr_str(self, "bitscore", fmt="%.2f")
statline.append("bitscore " + bitscore)
lines.append("Quick stats: " + "; ".join(statline))
if len(self.fragments) == 1:
return "\n".join(
[self._str_hsp_header(), "\n".join(lines), self.fragments[0]._str_aln()]
)
else:
lines.append(
" Fragments: %s %s %s %s" % ("-" * 3, "-" * 14, "-" * 22, "-" * 22)
)
pattern = "%16s %14s %22s %22s"
lines.append(pattern % ("#", "Span", "Query range", "Hit range"))
lines.append(pattern % ("-" * 3, "-" * 14, "-" * 22, "-" * 22))
for idx, block in enumerate(self.fragments):
# set hsp line and table
# alignment span
aln_span = getattr_str(block, "aln_span")
# query region
query_start = getattr_str(block, "query_start")
query_end = getattr_str(block, "query_end")
query_range = "[%s:%s]" % (query_start, query_end)
# max column length is 20
query_range = (
query_range[:20] + "~]" if len(query_range) > 22 else query_range
)
# hit region
hit_start = getattr_str(block, "hit_start")
hit_end = getattr_str(block, "hit_end")
hit_range = "[%s:%s]" % (hit_start, hit_end)
hit_range = hit_range[:20] + "~]" if len(hit_range) > 22 else hit_range
# append the hsp row
lines.append(pattern % (str(idx), aln_span, query_range, hit_range))
return self._str_hsp_header() + "\n" + "\n".join(lines)
def __getitem__(self, idx):
"""Return object of index idx."""
# if key is slice, return a new HSP instance
if isinstance(idx, slice):
obj = self.__class__(self._items[idx])
self._transfer_attrs(obj)
return obj
return self._items[idx]
def __setitem__(self, idx, fragments):
"""Set an item of index idx with the given fragments."""
# handle case if hsps is a list of hsp
if isinstance(fragments, (list, tuple)):
for fragment in fragments:
self._validate_fragment(fragment)
else:
self._validate_fragment(fragments)
self._items[idx] = fragments
def __delitem__(self, idx):
"""Delete item of index idx."""
# note that this may result in an empty HSP object, which should be
# invalid
del self._items[idx]
def _validate_fragment(self, fragment):
if not isinstance(fragment, HSPFragment):
raise TypeError("HSP objects can only contain HSPFragment objects.")
# HACK: to make validation during __init__ work
if self._items:
if fragment.hit_id != self.hit_id:
raise ValueError(
"Expected HSPFragment with hit ID %r, found %r instead."
% (self.id, fragment.hit_id)
)
if fragment.hit_description != self.hit_description:
raise ValueError(
"Expected HSPFragment with hit description %r, found %r instead."
% (self.description, fragment.hit_description)
)
if fragment.query_id != self.query_id:
raise ValueError(
"Expected HSPFragment with query ID %r, found %r instead."
% (self.query_id, fragment.query_id)
)
if fragment.query_description != self.query_description:
raise ValueError(
"Expected HSP with query description %r, found %r instead."
% (self.query_description, fragment.query_description)
)
def _aln_span_get(self):
# length of all alignments
# alignment span can be its own attribute, or computed from
# query / hit length
return sum(frg.aln_span for frg in self.fragments)
aln_span = property(
fget=_aln_span_get, doc="Total number of columns in all HSPFragment objects."
)
# coordinate properties #
def _get_coords(self, seq_type, coord_type):
assert seq_type in ("hit", "query")
assert coord_type in ("start", "end")
coord_name = "%s_%s" % (seq_type, coord_type)
coords = [getattr(frag, coord_name) for frag in self.fragments]
if None in coords:
warnings.warn(
"'None' exist in %s coordinates; ignored" % (coord_name),
BiopythonWarning,
)
return coords
def _hit_start_get(self):
return min(self._get_coords("hit", "start"))
hit_start = property(
fget=_hit_start_get, doc="Smallest coordinate value of all hit fragments."
)
def _query_start_get(self):
return min(self._get_coords("query", "start"))
query_start = property(
fget=_query_start_get, doc="Smallest coordinate value of all query fragments."
)
def _hit_end_get(self):
return max(self._get_coords("hit", "end"))
hit_end = property(
fget=_hit_end_get, doc="Largest coordinate value of all hit fragments."
