1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011
|
.. _`chapter:blast`:
BLAST (new)
===========
Hey, everybody loves BLAST right? I mean, geez, how can it get any
easier to do comparisons between one of your sequences and every other
sequence in the known world? But, of course, this section isn’t about
how cool BLAST is, since we already know that. It is about the problem
with BLAST – it can be really difficult to deal with the volume of data
generated by large runs, and to automate BLAST runs in general.
Fortunately, the Biopython folks know this only too well, so they’ve
developed lots of tools for dealing with BLAST and making things much
easier. This section details how to use these tools and do useful things
with them.
Dealing with BLAST can be split up into two steps, both of which can be
done from within Biopython. Firstly, running BLAST for your query
sequence(s), and getting some output. Secondly, parsing the BLAST output
in Python for further analysis.
Your first introduction to running BLAST was probably via the `NCBI
BLAST web page <https://blast.ncbi.nlm.nih.gov/Blast.cgi>`__. In fact,
there are lots of ways you can run BLAST, which can be categorized in
several ways. The most important distinction is running BLAST locally
(on your own machine), and running BLAST remotely (on another machine,
typically the NCBI servers). We’re going to start this chapter by
invoking the NCBI online BLAST service from within a Python script.
.. _`sec:running-www-blast`:
Running BLAST over the Internet
-------------------------------
We use the function ``qblast`` in the ``Bio.Blast`` module to call the
online version of BLAST.
The `NCBI
guidelines <https://blast.ncbi.nlm.nih.gov/doc/blast-help/developerinfo.html#developerinfo>`__
state:
#. Do not contact the server more often than once every 10 seconds.
#. Do not poll for any single RID more often than once a minute.
#. Use the URL parameter email and tool, so that the NCBI can contact
you if there is a problem.
#. Run scripts weekends or between 9 pm and 5 am Eastern time on
weekdays if more than 50 searches will be submitted.
``Blast.qblast`` follows the first two points automatically. To fulfill
the third point, set the ``Blast.email`` variable (the ``Blast.tool``
variable is already set to ``"biopython"`` by default):
.. doctest
.. code:: pycon
>>> from Bio import Blast
>>> Blast.tool
'biopython'
>>> Blast.email = "A.N.Other@example.com"
.. _`subsec:blast-arguments`:
BLAST arguments
~~~~~~~~~~~~~~~
The ``qblast`` function has three non-optional arguments:
- The first argument is the BLAST program to use for the search, as a
lower case string. The programs and their options are described at
the `NCBI BLAST web
page <https://blast.ncbi.nlm.nih.gov/Blast.cgi>`__. Currently
``qblast`` only works with blastn, blastp, blastx, tblast and
tblastx.
- The second argument specifies the databases to search against. Again,
the options for this are available on `NCBI’s BLAST Help
pages <https://blast.ncbi.nlm.nih.gov/doc/blast-help/>`__.
- The third argument is a string containing your query sequence. This
can either be the sequence itself, the sequence in fasta format, or
an identifier like a GI number.
The ``qblast`` function also takes a number of other option arguments,
which are basically analogous to the different parameters you can set on
the BLAST web page. We’ll just highlight a few of them here:
- The argument ``url_base`` sets the base URL for running BLAST over
the internet. By default it connects to the NCBI.
- The ``qblast`` function can return the BLAST results in various
formats, which you can choose with the optional ``format_type``
keyword: ``"XML"``, ``"HTML"``, ``"Text"``, ``"XML2"``, ``"JSON2"``,
or ``"Tabular"``. The default is ``"XML"``, as that is the format
expected by the parser, described in
section :ref:`sec:parsing-blast` below.
- The argument ``expect`` sets the expectation or e-value threshold.
For more about the optional BLAST arguments, we refer you to the NCBI’s
own documentation, or that built into Biopython:
.. code:: pycon
>>> from Bio import Blast
>>> help(Blast.qblast)
Note that the default settings on the NCBI BLAST website are not quite
the same as the defaults on QBLAST. If you get different results, you’ll
need to check the parameters (e.g., the expectation value threshold and
the gap values).
For example, if you have a nucleotide sequence you want to search
against the nucleotide database (nt) using BLASTN, and you know the GI
number of your query sequence, you can use:
.. code:: pycon
>>> from Bio import Blast
>>> result_stream = Blast.qblast("blastn", "nt", "8332116")
Alternatively, if we have our query sequence already in a FASTA
formatted file, we just need to open the file and read in this record as
a string, and use that as the query argument:
.. code:: pycon
>>> from Bio import Blast
>>> fasta_string = open("m_cold.fasta").read()
>>> result_stream = Blast.qblast("blastn", "nt", fasta_string)
We could also have read in the FASTA file as a ``SeqRecord`` and then
supplied just the sequence itself:
.. code:: pycon
>>> from Bio import Blast
>>> from Bio import SeqIO
>>> record = SeqIO.read("m_cold.fasta", "fasta")
>>> result_stream = Blast.qblast("blastn", "nt", record.seq)
Supplying just the sequence means that BLAST will assign an identifier
for your sequence automatically. You might prefer to call ``format`` on
the ``SeqRecord`` object to make a FASTA string (which will include the
existing identifier):
.. code:: pycon
>>> from Bio import Blast
>>> from Bio import SeqIO
>>> records = SeqIO.parse("ls_orchid.gbk", "genbank")
>>> record = next(records)
>>> result_stream = Blast.qblast("blastn", "nt", format(record, "fasta"))
This approach makes more sense if you have your sequence(s) in a
non-FASTA file format which you can extract using ``Bio.SeqIO`` (see
Chapter :ref:`chapter:seqio`).
