1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212
|
#!/usr/bin/env python
# Copyright 2000 by Thomas Sicheritz-Ponten.
# Copyright 2016 by Markus Piotrowski.
# All rights reserved.
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
# Created: Thu Jul 13 14:07:25 2000
# thomas@cbs.dtu.dk, http://www.cbs.dtu.dk/thomas
"""BLAST code for graphical Xbbtools tool."""
import glob
import os
import subprocess
import sys
import tkinter as tk
import tkinter.ttk as ttk
from tkinter import filedialog
from tkinter import messagebox
import xbb_blastbg
from xbb_utils import NotePad
class BlastIt:
"""Local BLAST integration for xbbtools."""
nin, pin = [], []
blast_ok = False
blast_path = ""
def __init__(self, seq, parent=None):
"""Set up new top-level window for BLAST search."""
self.seq = seq
self.parent = parent
self.toplevel = tk.Toplevel(parent)
self.toplevel.title("BLAST parameters")
if not self.get_blast_databases() or not self.get_blast_binaries():
return
self.Choices()
self.dbs.bind("<<ComboboxSelected>>", self.Validate)
self.blasts.bind("<<ComboboxSelected>>", self.Validate)
def get_blast_databases(self):
"""Try to locate the BLAST databases and put into lists."""
if not (BlastIt.nin and BlastIt.pin):
pin, nin = [], []
try:
pin.extend(glob.glob(os.environ["BLASTDB"] + "/*.pin"))
except KeyError:
pass
pin.extend(glob.glob("C:*.pin"))
try:
nin.extend(glob.glob(os.environ["BLASTDB"] + "/*.nin"))
except KeyError:
pass
# If no system variable BLASTDB exists, give user the chance to
# locate his database folder:
if not (nin and pin):
database_folder = filedialog.askdirectory(
title="Please locate your BLAST database(s) folder:"
)
nin.extend(glob.glob(database_folder + "/*.nin"))
pin.extend(glob.glob(database_folder + "/*.pin"))
if not (nin and pin):
messagebox.showerror(
"xbb tools", "This folder does not contain any BLAST databases!"
)
self.toplevel.destroy()
return False
self.pin = [os.path.splitext(x)[0] for x in pin]
self.nin = [os.path.splitext(x)[0] for x in nin]
BlastIt.pin = self.pin
BlastIt.nin = self.nin
return True
def get_blast_binaries(self):
"""Test if BLAST binaries are in PATH or let user locate them."""
if not BlastIt.blast_ok:
# Test if blast binaries are in path
if subprocess.call(
["blastn", "-version"]
): # Return of non-zero means error
self.blast_path = filedialog.askdirectory(
title="Please locate your BLAST program folder:"
)
if subprocess.call(
[os.path.join(self.blast_path, "blastn"), "-version"]
):
messagebox.showerror(
"xbb tools",
"Wrong folder or missing BLAST"
" binaries!\n To run BLAST you must install the "
" standalone BLAST binaries.",
)
self.toplevel.destroy()
return False
else:
BlastIt.blast_ok = True
else: # BLAST binaries are in PATH
BlastIt.blast_ok = True
self.blast_path = ""
BlastIt.blast_path = self.blast_path
self.toplevel.lift()
return True
def database_readable(self, db_paths):
"""Return the name of the blast database without path and extension."""
db_names = [entry.split(os.sep)[-1].split(".")[0] for entry in db_paths]
return db_names
def convert_dbname_to_dbpath(self, db_name):
"""Return the full path for a given blast database name."""
database_path = ""
for database in self.nin:
if database.endswith(db_name):
database_path = database
break
for database in self.pin:
if database.endswith(db_name):
database_path = database
break
return database_path
def Choices(self):
"""Set up window to select BLAST program and database."""
self.blast_string = tk.StringVar()
self.blast_string.set("blastn")
self.cf = ttk.Frame(self.toplevel)
self.cf.pack(side="top", expand=1, fill="x")
self.dbs_frame = ttk.LabelFrame(self.cf, text="Databases")
self.dbs_frame.pack(side="left", padx=5, pady=5, expand=1, fill="x")
nin_values = self.database_readable(self.nin)
pin_values = self.database_readable(self.pin)
self.dbs = ttk.Combobox(
self.dbs_frame, exportselection=0, values=nin_values + pin_values
)
self.dbs.current(0)
self.blast_frame = ttk.LabelFrame(self.cf, text="BLAST programs")
self.blast_frame.pack(side="left", padx=5, pady=5, expand=1, fill="x")
self.blasts = ttk.Combobox(
self.blast_frame,
exportselection=0,
textvariable=self.blast_string,
values=["blastn", "blastp", "blastx", "tblastn", "tblastx"],
)
self.dbs.pack(side="left", padx=5, pady=5, expand=1, fill="x")
self.blasts.pack(side="left", padx=5, pady=5, expand=1, fill="x")
self.option_f = ttk.LabelFrame(self.cf, text="Command line options")
self.option_f.pack(side="left", padx=5, pady=5, expand=1, fill="x")
self.option = ttk.Entry(self.option_f)
self.option.pack(side="left", padx=5, pady=5, fill="x", expand=1)
self.ok = ttk.Button(self.cf, text="Run", command=self._Run, state="disabled")
self.ok.pack(side="right")
self.Validate()
def Validate(self, *args):
"""Check everything and enable/disable 'Run' button."""
db = self.convert_dbname_to_dbpath(self.dbs.get())
prog = self.blasts.get()
if (prog in ["blastn", "tblastx", "tblastn"]) == (db in self.nin):
self.ok.config(state="normal")
elif (prog in ["blastp", "blastx"]) == (db in self.pin):
self.ok.config(state="normal")
else:
self.ok.config(state="disabled")
def _Run(self):
"""Initialise options for Blast commandline (PRIVATE)."""
command_options = self.option.get()
options = ""
if len(command_options.strip()):
options = command_options.strip()
db = self.convert_dbname_to_dbpath(self.dbs.get())
prog = self.blast_path + self.blasts.get()
self.command_data = [self.seq, prog, db, options]
self.Run()
def Run(self):
"""Open new notepad and initialize running BLAST."""
self.notepad = NotePad()
tid = self.notepad.tid
self.toplevel.destroy()
blastbg = xbb_blastbg.BlastDisplayer(self.command_data, tid)
blastbg.RunCommand()
if __name__ == "__main__":
try:
seq = sys.argv[1]
except IndexError: # Started script without providing a sequence
seq = "ATGACAAAGCTAATTATTCACTTGGTTTCAGACTCTTCTGTGCAAACTGC"
win = tk.Tk()
win.title("Dummy windows for BLAST test")
test = BlastIt(seq)
win.mainloop()
|