)
def _query_end_get(self):
return max(self._get_coords("query", "end"))
query_end = property(
fget=_query_end_get, doc="Largest coordinate value of all hit fragments."
)
# coordinate-dependent properties #
def _hit_span_get(self):
try:
return self.hit_end - self.hit_start
except TypeError: # triggered if any of the coordinates are None
return None
hit_span = property(
fget=_hit_span_get, doc="The number of hit residues covered by the HSP."
)
def _query_span_get(self):
try:
return self.query_end - self.query_start
except TypeError: # triggered if any of the coordinates are None
return None
query_span = property(
fget=_query_span_get, doc="The number of query residues covered by the HSP."
)
def _hit_range_get(self):
return (self.hit_start, self.hit_end)
hit_range = property(
fget=_hit_range_get, doc="Tuple of HSP hit start and end coordinates."
)
def _query_range_get(self):
return (self.query_start, self.query_end)
query_range = property(
fget=_query_range_get, doc="Tuple of HSP query start and end coordinates."
)
def _inter_ranges_get(self, seq_type):
# this property assumes that there are no mixed strands in a hit/query
assert seq_type in ("query", "hit")
strand = getattr(self, "%s_strand_all" % seq_type)[0]
coords = getattr(self, "%s_range_all" % seq_type)
# determine function used to set inter range
# start and end coordinates, given two pairs
# of fragment start and end coordinates
if strand == -1:
startfunc, endfunc = min, max
else:
startfunc, endfunc = max, min
inter_coords = []
for idx, coord in enumerate(coords[:-1]):
start = startfunc(coords[idx])
end = endfunc(coords[idx + 1])
inter_coords.append((min(start, end), max(start, end)))
return inter_coords
def _hit_inter_ranges_get(self):
return self._inter_ranges_get("hit")
hit_inter_ranges = property(
fget=_hit_inter_ranges_get,
doc="Hit sequence coordinates of the regions between fragments.",
)
def _query_inter_ranges_get(self):
return self._inter_ranges_get("query")
query_inter_ranges = property(
fget=_query_inter_ranges_get,
doc="Query sequence coordinates of the regions between fragments.",
)
def _inter_spans_get(self, seq_type):
assert seq_type in ("query", "hit")
attr_name = "%s_inter_ranges" % seq_type
return [coord[1] - coord[0] for coord in getattr(self, attr_name)]
def _hit_inter_spans_get(self):
return self._inter_spans_get("hit")
hit_inter_spans = property(
fget=_hit_inter_spans_get, doc="Lengths of regions between hit fragments."
)
def _query_inter_spans_get(self):
return self._inter_spans_get("query")
query_inter_spans = property(
fget=_query_inter_spans_get, doc="Lengths of regions between query fragments."
)
# shortcuts for fragments' properties #
# bool check if there's more than one fragments
is_fragmented = property(
lambda self: len(self) > 1,
doc="Whether the HSP has more than one HSPFragment objects.",
)
# first item properties with setters
hit_description = fullcascade(
"hit_description", doc="Description of the hit sequence."
)
query_description = fullcascade(
"query_description", doc="Description of the query sequence."
)
hit_id = fullcascade("hit_id", doc="ID of the hit sequence.")
query_id = fullcascade("query_id", doc="ID of the query sequence.")
molecule_type = fullcascade(
"molecule_type", doc="molecule_type of the hit and query SeqRecord objects."
)
# properties for single-fragment HSPs
fragment = singleitem(doc="HSPFragment object, first fragment.")
hit = singleitem("hit", doc="Hit sequence as a SeqRecord object, first fragment.")
query = singleitem(
"query", doc="Query sequence as a SeqRecord object, first fragment."
)
aln = singleitem(
"aln", doc="Alignment of the first fragment as a MultipleSeqAlignment object."
)
aln_annotation = singleitem(
"aln_annotation",
doc="Dictionary of annotation(s) of the first fragment's alignment.",
)
hit_features = singleitem(
"hit_features", doc="Hit sequence features, first fragment."
)
query_features = singleitem(
"query_features", doc="Query sequence features, first fragment."
)
hit_strand = singleitem("hit_strand", doc="Hit strand orientation, first fragment.")
query_strand = singleitem(
"query_strand", doc="Query strand orientation, first fragment."