.. _`subsec:saving-blast-results`:
Saving BLAST results
~~~~~~~~~~~~~~~~~~~~
Whatever arguments you give the ``qblast()`` function, you should get
back your results as a stream of ``bytes`` data (by default in XML
format). The next step would be to parse the XML output into Python
objects representing the search results
(Section :ref:`sec:parsing-blast`), but you might want to save a
local copy of the output file first. I find this especially useful when
debugging my code that extracts info from the BLAST results (because
re-running the online search is slow and wastes the NCBI computer time).
We need to be a bit careful since we can use ``result_stream.read()`` to
read the BLAST output only once – calling ``result_stream.read()`` again
returns an empty ``bytes`` object.
.. code:: pycon
>>> with open("my_blast.xml", "wb") as out_stream:
... out_stream.write(result_stream.read())
...
>>> result_stream.close()
After doing this, the results are in the file ``my_blast.xml`` and
``result_stream`` has had all its data extracted (so we closed it).
However, the ``parse`` function of the BLAST parser (described
in :ref:`sec:parsing-blast`) takes a file-like object, so we can
just open the saved file for input as ``bytes``:
.. code:: pycon
>>> result_stream = open("my_blast.xml", "rb")
Now that we’ve got the BLAST results back into a data stream again, we
are ready to do something with them, so this leads us right into the
parsing section (see Section :ref:`sec:parsing-blast` below). You
may want to jump ahead to that now ….
.. _`subsec:blast-other-formats`:
Obtaining BLAST output in other formats
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
By using the ``format_type`` argument when calling ``qblast``, you can
obtain BLAST output in formats other than XML. Below is an example of
reading BLAST output in JSON format. Using ``format_type="JSON2"``, the
data provided by ``Blast.qblast`` will be in zipped JSON format:
.. code:: pycon
>>> from Bio import Blast
>>> from Bio import SeqIO
>>> record = SeqIO.read("m_cold.fasta", "fasta")
>>> result_stream = Blast.qblast("blastn", "nt", record.seq, format_type="JSON2")
>>> data = result_stream.read()
>>> data[:4]
b'PK\x03\x04'
which is the ZIP file magic number.
.. code:: pycon
>>> with open("myzipfile.zip", "wb") as out_stream:
... out_stream.write(data)
...
13813
Note that we read and write the data as ``bytes``. Now open the ZIP file
we created:
.. code:: pycon
>>> import zipfile
>>> myzipfile = zipfile.ZipFile("myzipfile.zip")
>>> myzipfile.namelist()
['N5KN7UMJ013.json', 'N5KN7UMJ013_1.json']
>>> stream = myzipfile.open("N5KN7UMJ013.json")
>>> data = stream.read()
These data are ``bytes``, so we need to decode them to get a string
object:
.. code:: pycon
>>> data = data.decode()
>>> print(data)
{
"BlastJSON": [
{"File": "N5KN7UMJ013_1.json" }
]
}
Now open the second file contained in the ZIP file to get the BLAST
results in JSON format:
.. code:: pycon
>>> stream = myzipfile.open("N5KN7UMJ013_1.json")
>>> data = stream.read()
>>> len(data)
145707
>>> data = data.decode()
>>> print(data)
{
"BlastOutput2": {
"report": {
"program": "blastn",
"version": "BLASTN 2.14.1+",
"reference": "Stephen F. Altschul, Thomas L. Madden, Alejandro A. ...
"search_target": {
"db": "nt"
},
"params": {
"expect": 10,
"sc_match": 2,
"sc_mismatch": -3,
"gap_open": 5,
"gap_extend": 2,
"filter": "L;m;"
},
"results": {
"search": {
"query_id": "Query_69183",
"query_len": 1111,
"query_masking": [
{
"from": 797,
"to": 1110
}
],
"hits": [
{
"num": 1,
"description": [
{
"id": "gi|1219041180|ref|XM_021875076.1|",
...
