1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175
|
# Copyright 2006-2024 by Peter Cock. All rights reserved.
# This file is part of the Biopython distribution and governed by your
# choice of the "Biopython License Agreement" or the "BSD 3-Clause License".
# Please see the LICENSE file that should have been included as part of this
# package.
r"""Sequence input/output as SeqRecord objects.
Bio.SeqIO is also documented at SeqIO_ and by a whole chapter in our tutorial:
- `HTML Tutorial`_
- `PDF Tutorial`_
.. _SeqIO: http://biopython.org/wiki/SeqIO
.. _`HTML Tutorial`: http://biopython.org/DIST/docs/tutorial/Tutorial.html
.. _`PDF Tutorial`: http://biopython.org/DIST/docs/tutorial/Tutorial.pdf
Input
-----
The main function is Bio.SeqIO.parse(...) which takes an input file handle
(or in recent versions of Biopython alternatively a filename as a string),
and format string. This returns an iterator giving SeqRecord objects:
>>> from Bio import SeqIO
>>> for record in SeqIO.parse("Fasta/f002", "fasta"):
... print("%s %i" % (record.id, len(record)))
gi|1348912|gb|G26680|G26680 633
gi|1348917|gb|G26685|G26685 413
gi|1592936|gb|G29385|G29385 471
Note that the parse() function will invoke the relevant parser for the
format with its default settings. You may want more control, in which case
you need to create a format specific sequence iterator directly.
Some of these parsers are wrappers around low-level parsers which build up
SeqRecord objects for the consistent SeqIO interface. In cases where the
run-time is critical, such as large FASTA or FASTQ files, calling these
underlying parsers will be much faster - in this case these generator
functions which return tuples of strings:
>>> from Bio.SeqIO.FastaIO import SimpleFastaParser
>>> from Bio.SeqIO.QualityIO import FastqGeneralIterator
Input - Single Records
----------------------
If you expect your file to contain one-and-only-one record, then we provide
the following 'helper' function which will return a single SeqRecord, or
raise an exception if there are no records or more than one record:
>>> from Bio import SeqIO
>>> record = SeqIO.read("Fasta/f001", "fasta")
>>> print("%s %i" % (record.id, len(record)))
gi|3318709|pdb|1A91| 79
This style is useful when you expect a single record only (and would
consider multiple records an error). For example, when dealing with GenBank
files for bacterial genomes or chromosomes, there is normally only a single
record. Alternatively, use this with a handle when downloading a single
record from the internet.
However, if you just want the first record from a file containing multiple
record, use the next() function on the iterator:
>>> from Bio import SeqIO
>>> record = next(SeqIO.parse("Fasta/f002", "fasta"))
>>> print("%s %i" % (record.id, len(record)))
gi|1348912|gb|G26680|G26680 633
The above code will work as long as the file contains at least one record.
Note that if there is more than one record, the remaining records will be
silently ignored.
Input - Multiple Records
------------------------
For non-interlaced files (e.g. Fasta, GenBank, EMBL) with multiple records
using a sequence iterator can save you a lot of memory (RAM). There is
less benefit for interlaced file formats (e.g. most multiple alignment file
formats). However, an iterator only lets you access the records one by one.
If you want random access to the records by number, turn this into a list:
>>> from Bio import SeqIO
>>> records = list(SeqIO.parse("Fasta/f002", "fasta"))
>>> len(records)
3
>>> print(records[1].id)
gi|1348917|gb|G26685|G26685
If you want random access to the records by a key such as the record id,
turn the iterator into a dictionary:
>>> from Bio import SeqIO
>>> record_dict = SeqIO.to_dict(SeqIO.parse("Fasta/f002", "fasta"))
>>> len(record_dict)
3
>>> print(len(record_dict["gi|1348917|gb|G26685|G26685"]))
413
However, using list() or the to_dict() function will load all the records
into memory at once, and therefore is not possible on very large files.
Instead, for *some* file formats Bio.SeqIO provides an indexing approach
providing dictionary like access to any record. For example,
>>> from Bio import SeqIO
>>> record_dict = SeqIO.index("Fasta/f002", "fasta")
>>> len(record_dict)
3
>>> print(len(record_dict["gi|1348917|gb|G26685|G26685"]))
413
>>> record_dict.close()
Many but not all of the supported input file formats can be indexed like
this. For example "fasta", "fastq", "qual" and even the binary format "sff"
work, but alignment formats like "phylip", "clustalw" and "nexus" will not.
In most cases you can also use SeqIO.index to get the record from the file
as a raw string (not a SeqRecord). This can be useful for example to extract
a sub-set of records from a file where SeqIO cannot output the file format
(e.g. the plain text SwissProt format, "swiss") or where it is important to
keep the output 100% identical to the input). For example,
>>> from Bio import SeqIO
>>> record_dict = SeqIO.index("Fasta/f002", "fasta")
>>> len(record_dict)
3
>>> print(record_dict.get_raw("gi|1348917|gb|G26685|G26685").decode())
>gi|1348917|gb|G26685|G26685 human STS STS_D11734.
CGGAGCCAGCGAGCATATGCTGCATGAGGACCTTTCTATCTTACATTATGGCTGGGAATCTTACTCTTTC
ATCTGATACCTTGTTCAGATTTCAAAATAGTTGTAGCCTTATCCTGGTTTTACAGATGTGAAACTTTCAA
GAGATTTACTGACTTTCCTAGAATAGTTTCTCTACTGGAAACCTGATGCTTTTATAAGCCATTGTGATTA
GGATGACTGTTACAGGCTTAGCTTTGTGTGAAANCCAGTCACCTTTCTCCTAGGTAATGAGTAGTGCTGT
TCATATTACTNTAAGTTCTATAGCATACTTGCNATCCTTTANCCATGCTTATCATANGTACCATTTGAGG
AATTGNTTTGCCCTTTTGGGTTTNTTNTTGGTAAANNNTTCCCGGGTGGGGGNGGTNNNGAAA
<BLANKLINE>
>>> print(record_dict["gi|1348917|gb|G26685|G26685"].format("fasta"))
>gi|1348917|gb|G26685|G26685 human STS STS_D11734.