)
hit_frame = singleitem(
"hit_frame", doc="Hit sequence reading frame, first fragment."
)
query_frame = singleitem(
"query_frame", doc="Query sequence reading frame, first fragment."
)
# properties for multi-fragment HSPs
fragments = allitems(doc="List of all HSPFragment objects.")
hit_all = allitems(
"hit", doc="List of all fragments' hit sequences as SeqRecord objects."
)
query_all = allitems(
"query", doc="List of all fragments' query sequences as SeqRecord objects."
)
aln_all = allitems(
"aln", doc="List of all fragments' alignments as MultipleSeqAlignment objects."
)
aln_annotation_all = allitems(
"aln_annotation",
doc="Dictionary of annotation(s) of all fragments' alignments.",
)
hit_features_all = allitems(
"hit_features", doc="List of all hit sequence features."
)
query_features_all = allitems(
"query_features", doc="List of all query sequence features."
)
hit_strand_all = allitems(
"hit_strand", doc="List of all fragments' hit sequence strands."
)
query_strand_all = allitems(
"query_strand", doc="List of all fragments' query sequence strands"
)
hit_frame_all = allitems(
"hit_frame", doc="List of all fragments' hit sequence reading frames."
)
query_frame_all = allitems(
"query_frame", doc="List of all fragments' query sequence reading frames."
)
hit_start_all = allitems(
"hit_start", doc="List of all fragments' hit start coordinates."
)
query_start_all = allitems(
"query_start", doc="List of all fragments' query start coordinates."
)
hit_end_all = allitems("hit_end", doc="List of all fragments' hit end coordinates.")
query_end_all = allitems(
"query_end", doc="List of all fragments' query end coordinates."
)
hit_span_all = allitems("hit_span", doc="List of all fragments' hit sequence size.")
query_span_all = allitems(
"query_span", doc="List of all fragments' query sequence size."
)
hit_range_all = allitems(
"hit_range", doc="List of all fragments' hit start and end coordinates."
)
query_range_all = allitems(
"query_range", doc="List of all fragments' query start and end coordinates."
)
class HSPFragment(_BaseHSP):
"""Class representing a contiguous alignment of hit-query sequence.
HSPFragment forms the core of any parsed search output file. Depending on
the search output file format, it may contain the actual query and/or hit
sequences that produces the search hits. These sequences are stored as
SeqRecord objects (see SeqRecord):
>>> from Bio import SearchIO
>>> qresult = next(SearchIO.parse('Blast/mirna.xml', 'blast-xml'))
>>> fragment = qresult[0][0][0] # first hit, first hsp, first fragment
>>> print(fragment)
Query: 33211 mir_1
Hit: gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 520b (MIR520...
Query range: [0:61] (1)
Hit range: [0:61] (1)
Fragments: 1 (61 columns)
Query - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hit - CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG
# the query sequence is a SeqRecord object
>>> fragment.query.__class__
<class 'Bio.SeqRecord.SeqRecord'>
>>> print(fragment.query)
ID: 33211
Name: aligned query sequence
Description: mir_1
Number of features: 0
/molecule_type=DNA
Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG')
# the hit sequence is a SeqRecord object as well
>>> fragment.hit.__class__
<class 'Bio.SeqRecord.SeqRecord'>
>>> print(fragment.hit)
ID: gi|262205317|ref|NR_030195.1|
Name: aligned hit sequence
Description: Homo sapiens microRNA 520b (MIR520B), microRNA
Number of features: 0
/molecule_type=DNA
Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG')
# when both query and hit are present, we get a MultipleSeqAlignment object
>>> fragment.aln.__class__
<class 'Bio.Align.MultipleSeqAlignment'>
>>> print(fragment.aln)
Alignment with 2 rows and 61 columns
CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG 33211
CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAG...GGG gi|262205317|ref|NR_030195.1|
"""
def __init__(
self,
hit_id="<unknown id>",
query_id="<unknown id>",
hit=None,
query=None,
molecule_type=None,
):
"""Initialize the class."""