We can use the JSON parser in Python’s standard library to convert the
JSON data into a regular Python dictionary:
.. code:: pycon
>>> import json
>>> d = json.loads(data)
>>> print(d)
{'BlastOutput2': {'report': {'program': 'blastn', 'version': 'BLASTN 2.14.1+',
'reference': 'Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search programs",
Nucleic Acids Res. 25:3389-3402.',
'search_target': {'db': 'nt'}, 'params': {'expect': 10, 'sc_match': 2,
'sc_mismatch': -3, 'gap_open': 5, 'gap_extend': 2, 'filter': 'L;m;'},
'results': {'search': {'query_id': 'Query_128889', 'query_len': 1111,
'query_masking': [{'from': 797, 'to': 1110}], 'hits': [{'num': 1,
'description': [{'id': 'gi|1219041180|ref|XM_021875076.1|', 'accession':
'XM_021875076', 'title':
'PREDICTED: Chenopodium quinoa cold-regulated 413 plasma membrane protein 2-like (LOC110697660), mRNA',
'taxid': 63459, 'sciname': 'Chenopodium quinoa'}], 'len': 1173, 'hsps':
[{'num': 1, 'bit_score': 435.898, 'score': 482, 'evalue': 9.02832e-117,
'identity': 473, 'query_from'
...
.. _`sec:running-local-blast`:
Running BLAST locally
---------------------
Introduction
~~~~~~~~~~~~
Running BLAST locally (as opposed to over the internet, see
Section :ref:`sec:running-www-blast`) has at least major two
advantages:
- Local BLAST may be faster than BLAST over the internet;
- Local BLAST allows you to make your own database to search for
sequences against.
Dealing with proprietary or unpublished sequence data can be another
reason to run BLAST locally. You may not be allowed to redistribute the
sequences, so submitting them to the NCBI as a BLAST query would not be
an option.
Unfortunately, there are some major drawbacks too – installing all the
bits and getting it setup right takes some effort:
- Local BLAST requires command line tools to be installed.
- Local BLAST requires (large) BLAST databases to be setup (and
potentially kept up to date).
Standalone NCBI BLAST+
~~~~~~~~~~~~~~~~~~~~~~
The “new” `NCBI
BLAST+ <https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=Download>`__
suite was released in 2009. This replaces the old NCBI “legacy” BLAST
package (see :ref:`subsec:other-blast-versions`).
This section will show briefly how to use these tools from within
Python. If you have already read or tried the alignment tool examples in
Section :ref:`sec:alignment-tools` this should all
seem quite straightforward. First, we construct a command line string
(as you would type in at the command line prompt if running standalone
BLAST by hand). Then we can execute this command from within Python.
For example, taking a FASTA file of gene nucleotide sequences, you might
want to run a BLASTX (translation) search against the non-redundant (NR)
protein database. Assuming you (or your systems administrator) has
downloaded and installed the NR database, you might run:
.. code:: console
$ blastx -query opuntia.fasta -db nr -out opuntia.xml -evalue 0.001 -outfmt 5
This should run BLASTX against the NR database, using an expectation
cut-off value of :math:`0.001` and produce XML output to the specified
file (which we can then parse). On my computer this takes about six
minutes - a good reason to save the output to a file so you can repeat
any analysis as needed.
From within python we can use the ``subprocess`` module to build the
command line string, and run it:
.. code:: pycon
>>> import subprocess
>>> cmd = "blastx -query opuntia.fasta -db nr -out opuntia.xml"
>>> cmd += " -evalue 0.001 -outfmt 5"
>>> subprocess.run(cmd, shell=True)
In this example there shouldn’t be any output from BLASTX to the
terminal. You may want to check the output file ``opuntia.xml`` has been
created.
As you may recall from earlier examples in the tutorial, the
``opuntia.fasta`` contains seven sequences, so the BLAST XML output
should contain multiple results. Therefore use ``Bio.Blast.parse()`` to
parse it as described below in Section :ref:`sec:parsing-blast`.
.. _`subsec:other-blast-versions`:
Other versions of BLAST
~~~~~~~~~~~~~~~~~~~~~~~
NCBI BLAST+ (written in C++) was first released in 2009 as a replacement
for the original NCBI “legacy” BLAST (written in C) which is no longer
being updated. You may also come across `Washington University
BLAST <http://blast.wustl.edu/>`__ (WU-BLAST), and its successor,
`Advanced Biocomputing BLAST <https://blast.advbiocomp.com>`__
(AB-BLAST, released in 2009, not free/open source). These packages
include the command line tools ``wu-blastall`` and ``ab-blastall``,
which mimicked ``blastall`` from the NCBI “legacy” BLAST suite.
Biopython does not currently provide wrappers for calling these tools,
but should be able to parse any NCBI compatible output from them.
.. _`sec:parsing-blast`:
Parsing BLAST output
--------------------
As mentioned above, BLAST can generate output in various formats, such as XML,
HTML, and plain text. Originally, Biopython had parsers for BLAST plain text
and HTML output, as these were the only output formats offered at the time.
These parsers have now been removed from Biopython, as the BLAST output in
these formats kept changing, each time breaking the Biopython parsers.