CGGAGCCAGCGAGCATATGCTGCATGAGGACCTTTCTATCTTACATTATGGCTGGGAATC
TTACTCTTTCATCTGATACCTTGTTCAGATTTCAAAATAGTTGTAGCCTTATCCTGGTTT
TACAGATGTGAAACTTTCAAGAGATTTACTGACTTTCCTAGAATAGTTTCTCTACTGGAA
ACCTGATGCTTTTATAAGCCATTGTGATTAGGATGACTGTTACAGGCTTAGCTTTGTGTG
AAANCCAGTCACCTTTCTCCTAGGTAATGAGTAGTGCTGTTCATATTACTNTAAGTTCTA
TAGCATACTTGCNATCCTTTANCCATGCTTATCATANGTACCATTTGAGGAATTGNTTTG
CCCTTTTGGGTTTNTTNTTGGTAAANNNTTCCCGGGTGGGGGNGGTNNNGAAA
<BLANKLINE>
>>> record_dict.close()
Here the original file and what Biopython would output differ in the line
wrapping. Also note that the get_raw method will return a bytes object,
hence the use of decode to turn it into a string.
Also note that the get_raw method will preserve the newline endings. This
example FASTQ file uses Unix style endings (b"\n" only),
>>> from Bio import SeqIO
>>> fastq_dict = SeqIO.index("Quality/example.fastq", "fastq")
>>> len(fastq_dict)
3
>>> raw = fastq_dict.get_raw("EAS54_6_R1_2_1_540_792")
>>> raw.count(b"\n")
4
>>> raw.count(b"\r\n")
0
>>> b"\r" in raw
False
>>> len(raw)
78
>>> fastq_dict.close()
Here is the same file but using DOS/Windows new lines (b"\r\n" instead),
>>> from Bio import SeqIO
>>> fastq_dict = SeqIO.index("Quality/example_dos.fastq", "fastq")
>>> len(fastq_dict)
3
>>> raw = fastq_dict.get_raw("EAS54_6_R1_2_1_540_792")
>>> raw.count(b"\n")
4
>>> raw.count(b"\r\n")
4
>>> b"\r\n" in raw
True
>>> len(raw)
82
>>> fastq_dict.close()
Because this uses two bytes for each new line, the file is longer than
the Unix equivalent with only one byte.
Input - Alignments
------------------
You can read in alignment files as alignment objects using Bio.AlignIO.
Alternatively, reading in an alignment file format via Bio.SeqIO will give
you a SeqRecord for each row of each alignment:
>>> from Bio import SeqIO
>>> for record in SeqIO.parse("Clustalw/hedgehog.aln", "clustal"):
... print("%s %i" % (record.id, len(record)))
gi|167877390|gb|EDS40773.1| 447
gi|167234445|ref|NP_001107837. 447
gi|74100009|gb|AAZ99217.1| 447
gi|13990994|dbj|BAA33523.2| 447
gi|56122354|gb|AAV74328.1| 447
Output
------
Use the function Bio.SeqIO.write(...), which takes a complete set of
SeqRecord objects (either as a list, or an iterator), an output file handle
(or in recent versions of Biopython an output filename as a string) and of
course the file format::
from Bio import SeqIO
records = ...
SeqIO.write(records, "example.faa", "fasta")
Or, using a handle::
from Bio import SeqIO
records = ...
with open("example.faa", "w") as handle:
SeqIO.write(records, handle, "fasta")
You are expected to call this function once (with all your records) and if
using a handle, make sure you close it to flush the data to the hard disk.
Output - Advanced
-----------------
The effect of calling write() multiple times on a single file will vary
depending on the file format, and is best avoided unless you have a strong
reason to do so.
If you give a filename, then each time you call write() the existing file
will be overwritten. For sequential files formats (e.g. fasta, genbank) each
"record block" holds a single sequence. For these files it would probably
be safe to call write() multiple times by re-using the same handle.
However, trying this for certain alignment formats (e.g. phylip, clustal,
stockholm) would have the effect of concatenating several multiple sequence
alignments together. Such files are created by the PHYLIP suite of programs
for bootstrap analysis, but it is clearer to do this via Bio.AlignIO instead.
Worse, many fileformats have an explicit header and/or footer structure
(e.g. any XMl format, and most binary file formats like SFF). Here making
multiple calls to write() will result in an invalid file.
Conversion
----------
The Bio.SeqIO.convert(...) function allows an easy interface for simple
file format conversions. Additionally, it may use file format specific
optimisations so this should be the fastest way too.
In general however, you can combine the Bio.SeqIO.parse(...) function with
the Bio.SeqIO.write(...) function for sequence file conversion. Using
generator expressions or generator functions provides a memory efficient way
to perform filtering or other extra operations as part of the process.
File Formats
------------
When specifying the file format, use lowercase strings. The same format
names are also used in Bio.AlignIO and include the following:
- abi - Applied Biosystem's sequencing trace format
- abi-trim - Same as "abi" but with quality trimming with Mott's algorithm
- ace - Reads the contig sequences from an ACE assembly file.
- cif-atom - Uses Bio.PDB.MMCIFParser to determine the (partial) protein
sequence as it appears in the structure based on the atomic coordinates.