self._molecule_type = molecule_type
self.aln_annotation = {}
self._hit_id = hit_id
self._query_id = query_id
for seq_type in ("query", "hit"):
# query or hit attributes default attributes
setattr(self, "_%s_description" % seq_type, "<unknown description>")
setattr(self, "_%s_features" % seq_type, [])
# query or hit attributes whose default attribute is None
for attr in ("strand", "frame", "start", "end"):
setattr(self, "%s_%s" % (seq_type, attr), None)
# self.query or self.hit
if eval(seq_type):
setattr(self, seq_type, eval(seq_type))
else:
setattr(self, seq_type, None)
def __repr__(self):
"""Return HSPFragment info; hit id, query id, number of columns."""
info = "hit_id=%r, query_id=%r" % (self.hit_id, self.query_id)
try:
info += ", %i columns" % len(self)
except AttributeError:
pass
return "%s(%s)" % (self.__class__.__name__, info)
def __len__(self):
"""Return alignment span."""
return self.aln_span
def __str__(self):
"""Return string of HSP header and alignments."""
return self._str_hsp_header() + "\n" + self._str_aln()
def __getitem__(self, idx):
"""Return object of index idx."""
if self.aln is not None:
obj = self.__class__(
hit_id=self.hit_id,
query_id=self.query_id,
molecule_type=self.molecule_type,
)
# transfer query and hit attributes
# let SeqRecord handle feature slicing, then retrieve the sliced
# features into the sliced HSPFragment
if self.query is not None:
obj.query = self.query[idx]
obj.query_features = obj.query.features
if self.hit is not None:
obj.hit = self.hit[idx]
obj.hit_features = obj.hit.features
# description, strand, frame
for attr in ("description", "strand", "frame"):
for seq_type in ("hit", "query"):
attr_name = "%s_%s" % (seq_type, attr)
self_val = getattr(self, attr_name)
setattr(obj, attr_name, self_val)
# alignment annotation should be transferred, since we can compute
# the resulting annotation
obj.aln_annotation = {}
for key, value in self.aln_annotation.items():
assert len(value[idx]) == len(obj)
obj.aln_annotation[key] = value[idx]
return obj
else:
raise TypeError(
"Slicing for HSP objects without alignment is not supported."
)
def _str_aln(self):
lines = []
# alignment length
aln_span = getattr_str(self, "aln_span")
lines.append(" Fragments: 1 (%s columns)" % aln_span)
# sequences
if self.query is not None and self.hit is not None:
try:
qseq = self.query.seq
except AttributeError: # query is None
qseq = "?"
try:
hseq = self.hit.seq
except AttributeError: # hit is None
hseq = "?"
# similarity line
simil = ""
if "similarity" in self.aln_annotation and isinstance(
self.aln_annotation.get("similarity"), str
):
simil = self.aln_annotation["similarity"]
if self.aln_span <= 67:
lines.append("%10s - %s" % ("Query", qseq))
if simil:
lines.append(" %s" % simil)
lines.append("%10s - %s" % ("Hit", hseq))
else:
# adjust continuation character length, so we don't display
# the same residues twice
if self.aln_span - 66 > 3:
cont = "~" * 3
else:
cont = "~" * (self.aln_span - 66)
lines.append("%10s - %s%s%s" % ("Query", qseq[:59], cont, qseq[-5:]))
if simil:
lines.append(" %s%s%s" % (simil[:59], cont, simil[-5:]))
lines.append("%10s - %s%s%s" % ("Hit", hseq[:59], cont, hseq[-5:]))
return "\n".join(lines)
# sequence properties #
def _set_seq(self, seq, seq_type):
"""Check the given sequence for attribute setting (PRIVATE).
:param seq: sequence to check
:type seq: string or SeqRecord
:param seq_type: sequence type
:type seq_type: string, choice of 'hit' or 'query'
"""
assert seq_type in ("hit", "query")
if seq is None:
return seq # return immediately if seq is None
else:
if not isinstance(seq, (str, SeqRecord)):
raise TypeError(
"%s sequence must be a string or a SeqRecord object." % seq_type
)
# check length if the opposite sequence is not None
opp_type = "hit" if seq_type == "query" else "query"
opp_seq = getattr(self, "_%s" % opp_type, None)
if opp_seq is not None:
if len(seq) != len(opp_seq):
raise ValueError(
"Sequence lengths do not match. Expected: %r (%s); found: %r (%s)."