Nowadays, Biopython can parse BLAST output in the XML format, the XML2 format,
and tabular format. This chapter describes the parser for BLAST output in the
XML and XML2 formats using the ``Bio.Blast.parse`` function. This function
automatically detects if the XML file is in the XML format or in the XML2
format.
BLAST output in tabular format can be parsed as alignments using the
``Bio.Align.parse`` function (see the section :ref:`subsec:align_tabular`).
You can get BLAST output in XML format in various ways. For the parser,
it doesn’t matter how the output was generated, as long as it is in the
XML format.
- You can use Biopython to run BLAST over the internet, as described in
section :ref:`sec:running-www-blast`.
- You can use Biopython to run BLAST locally, as described in
section :ref:`sec:running-local-blast`.
- You can do the BLAST search yourself on the NCBI site through your
web browser, and then save the results. You need to choose XML as the
format in which to receive the results, and save the final BLAST page
you get (you know, the one with all of the interesting results!) to a
file.
- You can also run BLAST locally without using Biopython, and save the
output in a file. Again, you need to choose XML as the format in
which to receive the results.
The important point is that you do not have to use Biopython scripts to
fetch the data in order to be able to parse it. Doing things in one of
these ways, you then need to get a file-like object to the results. In
Python, a file-like object or handle is just a nice general way of
describing input to any info source so that the info can be retrieved
using ``read()`` and ``readline()`` functions (see
Section :ref:`sec:appendix-handles`).
If you followed the code above for interacting with BLAST through a
script, then you already have ``result_stream``, the file-like object to
the BLAST results. For example, using a GI number to do an online
search:
.. code:: pycon
>>> from Bio import Blast
>>> result_stream = Blast.qblast("blastn", "nt", "8332116")
If instead you ran BLAST some other way, and have the BLAST output (in
XML format) in the file ``my_blast.xml``, all you need to do is to open
the file for reading (as ``bytes``):
.. code:: pycon
>>> result_stream = open("my_blast.xml", "rb")
Now that we’ve got a data stream, we are ready to parse the output. The
code to parse it is really quite small. If you expect a single BLAST
result (i.e., you used a single query):
.. code:: pycon
>>> from Bio import Blast
>>> blast_record = Blast.read(result_stream)
or, if you have lots of results (i.e., multiple query sequences):
.. code:: pycon
>>> from Bio import Blast
>>> blast_records = Blast.parse(result_stream)
Just like ``Bio.SeqIO`` and ``Bio.Align`` (see
Chapters :ref:`chapter:seqio`
and :ref:`chapter:align`), we have a pair of input
functions, ``read`` and ``parse``, where ``read`` is for when you have
exactly one object, and ``parse`` is an iterator for when you can have
lots of objects – but instead of getting ``SeqRecord`` or ``Alignment``
objects, we get BLAST record objects.
To be able to handle the situation where the BLAST file may be huge,
containing thousands of results, ``Blast.parse()`` returns an iterator.
In plain English, an iterator allows you to step through the BLAST
output, retrieving BLAST records one by one for each BLAST search
result:
.. code:: pycon
>>> from Bio import Blast
>>> blast_records = Blast.parse(result_stream)
>>> blast_record = next(blast_records)
# ... do something with blast_record
>>> blast_record = next(blast_records)
# ... do something with blast_record
>>> blast_record = next(blast_records)
# ... do something with blast_record
>>> blast_record = next(blast_records)
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
StopIteration
# No further records
Or, you can use a ``for``-loop:
.. code:: pycon
>>> for blast_record in blast_records:
... pass # Do something with blast_record
...
Note though that you can step through the BLAST records only once.
Usually, from each BLAST record you would save the information that you
are interested in.
Alternatively, you can use ``blast_records`` as a list, for example by
extracting one record by index, or by calling ``len`` or ``print`` on
``blast_records``. The parser will then automatically iterate over the records
and store them:
.. doctest ../Tests/Blast
.. code:: pycon
>>> from Bio import Blast
>>> blast_records = Blast.parse("xml_2222_blastx_001.xml")
>>> len(blast_records) # this causes the parser to iterate over all records
7
>>> blast_records[2].query.description
'gi|5690369|gb|AF158246.1|AF158246 Cricetulus griseus glucose phosphate isomerase (GPI) gene, partial intron sequence'
If your BLAST file is huge though, you may run into memory problems
trying to save them all in a list.
If you start iterating over the records *before* using ``blast_records`` as
a list, the parser will first reset the file stream to the beginning of the
data to ensure that all records are neing read. Note that this will fail if the
stream cannot be reset to the beginning, for example if the data are being
read remotely (e.g. by qblast; see subsection :ref:`sec:running-www-blast`).
In those cases, you can explicitly read the records into a list by calling
``blast_records = blast_records[:]`` before iterating over them. After reading
in the records, it is safe to iterate over them or use them as a list.