- cif-seqres - Reads a macromolecular Crystallographic Information File
(mmCIF) file to determine the complete protein sequence as defined by the
_pdbx_poly_seq_scheme records.
- embl - The EMBL flat file format. Uses Bio.GenBank internally.
- fasta - The generic sequence file format where each record starts with
an identifier line starting with a ">" character, followed by
lines of sequence.
- fasta-2line - Stricter interpretation of the FASTA format using exactly
two lines per record (no line wrapping).
- fastq - A "FASTA like" format used by Sanger which also stores PHRED
sequence quality values (with an ASCII offset of 33).
- fastq-sanger - An alias for "fastq" for consistency with BioPerl and EMBOSS
- fastq-solexa - Original Solexa/Illumnia variant of the FASTQ format which
encodes Solexa quality scores (not PHRED quality scores) with an
ASCII offset of 64.
- fastq-illumina - Solexa/Illumina 1.3 to 1.7 variant of the FASTQ format
which encodes PHRED quality scores with an ASCII offset of 64
(not 33). Note as of version 1.8 of the CASAVA pipeline Illumina
will produce FASTQ files using the standard Sanger encoding.
- gck - Gene Construction Kit's format.
- genbank - The GenBank or GenPept flat file format.
- gb - An alias for "genbank", for consistency with NCBI Entrez Utilities
- gfa1 - Graphical Fragment Assemblyv versions 1.x. Only segment lines
are parsed and all linkage information is ignored.
- gfa2 - Graphical Fragment Assembly version 2.0. Only segment lines are
parsed and all linkage information is ignored.
- ig - The IntelliGenetics file format, apparently the same as the
MASE alignment format.
- imgt - An EMBL like format from IMGT where the feature tables are more
indented to allow for longer feature types.
- nib - UCSC's nib file format for nucleotide sequences, which uses one
nibble (4 bits) to represent each nucleotide, and stores two nucleotides in
one byte.
- pdb-seqres - Reads a Protein Data Bank (PDB) file to determine the
complete protein sequence as it appears in the header (no dependencies).
- pdb-atom - Uses Bio.PDB to determine the (partial) protein sequence as
it appears in the structure based on the atom coordinate section of the
file (requires NumPy for Bio.PDB).
- phd - Output from PHRED, used by PHRAP and CONSED for input.
- pir - A "FASTA like" format introduced by the National Biomedical
Research Foundation (NBRF) for the Protein Information Resource
(PIR) database, now part of UniProt.
- seqxml - SeqXML, simple XML format described in Schmitt et al (2011).
- sff - Standard Flowgram Format (SFF), typical output from Roche 454.
- sff-trim - Standard Flowgram Format (SFF) with given trimming applied.
- snapgene - SnapGene's native format.
- swiss - Plain text Swiss-Prot aka UniProt format.
- tab - Simple two column tab separated sequence files, where each
line holds a record's identifier and sequence. For example,
this is used as by Aligent's eArray software when saving
microarray probes in a minimal tab delimited text file.
- qual - A "FASTA like" format holding PHRED quality values from
sequencing DNA, but no actual sequences (usually provided
in separate FASTA files).
- uniprot-xml - The UniProt XML format (replacement for the SwissProt plain
text format which we call "swiss")
- xdna - DNA Strider's and SerialCloner's native format.
Note that while Bio.SeqIO can read all the above file formats, it cannot
write to all of them.
You can also use any file format supported by Bio.AlignIO, such as "nexus",
"phylip" and "stockholm", which gives you access to the individual sequences
making up each alignment as SeqRecords.
"""