% (len(opp_seq), opp_type, len(seq), seq_type)
)
seq_id = getattr(self, "%s_id" % seq_type)
seq_desc = getattr(self, "%s_description" % seq_type)
seq_feats = getattr(self, "%s_features" % seq_type)
seq_name = "aligned %s sequence" % seq_type
if isinstance(seq, SeqRecord):
seq.id = seq_id
seq.description = seq_desc
seq.name = seq_name
seq.features = seq_feats
seq.annotations["molecule_type"] = self.molecule_type
elif isinstance(seq, str):
seq = SeqRecord(
Seq(seq),
id=seq_id,
name=seq_name,
description=seq_desc,
features=seq_feats,
annotations={"molecule_type": self.molecule_type},
)
return seq
def _hit_get(self):
return self._hit
def _hit_set(self, value):
self._hit = self._set_seq(value, "hit")
hit = property(
fget=_hit_get,
fset=_hit_set,
doc="Hit sequence as a SeqRecord object, defaults to None.",
)
def _query_get(self):
return self._query
def _query_set(self, value):
self._query = self._set_seq(value, "query")
query = property(
fget=_query_get,
fset=_query_set,
doc="Query sequence as a SeqRecord object, defaults to None.",
)
def _aln_get(self):
if self.query is None and self.hit is None:
return None
if self.hit is None:
msa = MultipleSeqAlignment([self.query])
elif self.query is None:
msa = MultipleSeqAlignment([self.hit])
else:
msa = MultipleSeqAlignment([self.query, self.hit])
molecule_type = self.molecule_type
if molecule_type is not None:
msa.molecule_type = molecule_type
return msa
aln = property(
fget=_aln_get,
doc="Query-hit alignment as a MultipleSeqAlignment object, defaults to None.",
)
def _molecule_type_get(self):
return self._molecule_type
def _molecule_type_set(self, value):
self._molecule_type = value
try:
self.query.annotations["molecule_type"] = value
except AttributeError:
pass
try:
self.hit.annotations["molecule_type"] = value
except AttributeError:
pass
molecule_type = property(
fget=_molecule_type_get,
fset=_molecule_type_set,
doc="molecule type used in the fragment's "
"sequence records and alignment, defaults to None.",
)
def _aln_span_get(self):
# length of alignment (gaps included)
# alignment span can be its own attribute, or computed from
# query / hit length
try:
self._aln_span
except AttributeError:
if self.query is not None:
self._aln_span = len(self.query)
elif self.hit is not None:
self._aln_span = len(self.hit)
return self._aln_span
def _aln_span_set(self, value):
self._aln_span = value
aln_span = property(
fget=_aln_span_get,
fset=_aln_span_set,
doc="The number of alignment columns covered by the fragment.",
)
# id, description, and features properties #
hit_description = fragcascade("description", "hit", doc="Hit sequence description.")
query_description = fragcascade(
"description", "query", doc="Query sequence description."
)
hit_id = fragcascade("id", "hit", doc="Hit sequence ID.")
query_id = fragcascade("id", "query", doc="Query sequence ID.")
hit_features = fragcascade("features", "hit", doc="Hit sequence features.")
query_features = fragcascade("features", "query", doc="Query sequence features.")
# strand properties #
def _prep_strand(self, strand):
# follow SeqFeature's convention
if strand not in (-1, 0, 1, None):
raise ValueError("Strand should be -1, 0, 1, or None; not %r" % strand)
return strand
def _get_strand(self, seq_type):
assert seq_type in ("hit", "query")
strand = getattr(self, "_%s_strand" % seq_type)
if strand is None:
# try to compute strand from frame
frame = getattr(self, "%s_frame" % seq_type)
if frame is not None:
try:
strand = frame // abs(frame)
except ZeroDivisionError:
strand = 0
setattr(self, "%s_strand" % seq_type, strand)
return strand
def _hit_strand_get(self):
return self._get_strand("hit")
def _hit_strand_set(self, value):
self._hit_strand = self._prep_strand(value)
hit_strand = property(
fget=_hit_strand_get,
fset=_hit_strand_set,
doc="Hit sequence strand, defaults to None.",
)
def _query_strand_get(self):
return self._get_strand("query")
def _query_strand_set(self, value):
self._query_strand = self._prep_strand(value)
query_strand = property(
fget=_query_strand_get,
fset=_query_strand_set,
doc="Query sequence strand, defaults to None.",
)
# frame properties #
def _prep_frame(self, frame):
if frame not in (-3, -2, -1, 0, 1, 2, 3, None):
raise ValueError(
"Strand should be an integer between -3 and 3, or None; not %r" % frame
)
return frame
def _hit_frame_get(self):
return self._hit_frame
def _hit_frame_set(self, value):
self._hit_frame = self._prep_frame(value)
hit_frame = property(
fget=_hit_frame_get,
fset=_hit_frame_set,
doc="Hit sequence reading frame, defaults to None.",
)
def _query_frame_get(self):
"""Get query sequence reading frame (PRIVATE)."""