Instead of opening the file yourself, you can just provide the file
name:
.. doctest examples
.. code:: pycon
>>> from Bio import Blast
>>> with Blast.parse("my_blast.xml") as blast_records:
... for blast_record in blast_records:
... pass # Do something with blast_record
...
In this case, Biopython opens the file for you, and closes it as soon as
the file is not needed any more (while it is possible to simply use
``blast_records = Blast.parse("my_blast.xml")``, it has the disadvantage
that the file may stay open longer than strictly necessary, thereby
wasting resources).
You can ``print`` the records to get a quick overview of their contents:
.. doctest examples
.. code:: pycon
>>> from Bio import Blast
>>> with Blast.parse("my_blast.xml") as blast_records:
... print(blast_records)
...
Program: BLASTN 2.2.27+
db: refseq_rna
<BLANKLINE>
Query: 42291 (length=61)
mystery_seq
Hits: ---- ----- ----------------------------------------------------------
# # HSP ID + description
---- ----- ----------------------------------------------------------
0 1 gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 52...
1 1 gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA...
2 1 gi|270133242|ref|NR_032573.1| Macaca mulatta microRNA ...
3 2 gi|301171322|ref|NR_035857.1| Pan troglodytes microRNA...
4 1 gi|301171267|ref|NR_035851.1| Pan troglodytes microRNA...
5 2 gi|262205330|ref|NR_030198.1| Homo sapiens microRNA 52...
6 1 gi|262205302|ref|NR_030191.1| Homo sapiens microRNA 51...
7 1 gi|301171259|ref|NR_035850.1| Pan troglodytes microRNA...
8 1 gi|262205451|ref|NR_030222.1| Homo sapiens microRNA 51...
9 2 gi|301171447|ref|NR_035871.1| Pan troglodytes microRNA...
10 1 gi|301171276|ref|NR_035852.1| Pan troglodytes microRNA...
11 1 gi|262205290|ref|NR_030188.1| Homo sapiens microRNA 51...
12 1 gi|301171354|ref|NR_035860.1| Pan troglodytes microRNA...
13 1 gi|262205281|ref|NR_030186.1| Homo sapiens microRNA 52...
14 2 gi|262205298|ref|NR_030190.1| Homo sapiens microRNA 52...
15 1 gi|301171394|ref|NR_035865.1| Pan troglodytes microRNA...
16 1 gi|262205429|ref|NR_030218.1| Homo sapiens microRNA 51...
17 1 gi|262205423|ref|NR_030217.1| Homo sapiens microRNA 52...
18 1 gi|301171401|ref|NR_035866.1| Pan troglodytes microRNA...
19 1 gi|270133247|ref|NR_032574.1| Macaca mulatta microRNA ...
20 1 gi|262205309|ref|NR_030193.1| Homo sapiens microRNA 52...
21 2 gi|270132717|ref|NR_032716.1| Macaca mulatta microRNA ...
22 2 gi|301171437|ref|NR_035870.1| Pan troglodytes microRNA...
23 2 gi|270133306|ref|NR_032587.1| Macaca mulatta microRNA ...
24 2 gi|301171428|ref|NR_035869.1| Pan troglodytes microRNA...
25 1 gi|301171211|ref|NR_035845.1| Pan troglodytes microRNA...
26 2 gi|301171153|ref|NR_035838.1| Pan troglodytes microRNA...
27 2 gi|301171146|ref|NR_035837.1| Pan troglodytes microRNA...
28 2 gi|270133254|ref|NR_032575.1| Macaca mulatta microRNA ...
29 2 gi|262205445|ref|NR_030221.1| Homo sapiens microRNA 51...
~~~
97 1 gi|356517317|ref|XM_003527287.1| PREDICTED: Glycine ma...
98 1 gi|297814701|ref|XM_002875188.1| Arabidopsis lyrata su...
99 1 gi|397513516|ref|XM_003827011.1| PREDICTED: Pan panisc...
Usually, you’ll be running one BLAST search at a time. Then, all you
need to do is to pick up the first (and only) BLAST record in
``blast_records``:
.. doctest examples
.. code:: pycon
>>> from Bio import Blast
>>> blast_records = Blast.parse("my_blast.xml")
>>> blast_record = next(blast_records)
or more elegantly:
.. code:: pycon
>>> from Bio import Blast
>>> blast_record = Blast.read(result_stream)
or, equivalently,
.. code:: pycon
>>> from Bio import Blast
>>> blast_record = Blast.read("my_blast.xml")
(here, you don’t need to use a ``with`` block as ``Blast.read`` will
read the whole file and close it immediately afterwards).
I guess by now you’re wondering what is in a BLAST record.