# TODO
# - define policy on reading aligned sequences with more than
# one gap character (see also AlignIO)
#
# - How best to handle unique/non unique record.id when writing.
# For most file formats reading such files is fine; The stockholm
# parser would fail.
#
# - MSF multiple alignment format, aka GCG, aka PileUp format (*.msf)
# http://www.bioperl.org/wiki/MSF_multiple_alignment_format
#
# FAO BioPython Developers
# ------------------------
# The way I envision this SeqIO system working as that for any sequence file
# format we have an iterator that returns SeqRecord objects.
#
# This also applies to interlaced file formats (like clustal - although that
# is now handled via Bio.AlignIO instead) where the file cannot be read record
# by record. You should still return an iterator, even if the implementation
# could just as easily return a list.
#
# These file format specific sequence iterators may be implemented as:
# - Classes which take a handle for __init__ and provide the __iter__ method
# - Functions that take a handle, and return an iterator object
# - Generator functions that take a handle, and yield SeqRecord objects
#
# It is then trivial to turn this iterator into a list of SeqRecord objects,
# an in memory dictionary, or a multiple sequence alignment object.
#
# For building the dictionary by default the id property of each SeqRecord is
# used as the key. You should always populate the id property, and it should
# be unique in most cases. For some file formats the accession number is a good
# choice. If the file itself contains ambiguous identifiers, don't try and
# dis-ambiguate them - return them as is.
#
# When adding a new file format, please use the same lower case format name
# as BioPerl, or if they have not defined one, try the names used by EMBOSS.
#
# See also http://biopython.org/wiki/SeqIO_dev
#
# --Peter
from abc import ABC, abstractmethod
from collections.abc import Callable
from collections.abc import Iterable
from typing import Union
from Bio import AlignIO
from Bio.SeqIO import AbiIO
from Bio.SeqIO import AceIO
from Bio.SeqIO import FastaIO
from Bio.SeqIO import GckIO
from Bio.SeqIO import GfaIO
from Bio.SeqIO import IgIO # IntelliGenetics or MASE format
from Bio.SeqIO import InsdcIO # EMBL and GenBank
from Bio.SeqIO import NibIO
from Bio.SeqIO import PdbIO
from Bio.SeqIO import PhdIO
from Bio.SeqIO import PirIO
from Bio.SeqIO import QualityIO # FastQ and qual files
from Bio.SeqIO import SeqXmlIO
from Bio.SeqIO import SffIO
from Bio.SeqIO import SnapGeneIO
from Bio.SeqIO import SwissIO
from Bio.SeqIO import TabIO
from Bio.SeqIO import TwoBitIO
from Bio.SeqIO import UniprotIO
from Bio.SeqIO import XdnaIO
from Bio.SeqRecord import SeqRecord
from .Interfaces import _IOSource, _TextIOSource, SequenceIterator, SequenceWriter
# Convention for format names is "mainname-subtype" in lower case.
# Please use the same names as BioPerl or EMBOSS where possible.
#
# Note that this simple system copes with defining
# multiple possible iterators for a given format/extension
# with the -subtype suffix
#
# Most alignment file formats will be handled via Bio.AlignIO
_FormatToIterator = {
"abi": AbiIO.AbiIterator,
"abi-trim": AbiIO._AbiTrimIterator,
"ace": AceIO.AceIterator,
"fasta": FastaIO.FastaIterator,
"fasta-2line": FastaIO.FastaTwoLineIterator,
"fasta-blast": FastaIO.FastaBlastIterator,
"fasta-pearson": FastaIO.FastaPearsonIterator,
"ig": IgIO.IgIterator,
"embl": InsdcIO.EmblIterator,
"embl-cds": InsdcIO.EmblCdsFeatureIterator,
"gb": InsdcIO.GenBankIterator,
"gck": GckIO.GckIterator,
"genbank": InsdcIO.GenBankIterator,
"genbank-cds": InsdcIO.GenBankCdsFeatureIterator,
"gfa1": GfaIO.Gfa1Iterator,
"gfa2": GfaIO.Gfa2Iterator,
"imgt": InsdcIO.ImgtIterator,
"nib": NibIO.NibIterator,
"cif-seqres": PdbIO.CifSeqresIterator,
"cif-atom": PdbIO.CifAtomIterator,
"pdb-atom": PdbIO.PdbAtomIterator,
"pdb-seqres": PdbIO.PdbSeqresIterator,
"phd": PhdIO.PhdIterator,
"pir": PirIO.PirIterator,
"fastq": QualityIO.FastqPhredIterator,
"fastq-sanger": QualityIO.FastqPhredIterator,
"fastq-solexa": QualityIO.FastqSolexaIterator,
"fastq-illumina": QualityIO.FastqIlluminaIterator,
"qual": QualityIO.QualPhredIterator,
"seqxml": SeqXmlIO.SeqXmlIterator,
"sff": SffIO.SffIterator,
"snapgene": SnapGeneIO.SnapGeneIterator,
"sff-trim": SffIO._SffTrimIterator, # Not sure about this in the long run
"swiss": SwissIO.SwissIterator,
"tab": TabIO.TabIterator,
"twobit": TwoBitIO.TwoBitIterator,
"uniprot-xml": UniprotIO.UniprotIterator,
"xdna": XdnaIO.XdnaIterator,
}
# Right now used in the unit tests as proxy for all supported outputs...
_FormatToWriter = {
"fasta": FastaIO.FastaWriter,
"fasta-2line": FastaIO.FastaTwoLineWriter,
"gb": InsdcIO.GenBankWriter,
"genbank": InsdcIO.GenBankWriter,
"embl": InsdcIO.EmblWriter,
"imgt": InsdcIO.ImgtWriter,
"nib": NibIO.NibWriter,
"phd": PhdIO.PhdWriter,
"pir": PirIO.PirWriter,
"fastq": QualityIO.FastqPhredWriter,
"fastq-sanger": QualityIO.FastqPhredWriter,
"fastq-solexa": QualityIO.FastqSolexaWriter,
"fastq-illumina": QualityIO.FastqIlluminaWriter,
"qual": QualityIO.QualPhredWriter,
"seqxml": SeqXmlIO.SeqXmlWriter,
"sff": SffIO.SffWriter,
"tab": TabIO.TabWriter,
"xdna": XdnaIO.XdnaWriter,
}
class AlignmentSequenceIterator(SequenceIterator):
"""Pareses an alignment file and yields sequence records."""
modes = "t"
@property
@abstractmethod
def fmt(self):
"""Alignment file format name."""
@property
@abstractmethod
def _alignment_iterator_class(self):
"""Alignment iterator class."""
def __init__(self, source: _IOSource) -> None:
"""Initialize the iterator."""
super().__init__(source, fmt=self.fmt)
# We need type(self) here, because _alignment_iterator_class is
# actually a function instead of a class for some formats in
# Bio.AlignIO, and Python will turn the function into a bound method
# with self as the first argument.
alignment_iterator_class = type(self)._alignment_iterator_class
alignments = alignment_iterator_class(self.stream, None) # type: ignore
self.iterator = (record for alignment in alignments for record in alignment)
def __next__(self):
return next(self.iterator)
for fmt, alignment_iterator_class in AlignIO._FormatToIterator.items():
name = fmt.replace("-", " ").title().replace(" ", "") + "AlignmentSequenceIterator"
cls = type(
name,
(AlignmentSequenceIterator,),
{
"fmt": fmt,
"_alignment_iterator_class": alignment_iterator_class,
},
)
_FormatToIterator[fmt] = cls
class AlignmentSequenceWriter(SequenceWriter):
"""Writes sequences as an alignment."""