return self._query_frame
def _query_frame_set(self, value):
"""Set query sequence reading frame (PRIVATE)."""
self._query_frame = self._prep_frame(value)
query_frame = property(
fget=_query_frame_get,
fset=_query_frame_set,
doc="Query sequence reading frame, defaults to None.",
)
# coordinate properties #
def _prep_coord(self, coord, opp_coord_name, op):
# coord must either be None or int
if coord is None:
return coord
assert isinstance(coord, int)
# try to get opposite coordinate, if it's not present, return
try:
opp_coord = getattr(self, opp_coord_name)
except AttributeError:
return coord
# if opposite coordinate is None, return
if opp_coord is None:
return coord
# otherwise compare it to coord ('>=' or '<=')
else:
assert op(coord, opp_coord)
return coord
def _hit_start_get(self):
"""Get the sequence hit start coordinate (PRIVATE)."""
return self._hit_start
def _hit_start_set(self, value):
"""Set the sequence hit start coordinate (PRIVATE)."""
self._hit_start = self._prep_coord(value, "hit_end", le)
hit_start = property(
fget=_hit_start_get,
fset=_hit_start_set,
doc="Hit sequence start coordinate, defaults to None.",
)
def _query_start_get(self):
"""Get the query sequence start coordinate (PRIVATE)."""
return self._query_start
def _query_start_set(self, value):
"""Set the query sequence start coordinate (PRIVATE)."""
self._query_start = self._prep_coord(value, "query_end", le)
query_start = property(
fget=_query_start_get,
fset=_query_start_set,
doc="Query sequence start coordinate, defaults to None.",
)
def _hit_end_get(self):
"""Get the hit sequence end coordinate (PRIVATE)."""
return self._hit_end
def _hit_end_set(self, value):
"""Set the hit sequence end coordinate (PRIVATE)."""
self._hit_end = self._prep_coord(value, "hit_start", ge)
hit_end = property(
fget=_hit_end_get,
fset=_hit_end_set,
doc="Hit sequence end coordinate, defaults to None.",
)
def _query_end_get(self):
"""Get the query sequence end coordinate (PRIVATE)."""
return self._query_end
def _query_end_set(self, value):
"""Set the query sequence end coordinate (PRIVATE)."""
self._query_end = self._prep_coord(value, "query_start", ge)
query_end = property(
fget=_query_end_get,
fset=_query_end_set,
doc="Query sequence end coordinate, defaults to None.",
)
# coordinate-dependent properties #
def _hit_span_get(self):
"""Return the number of residues covered by the hit sequence (PRIVATE)."""
try:
return self.hit_end - self.hit_start
except TypeError: # triggered if any of the coordinates are None
return None
hit_span = property(
fget=_hit_span_get, doc="The number of residues covered by the hit sequence."
)
def _query_span_get(self):
"""Return the number or residues covered by the query (PRIVATE)."""
try:
return self.query_end - self.query_start
except TypeError: # triggered if any of the coordinates are None
return None
query_span = property(
fget=_query_span_get,
doc="The number of residues covered by the query sequence.",
)
def _hit_range_get(self):
"""Return the start and end of a hit (PRIVATE)."""
return (self.hit_start, self.hit_end)
hit_range = property(
fget=_hit_range_get, doc="Tuple of hit start and end coordinates."
)
def _query_range_get(self):
"""Return the start and end of a query (PRIVATE)."""
return (self.query_start, self.query_end)
query_range = property(
fget=_query_range_get, doc="Tuple of query start and end coordinates."
)
# if not used as a module, run the doctest
if __name__ == "__main__":
from Bio._utils import run_doctest
run_doctest()
|