The BLAST Records, Record, and Hit classes
------------------------------------------
.. _`subsec:blast-records`:
The BLAST Records class
~~~~~~~~~~~~~~~~~~~~~~~
A single BLAST output file can contain output from multiple BLAST queries. In
Biopython, the information in a BLAST output file is stored in an
``Bio.Blast.Records`` object. This is an iterator returning one
``Bio.Blast.Record`` object (see subsection :ref:`subsec:blast-record`) for
each query. The ``Bio.Blast.Records`` object has the following attributes describing the BLAST run:
- ``source``: The input data from which the ``Bio.Blast.Records``
object was constructed (this could be a file name or path, or a
file-like object).
- ``program``: The specific BLAST program that was used (e.g.,
’blastn’).
- ``version``: The version of the BLAST program (e.g., ’BLASTN
2.2.27+’).
- ``reference``: The literature reference to the BLAST publication.
- ``db``: The BLAST database against which the query was run (e.g.,
’nr’).
- ``query``: A ``SeqRecord`` object which may contain some or all of
the following information:
- ``query.id``: SeqId of the query;
- ``query.description``: Definition line of the query;
- ``query.seq``: The query sequence.
- ``param``: A dictionary with the parameters used for the BLAST run.
You may find the following keys in this dictionary:
- ``'matrix'``: the scoring matrix used in the BLAST run (e.g.,
’BLOSUM62’) (string);
- ``'expect'``: threshold on the expected number of chance matches
(float);
- ``'include'``: e-value threshold for inclusion in multipass model
in psiblast (float);
- ``'sc-match'``: score for matching nucleotides (integer);
- ``'sc-mismatch'``: score for mismatched nucleotides (integer;
- ``'gap-open'``: gap opening cost (integer);
- ``'gap-extend'``: gap extension cost (integer);
- ``'filter'``: filtering options applied in the BLAST run (string);
- ``'pattern'``: PHI-BLAST pattern (string);
- ``'entrez-query'``: Limit of request to Entrez query (string).
- ``mbstat``: A dictionary with Mega BLAST search statistics. See the
description of the ``Record.stat`` attribute below (in subsection
:ref:`subsec:blast-record`) for a description of the items in
this dictionary. Only older versions of Mega BLAST store this
information. As it is stored near the end of the BLAST output file,
this attribute can only be accessed after the file has been read
completely (by iterating over the records until a ``StopIteration``
is issued).
For our example, we find:
.. cont-doctest
.. code:: pycon
>>> blast_records
<Bio.Blast.Records source='my_blast.xml' program='blastn' version='BLASTN 2.2.27+' db='refseq_rna'>
>>> blast_records.source
'my_blast.xml'
>>> blast_records.program
'blastn'
>>> blast_records.version
'BLASTN 2.2.27+'
>>> blast_records.reference
'Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.'
>>> blast_records.db
'refseq_rna'
>>> blast_records.param
{'expect': 10.0, 'sc-match': 2, 'sc-mismatch': -3, 'gap-open': 5, 'gap-extend': 2, 'filter': 'L;m;'}
>>> print(blast_records)
Program: BLASTN 2.2.27+
db: refseq_rna
<BLANKLINE>
Query: 42291 (length=61)
mystery_seq
Hits: ---- ----- ----------------------------------------------------------
# # HSP ID + description
---- ----- ----------------------------------------------------------
0 1 gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 52...
1 1 gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA...
2 1 gi|270133242|ref|NR_032573.1| Macaca mulatta microRNA ...
3 2 gi|301171322|ref|NR_035857.1| Pan troglodytes microRNA...
...
.. _`subsec:blast-record`:
The BLAST Record class
~~~~~~~~~~~~~~~~~~~~~~
A ``Bio.Blast.Record`` object stores the information provided by BLAST for a
single query. The ``Bio.Blast.Record`` class inherits from ``list``, and is
essentially a list of ``Bio.Blast.Hit`` objects (see section
:ref:`subsec:blast-hit`).
A ``Bio.Blast.Record`` object has the following two attributes:
- ``query``: A ``SeqRecord`` object which may contain some or all of
the following information:
- ``query.id``: SeqId of the query;
- ``query.description``: Definition line of the query;
- ``query.seq``: The query sequence.
- ``stat``: A dictionary with statistical data of the BLAST hit. You
may find the following keys in this dictionary:
- ``'db-num'``: number of sequences in BLAST db (integer);
- ``'db-len'``: length of BLAST db (integer);
- ``'hsp-len'``: effective HSP (High Scoring Pair) length (integer);
- ``'eff-space'``: effective search space (float);
- ``'kappa'``: Karlin-Altschul parameter K (float);
- ``'lambda'``: Karlin-Altschul parameter Lambda (float);
- ``'entropy'``: Karlin-Altschul parameter H (float)
- ``message``: Some (error?) information.