modes = "t"
@property
@abstractmethod
def _alignment_writer_class(self):
"""Alignment writer class."""
def write_records(self, records):
"""Write records to the output file, and return the number of records.
records - A list or iterator returning SeqRecord objects
"""
from Bio.Align import MultipleSeqAlignment
alignment = MultipleSeqAlignment(records)
alignment_writer_class = self._alignment_writer_class
alignment_writer = alignment_writer_class(self.handle)
alignment_count = alignment_writer.write_file([alignment])
if alignment_count != 1:
raise RuntimeError(
"Internal error - the underlying writer "
"should have returned 1, not %r" % alignment_count
)
count = len(alignment)
return count
for fmt, alignment_writer_class in AlignIO._FormatToWriter.items():
name = fmt.replace("-", " ").title().replace(" ", "") + "AlignmentSequenceWriter"
cls = type(
name,
(AlignmentSequenceWriter,),
{"_alignment_writer_class": alignment_writer_class},
)
_FormatToWriter[fmt] = cls # type: ignore
del AlignIO
def write(
sequences: Iterable[SeqRecord] | SeqRecord,
handle: _TextIOSource,
format: str,
) -> int:
"""Write complete set of sequences to a file.
Arguments:
- sequences - A list (or iterator) of SeqRecord objects, or a single
SeqRecord.
- handle - File handle object to write to, or filename as string.
- format - lower case string describing the file format to write.
Note if providing a file handle, your code should close the handle
after calling this function (to ensure the data gets flushed to disk).
Returns the number of records written (as an integer).
"""
from Bio import AlignIO
# Try and give helpful error messages:
if not isinstance(format, str):
raise TypeError("Need a string for the file format (lower case)")
if not format:
raise ValueError("Format required (lower case string)")
if not format.islower():
raise ValueError(f"Format string '{format}' should be lower case")
if isinstance(handle, SeqRecord):
raise TypeError("Check arguments, handle should NOT be a SeqRecord")
if isinstance(handle, list):
# e.g. list of SeqRecord objects
raise TypeError("Check arguments, handle should NOT be a list")
if isinstance(sequences, SeqRecord):
# This raised an exception in older versions of Biopython
sequences = [sequences]
writer_class = _FormatToWriter.get(format)
if writer_class is not None:
count = writer_class(handle).write_file(sequences)
if not isinstance(count, int):
raise RuntimeError(
"Internal error - the underlying %s writer "
"should have returned the record count, not %r" % (format, count)
)
return count
if format in _FormatToIterator:
raise ValueError(f"Reading format '{format}' is supported, but not writing")
raise ValueError(f"Unknown format '{format}'")
def parse(handle, format, alphabet=None):
r"""Turn a sequence file into an iterator returning SeqRecords.
Arguments:
- handle - handle to the file, or the filename as a string
- format - lower case string describing the file format.
- alphabet - no longer used, should be None.
Typical usage, opening a file to read in, and looping over the record(s):
>>> from Bio import SeqIO
>>> filename = "Fasta/sweetpea.nu"
>>> for record in SeqIO.parse(filename, "fasta"):
... print("ID %s" % record.id)
... print("Sequence length %i" % len(record))
ID gi|3176602|gb|U78617.1|LOU78617
Sequence length 309
For lazy-loading file formats such as twobit, for which the file contents
is read on demand only, ensure that the file remains open while extracting
sequence data.
If you have a string 'data' containing the file contents, you must
first turn this into a handle in order to parse it:
>>> data = ">Alpha\nACCGGATGTA\n>Beta\nAGGCTCGGTTA\n"
>>> from Bio import SeqIO
>>> from io import StringIO
>>> for record in SeqIO.parse(StringIO(data), "fasta"):
... print("%s %s" % (record.id, record.seq))
Alpha ACCGGATGTA
Beta AGGCTCGGTTA
Use the Bio.SeqIO.read(...) function when you expect a single record
only.
"""
# NOTE - The above docstring has some raw \n characters needed
# for the StringIO example, hence the whole docstring is in raw
# string mode (see the leading r before the opening quote).
# Try and give helpful error messages:
if not isinstance(format, str):
raise TypeError("Need a string for the file format (lower case)")
if not format:
raise ValueError("Format required (lower case string)")
if not format.islower():
raise ValueError(f"Format string '{format}' should be lower case")
if alphabet is not None:
raise ValueError("The alphabet argument is no longer supported")
iterator_generator = _FormatToIterator.get(format)
if iterator_generator:
return iterator_generator(handle)
raise ValueError(f"Unknown format '{format}'")
def read(handle, format, alphabet=None):
"""Turn a sequence file into a single SeqRecord.
Arguments:
- handle - handle to the file, or the filename as a string
(note older versions of Biopython only took a handle).
- format - string describing the file format.
- alphabet - no longer used, should be None.
This function is for use parsing sequence files containing
exactly one record. For example, reading a GenBank file:
>>> from Bio import SeqIO
>>> record = SeqIO.read("GenBank/arab1.gb", "genbank")
>>> print("ID %s" % record.id)
ID AC007323.5
>>> print("Sequence length %i" % len(record))
Sequence length 86436
If the handle contains no records, or more than one record,
an exception is raised. For example:
>>> from Bio import SeqIO
>>> record = SeqIO.read("GenBank/cor6_6.gb", "genbank")
Traceback (most recent call last):
...
ValueError: More than one record found in handle
If however you want the first record from a file containing
multiple records this function would raise an exception (as
shown in the example above). Instead use:
>>> from Bio import SeqIO
>>> record = next(SeqIO.parse("GenBank/cor6_6.gb", "genbank"))
>>> print("First record's ID %s" % record.id)
First record's ID X55053.1
Use the Bio.SeqIO.parse(handle, format) function if you want
to read multiple records from the handle.
"""
with parse(handle, format, alphabet) as records:
try:
record = next(records)
except StopIteration:
raise ValueError("No records found in handle") from None
try:
next(records)
raise ValueError("More than one record found in handle")
except StopIteration:
pass
return record
def to_dict(sequences, key_function=None):
"""Turn a sequence iterator or list into a dictionary.
Arguments:
- sequences - An iterator that returns SeqRecord objects,
or simply a list of SeqRecord objects.
- key_function - Optional callback function which when given a
SeqRecord should return a unique key for the dictionary.
e.g. key_function = lambda rec : rec.name
or, key_function = lambda rec : rec.description.split()[0]
If key_function is omitted then record.id is used, on the assumption
that the records objects returned are SeqRecords with a unique id.
If there are duplicate keys, an error is raised.
Since Python 3.7, the default dict class maintains key order, meaning
this dictionary will reflect the order of records given to it. For
CPython and PyPy, this was already implemented for Python 3.6, so
effectively you can always assume the record order is preserved.
Example usage, defaulting to using the record.id as key:
>>> from Bio import SeqIO
>>> filename = "GenBank/cor6_6.gb"
>>> format = "genbank"
>>> id_dict = SeqIO.to_dict(SeqIO.parse(filename, format))
>>> print(list(id_dict))
['X55053.1', 'X62281.1', 'M81224.1', 'AJ237582.1', 'L31939.1', 'AF297471.1']
>>> print(id_dict["L31939.1"].description)
Brassica rapa (clone bif72) kin mRNA, complete cds
A more complex example, using the key_function argument in order to
use a sequence checksum as the dictionary key:
>>> from Bio import SeqIO
>>> from Bio.SeqUtils.CheckSum import seguid
>>> filename = "GenBank/cor6_6.gb"
>>> format = "genbank"
>>> seguid_dict = SeqIO.to_dict(SeqIO.parse(filename, format),
... key_function = lambda rec : seguid(rec.seq))
>>> for key, record in sorted(seguid_dict.items()):
... print("%s %s" % (key, record.id))
/wQvmrl87QWcm9llO4/efg23Vgg AJ237582.1
BUg6YxXSKWEcFFH0L08JzaLGhQs L31939.1
SabZaA4V2eLE9/2Fm5FnyYy07J4 X55053.1
TtWsXo45S3ZclIBy4X/WJc39+CY M81224.1
l7gjJFE6W/S1jJn5+1ASrUKW/FA X62281.1
uVEYeAQSV5EDQOnFoeMmVea+Oow AF297471.1
This approach is not suitable for very large sets of sequences, as all
the SeqRecord objects are held in memory. Instead, consider using the
Bio.SeqIO.index() function (if it supports your particular file format).
This dictionary will reflect the order of records given to it.
"""
# This is to avoid a lambda function:
def _default_key_function(rec):
return rec.id
if key_function is None:
key_function = _default_key_function
d = {}
for record in sequences:
key = key_function(record)
if key in d:
raise ValueError(f"Duplicate key '{key}'")
d[key] = record
return d
def index(filename, format, alphabet=None, key_function=None):
"""Indexes a sequence file and returns a dictionary like object.
Arguments:
- filename - string giving name of file to be indexed
- format - lower case string describing the file format
- alphabet - no longer used, leave as None
- key_function - Optional callback function which when given a
SeqRecord identifier string should return a unique key for the
dictionary.
This indexing function will return a dictionary like object, giving the
SeqRecord objects as values.
As of Biopython 1.69, this will preserve the ordering of the records in
file when iterating over the entries.
>>> from Bio import SeqIO
>>> records = SeqIO.index("Quality/example.fastq", "fastq")
>>> len(records)
3
>>> list(records) # make a list of the keys
['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_540_792', 'EAS54_6_R1_2_1_443_348']
>>> print(records["EAS54_6_R1_2_1_540_792"].format("fasta"))
>EAS54_6_R1_2_1_540_792
TTGGCAGGCCAAGGCCGATGGATCA
<BLANKLINE>
>>> "EAS54_6_R1_2_1_540_792" in records
True
>>> print(records.get("Missing", None))
None
>>> records.close()
If the file is BGZF compressed, this is detected automatically. Ordinary
GZIP files are not supported:
>>> from Bio import SeqIO
>>> records = SeqIO.index("Quality/example.fastq.bgz", "fastq")
>>> len(records)
3
>>> print(records["EAS54_6_R1_2_1_540_792"].seq)
TTGGCAGGCCAAGGCCGATGGATCA
>>> records.close()
When you call the index function, it will scan through the file, noting
the location of each record. When you access a particular record via the
dictionary methods, the code will jump to the appropriate part of the
file and then parse that section into a SeqRecord.
Note that not all the input formats supported by Bio.SeqIO can be used
with this index function. It is designed to work only with sequential
file formats (e.g. "fasta", "gb", "fastq") and is not suitable for any
interlaced file format (e.g. alignment formats such as "clustal").
For small files, it may be more efficient to use an in memory Python
dictionary, e.g.