Continuing with our example,
.. cont-doctest
.. code:: pycon
>>> blast_record
<Bio.Blast.Record query.id='42291'; 100 hits>
>>> blast_record.query
SeqRecord(seq=Seq(None, length=61), id='42291', name='<unknown name>', description='mystery_seq', dbxrefs=[])
>>> blast_record.stat
{'db-num': 3056429, 'db-len': 673143725, 'hsp-len': 0, 'eff-space': 0, 'kappa': 0.41, 'lambda': 0.625, 'entropy': 0.78}
>>> print(blast_record)
Query: 42291 (length=61)
mystery_seq
Hits: ---- ----- ----------------------------------------------------------
# # HSP ID + description
---- ----- ----------------------------------------------------------
0 1 gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 52...
1 1 gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA...
2 1 gi|270133242|ref|NR_032573.1| Macaca mulatta microRNA ...
3 2 gi|301171322|ref|NR_035857.1| Pan troglodytes microRNA...
...
As the ``Bio.Blast.Record`` class inherits from ``list``, you can use it as
such. For example, you can iterate over the record:
.. cont-doctest
.. code:: pycon
>>> for hit in blast_record:
... hit
...
<Bio.Blast.Hit target.id='gi|262205317|ref|NR_030195.1|' query.id='42291'; 1 HSP>
<Bio.Blast.Hit target.id='gi|301171311|ref|NR_035856.1|' query.id='42291'; 1 HSP>
<Bio.Blast.Hit target.id='gi|270133242|ref|NR_032573.1|' query.id='42291'; 1 HSP>
<Bio.Blast.Hit target.id='gi|301171322|ref|NR_035857.1|' query.id='42291'; 2 HSPs>
<Bio.Blast.Hit target.id='gi|301171267|ref|NR_035851.1|' query.id='42291'; 1 HSP>
...
To check how many hits the ``blast_record`` has, you can simply invoke Python’s
``len`` function:
.. cont-doctest
.. code:: pycon
>>> len(blast_record)
100
Like Python lists, you can retrieve hits from a ``Bio.Blast.Record`` using
indices:
.. cont-doctest
.. code:: pycon
>>> blast_record[0] # retrieves the top hit
<Bio.Blast.Hit target.id='gi|262205317|ref|NR_030195.1|' query.id='42291'; 1 HSP>
>>> blast_record[-1] # retrieves the last hit
<Bio.Blast.Hit target.id='gi|397513516|ref|XM_003827011.1|' query.id='42291'; 1 HSP>
To retrieve multiple hits from a ``Bio.Blast.Record``, you can use the slice
notation. This will return a new ``Bio.Blast.Record`` object containing only
the sliced hits:
.. cont-doctest
.. code:: pycon
>>> blast_slice = blast_record[:3] # slices the first three hits
>>> print(blast_slice)
Query: 42291 (length=61)
mystery_seq
Hits: ---- ----- ----------------------------------------------------------
# # HSP ID + description
---- ----- ----------------------------------------------------------
0 1 gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 52...
1 1 gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA...
2 1 gi|270133242|ref|NR_032573.1| Macaca mulatta microRNA ...
To create a copy of the ``Bio.Blast.Record``, take the full slice:
.. cont-doctest
.. code:: pycon
>>> blast_record_copy = blast_record[:]
>>> type(blast_record_copy)
<class 'Bio.Blast.Record'>
>>> blast_record_copy # list of all hits
<Bio.Blast.Record query.id='42291'; 100 hits>
This is particularly useful if you want to sort or filter the BLAST record
(see :ref:`subsec:blast-sorting-filtering`), but want to retain a copy of the original BLAST output.
You can also access ``blast_record`` as a Python dictionary and retrieve hits
using the hit’s ID as key:
.. cont-doctest
.. code:: pycon
>>> blast_record["gi|262205317|ref|NR_030195.1|"]
<Bio.Blast.Hit target.id='gi|262205317|ref|NR_030195.1|' query.id='42291'; 1 HSP>
If the ID is not found in the ``blast_record``, a ``KeyError`` is raised:
.. cont-doctest
.. code:: pycon
>>> blast_record["unicorn_gene"]
Traceback (most recent call last):
...
KeyError: 'unicorn_gene'
You can get the full list of keys by using ``.keys()`` as usual:
.. cont-doctest
.. code:: pycon
>>> blast_record.keys()
['gi|262205317|ref|NR_030195.1|', 'gi|301171311|ref|NR_035856.1|', 'gi|270133242|ref|NR_032573.1|', ...]
What if you just want to check whether a particular hit is present in the query
results? You can do a simple Python membership test using the ``in`` keyword:
.. cont-doctest
.. code:: pycon
>>> "gi|262205317|ref|NR_030195.1|" in blast_record
True
>>> "gi|262205317|ref|NR_030194.1|" in blast_record
False
Sometimes, knowing whether a hit is present is not enough; you also want to
know the rank of the hit. Here, the ``index`` method comes to the rescue:
.. cont-doctest
.. code:: pycon
>>> blast_record.index("gi|301171437|ref|NR_035870.1|")
22
Remember that Python uses zero-based indexing, so the first hit will be at
index 0.