>>> from Bio import SeqIO
>>> records = SeqIO.to_dict(SeqIO.parse("Quality/example.fastq", "fastq"))
>>> len(records)
3
>>> list(records) # make a list of the keys
['EAS54_6_R1_2_1_413_324', 'EAS54_6_R1_2_1_540_792', 'EAS54_6_R1_2_1_443_348']
>>> print(records["EAS54_6_R1_2_1_540_792"].format("fasta"))
>EAS54_6_R1_2_1_540_792
TTGGCAGGCCAAGGCCGATGGATCA
<BLANKLINE>
As with the to_dict() function, by default the id string of each record
is used as the key. You can specify a callback function to transform
this (the record identifier string) into your preferred key. For example:
>>> from Bio import SeqIO
>>> def make_tuple(identifier):
... parts = identifier.split("_")
... return int(parts[-2]), int(parts[-1])
>>> records = SeqIO.index("Quality/example.fastq", "fastq",
... key_function=make_tuple)
>>> len(records)
3
>>> list(records) # make a list of the keys
[(413, 324), (540, 792), (443, 348)]
>>> print(records[(540, 792)].format("fasta"))
>EAS54_6_R1_2_1_540_792
TTGGCAGGCCAAGGCCGATGGATCA
<BLANKLINE>
>>> (540, 792) in records
True
>>> "EAS54_6_R1_2_1_540_792" in records
False
>>> print(records.get("Missing", None))
None
>>> records.close()
Another common use case would be indexing an NCBI style FASTA file,
where you might want to extract the GI number from the FASTA identifier
to use as the dictionary key.
Notice that unlike the to_dict() function, here the key_function does
not get given the full SeqRecord to use to generate the key. Doing so
would impose a severe performance penalty as it would require the file
to be completely parsed while building the index. Right now this is
usually avoided.
See Also: Bio.SeqIO.index_db() and Bio.SeqIO.to_dict()
"""
# Try and give helpful error messages:
if not isinstance(format, str):
raise TypeError("Need a string for the file format (lower case)")
if not format:
raise ValueError("Format required (lower case string)")
if not format.islower():
raise ValueError(f"Format string '{format}' should be lower case")
if alphabet is not None:
raise ValueError("The alphabet argument is no longer supported")
# Map the file format to a sequence iterator:
from Bio.File import _IndexedSeqFileDict
from ._index import _FormatToRandomAccess # Lazy import
try:
proxy_class = _FormatToRandomAccess[format]
except KeyError:
raise ValueError(f"Unsupported format {format!r}") from None
repr = "SeqIO.index(%r, %r, alphabet=%r, key_function=%r)" % (
filename,
format,
alphabet,
key_function,
)
try:
random_access_proxy = proxy_class(filename, format)
except TypeError:
raise TypeError(
"Need a string or path-like object for the filename (not a handle)"
) from None
return _IndexedSeqFileDict(random_access_proxy, key_function, repr, "SeqRecord")
def index_db(
index_filename, filenames=None, format=None, alphabet=None, key_function=None
):
"""Index several sequence files and return a dictionary like object.
The index is stored in an SQLite database rather than in memory (as in the
Bio.SeqIO.index(...) function).
Arguments:
- index_filename - Where to store the SQLite index
- filenames - list of strings specifying file(s) to be indexed, or when
indexing a single file this can be given as a string.
(optional if reloading an existing index, but must match)
- format - lower case string describing the file format
(optional if reloading an existing index, but must match)
- alphabet - no longer used, leave as None.
- key_function - Optional callback function which when given a
SeqRecord identifier string should return a unique
key for the dictionary.
This indexing function will return a dictionary like object, giving the
SeqRecord objects as values:
>>> from Bio import SeqIO
>>> files = ["GenBank/NC_000932.faa", "GenBank/NC_005816.faa"]
>>> def get_gi(name):
... parts = name.split("|")
... i = parts.index("gi")
... assert i != -1
... return parts[i+1]
>>> idx_name = ":memory:" #use an in memory SQLite DB for this test
>>> records = SeqIO.index_db(idx_name, files, "fasta", key_function=get_gi)
>>> len(records)
95
>>> records["7525076"].description
'gi|7525076|ref|NP_051101.1| Ycf2 [Arabidopsis thaliana]'
>>> records["45478717"].description
'gi|45478717|ref|NP_995572.1| pesticin [Yersinia pestis biovar Microtus str. 91001]'
>>> records.close()
In this example the two files contain 85 and 10 records respectively.
BGZF compressed files are supported, and detected automatically. Ordinary
GZIP compressed files are not supported.
See Also: Bio.SeqIO.index() and Bio.SeqIO.to_dict(), and the Python module
glob which is useful for building lists of files.
"""
from os import fspath
def is_pathlike(obj):
"""Test if the given object can be accepted as a path."""
try:
fspath(obj)
return True
except TypeError:
return False
# Try and give helpful error messages:
if not is_pathlike(index_filename):
raise TypeError("Need a string or path-like object for filename (not a handle)")
if is_pathlike(filenames):
# Make the API a little more friendly, and more similar
# to Bio.SeqIO.index(...) for indexing just one file.
filenames = [filenames]
if filenames is not None and not isinstance(filenames, list):
raise TypeError(
"Need a list of filenames (as strings or path-like "
"objects), or one filename"
)
if format is not None and not isinstance(format, str):
raise TypeError("Need a string for the file format (lower case)")
if format and not format.islower():
raise ValueError(f"Format string '{format}' should be lower case")
if alphabet is not None:
raise ValueError("The alphabet argument is no longer supported")
# Map the file format to a sequence iterator:
from Bio.File import _SQLiteManySeqFilesDict
from ._index import _FormatToRandomAccess # Lazy import
repr = "SeqIO.index_db(%r, filenames=%r, format=%r, key_function=%r)" % (
index_filename,
filenames,
format,
key_function,
)
def proxy_factory(format, filename=None):
"""Given a filename returns proxy object, else boolean if format OK."""
if filename:
return _FormatToRandomAccess[format](filename, format)
else:
return format in _FormatToRandomAccess
return _SQLiteManySeqFilesDict(
index_filename, filenames, proxy_factory, format, key_function, repr
)
# TODO? - Handling aliases explicitly would let us shorten this list:
_converter = {
("genbank", "fasta"): InsdcIO._genbank_convert_fasta,
("gb", "fasta"): InsdcIO._genbank_convert_fasta,
("embl", "fasta"): InsdcIO._embl_convert_fasta,
("fastq", "fasta"): QualityIO._fastq_convert_fasta,
("fastq-sanger", "fasta"): QualityIO._fastq_convert_fasta,
("fastq-solexa", "fasta"): QualityIO._fastq_convert_fasta,
("fastq-illumina", "fasta"): QualityIO._fastq_convert_fasta,
("fastq", "tab"): QualityIO._fastq_convert_tab,
("fastq-sanger", "tab"): QualityIO._fastq_convert_tab,
("fastq-solexa", "tab"): QualityIO._fastq_convert_tab,
("fastq-illumina", "tab"): QualityIO._fastq_convert_tab,
("fastq", "fastq"): QualityIO._fastq_sanger_convert_fastq_sanger,
("fastq-sanger", "fastq"): QualityIO._fastq_sanger_convert_fastq_sanger,
("fastq-solexa", "fastq"): QualityIO._fastq_solexa_convert_fastq_sanger,
("fastq-illumina", "fastq"): QualityIO._fastq_illumina_convert_fastq_sanger,
("fastq", "fastq-sanger"): QualityIO._fastq_sanger_convert_fastq_sanger,
("fastq-sanger", "fastq-sanger"): QualityIO._fastq_sanger_convert_fastq_sanger,
("fastq-solexa", "fastq-sanger"): QualityIO._fastq_solexa_convert_fastq_sanger,
("fastq-illumina", "fastq-sanger"): QualityIO._fastq_illumina_convert_fastq_sanger,
("fastq", "fastq-solexa"): QualityIO._fastq_sanger_convert_fastq_solexa,
("fastq-sanger", "fastq-solexa"): QualityIO._fastq_sanger_convert_fastq_solexa,
("fastq-solexa", "fastq-solexa"): QualityIO._fastq_solexa_convert_fastq_solexa,
("fastq-illumina", "fastq-solexa"): QualityIO._fastq_illumina_convert_fastq_solexa,
("fastq", "fastq-illumina"): QualityIO._fastq_sanger_convert_fastq_illumina,
("fastq-sanger", "fastq-illumina"): QualityIO._fastq_sanger_convert_fastq_illumina,
("fastq-solexa", "fastq-illumina"): QualityIO._fastq_solexa_convert_fastq_illumina,
(
"fastq-illumina",
"fastq-illumina",
): QualityIO._fastq_illumina_convert_fastq_illumina,
("fastq", "qual"): QualityIO._fastq_sanger_convert_qual,
("fastq-sanger", "qual"): QualityIO._fastq_sanger_convert_qual,
("fastq-solexa", "qual"): QualityIO._fastq_solexa_convert_qual,
("fastq-illumina", "qual"): QualityIO._fastq_illumina_convert_qual,
}
def convert(in_file, in_format, out_file, out_format, molecule_type=None):
"""Convert between two sequence file formats, return number of records.
Arguments:
- in_file - an input handle or filename
- in_format - input file format, lower case string
- out_file - an output handle or filename
- out_format - output file format, lower case string
- molecule_type - optional molecule type to apply, string containing
"DNA", "RNA" or "protein".
**NOTE** - If you provide an output filename, it will be opened which will
overwrite any existing file without warning.
The idea here is that while doing this will work::
from Bio import SeqIO
records = SeqIO.parse(in_handle, in_format)
count = SeqIO.write(records, out_handle, out_format)
it is shorter to write::
from Bio import SeqIO
count = SeqIO.convert(in_handle, in_format, out_handle, out_format)
Also, Bio.SeqIO.convert is faster for some conversions as it can make some
optimisations.
For example, going from a filename to a handle:
>>> from Bio import SeqIO
>>> from io import StringIO
>>> handle = StringIO("")
>>> SeqIO.convert("Quality/example.fastq", "fastq", handle, "fasta")
3
>>> print(handle.getvalue())
>EAS54_6_R1_2_1_413_324
CCCTTCTTGTCTTCAGCGTTTCTCC
>EAS54_6_R1_2_1_540_792
TTGGCAGGCCAAGGCCGATGGATCA
>EAS54_6_R1_2_1_443_348
GTTGCTTCTGGCGTGGGTGGGGGGG
<BLANKLINE>
Note some formats like SeqXML require you to specify the molecule type
when it cannot be determined by the parser:
>>> from Bio import SeqIO
>>> from io import BytesIO
>>> handle = BytesIO()
>>> SeqIO.convert("Quality/example.fastq", "fastq", handle, "seqxml", "DNA")
3
"""
if molecule_type:
if not isinstance(molecule_type, str):
raise TypeError(f"Molecule type should be a string, not {molecule_type!r}")
elif (
"DNA" in molecule_type
or "RNA" in molecule_type
or "protein" in molecule_type
):
pass
else:
raise ValueError(f"Unexpected molecule type, {molecule_type!r}")
f = _converter.get((in_format, out_format))
if f:
count = f(in_file, out_file)
else:
records = parse(in_file, in_format)
if molecule_type:
# Edit the records on the fly to set molecule type
def over_ride(record):
"""Over-ride molecule in-place."""
record.annotations["molecule_type"] = molecule_type
return record
records = (over_ride(_) for _ in records)
count = write(records, out_file, out_format)
return count
if __name__ == "__main__":
from Bio._utils import run_doctest
run_doctest()
|