.. _`subsec:blast-hit`:
The BLAST Hit class
~~~~~~~~~~~~~~~~~~~
Each ``Bio.Blast.Hit`` object in the ``blast_record`` list represents one BLAST
hit of the query against a target.
.. cont-doctest
.. code:: pycon
>>> hit = blast_record[0]
>>> hit
<Bio.Blast.Hit target.id='gi|262205317|ref|NR_030195.1|' query.id='42291'; 1 HSP>
>>> hit.target
SeqRecord(seq=Seq(None, length=61), id='gi|262205317|ref|NR_030195.1|', name='NR_030195', description='Homo sapiens microRNA 520b (MIR520B), microRNA', dbxrefs=[])
We can get a summary of the ``hit`` by printing it:
.. cont-doctest
.. code:: pycon
>>> print(blast_record[3])
Query: 42291
mystery_seq
Hit: gi|301171322|ref|NR_035857.1| (length=86)
Pan troglodytes microRNA mir-520c (MIR520C), microRNA
HSPs: ---- -------- --------- ------ --------------- ---------------------
# E-value Bit score Span Query range Hit range
---- -------- --------- ------ --------------- ---------------------
0 8.9e-20 100.47 60 [1:61] [13:73]
1 3.3e-06 55.39 60 [0:60] [73:13]
You see that we’ve got the essentials covered here:
- A hit is always for one query; the query ID and description are shown at the
top of the summary.
- A hit consists of one or more alignments of the query against one target
sequence. The target information is shown next is the summary. As shown
above, the target can be accessed via the ``target`` attribute of the hit.
- Finally, there’s a table containing quick information about the alignments
each hit contains. In BLAST parlance, these alignments are called
"High-scoring Segment Pairs", or HSPs (see section :ref:`subsec:blast-hsp`).
Each row in the table summarizes one HSP, including the HSP index, e-value,
bit score, span (the alignment length including gaps), query coordinates,
and target coordinates.
The ``Bio.Blast.Hit`` class is a subclass of ``Bio.Align.Alignments`` (plural;
see Section :ref:`sec:alignments`), and therefore in essence is a list of
``Bio.Align.Alignment`` (singular; see Section :ref:`sec:alignmentobject`)
objects. In particular when aligning nucleotide sequences against the genome,
the ``Bio.Blast.Hit`` object may consist of more than one
``Bio.Align.Alignment`` if a particular query aligns to more than one region of
a chromosome. For protein alignments, usually a hit consists of only one
alignment, especially for alignments of highly homologous sequences.
.. cont-doctest
.. code:: pycon
>>> type(hit)
<class 'Bio.Blast.Hit'>
>>> from Bio.Align import Alignments
>>> isinstance(hit, Alignments)
True
>>> len(hit)
1
For BLAST output in the XML2 format, a hit may have several targets with
identical sequences but different sequence IDs and descriptions. These targets
are accessible as the ``hit.targets`` attribute. In most cases, ``hit.targets``
has length 1 and only contains ``hit.target``:
.. doctest ../Tests/Blast
.. code:: pycon
>>> from Bio import Blast
>>> blast_record = Blast.read("xml_2900_blastx_001_v2.xml")
>>> for hit in blast_record:
... print(len(hit.targets))
...
1
1
2
1
1
1
1
1
1
1
However, as you can see in the output above, the third hit has multiple
targets.
.. cont-doctest
.. code:: pycon
>>> hit = blast_record[2]
>>> hit.targets[0].seq
Seq(None, length=246)
>>> hit.targets[1].seq
Seq(None, length=246)
>>> hit.targets[0].id
'gi|684409690|ref|XP_009175831.1|'
>>> hit.targets[1].id
'gi|663044098|gb|KER20427.1|'
>>> hit.targets[0].name
'XP_009175831'
>>> hit.targets[1].name
'KER20427'
>>> hit.targets[0].description
'hypothetical protein T265_11027 [Opisthorchis viverrini]'
>>> hit.targets[1].description
'hypothetical protein T265_11027 [Opisthorchis viverrini]'
As the sequence contents for the two targets are identical to each other, their
sequence alignments are also identical. The alignments for this hit therefore
only refers to ``hit.targets[0]`` (which is identical to ``hit.target``), as
the alignment for ``hit.targets[1]`` would be the same anyway.
.. _`subsec:blast-hsp`:
The BLAST HSP class
~~~~~~~~~~~~~~~~~~~
Let's return to our main example, and look at the first (and only) alignment in
the first hit. This alignment is an instance of the ``Bio.Blast.HSP`` class,
which is a subclass of the ``Alignment`` class in ``Bio.Align``:
.. doctest examples
.. code:: pycon
>>> from Bio import Blast
>>> blast_record = Blast.read("my_blast.xml")
>>> hit = blast_record[0]
>>> len(hit)
1
>>> alignment = hit[0]
>>> alignment
<Bio.Blast.HSP target.id='gi|262205317|ref|NR_030195.1|' query.id='42291'; 2 rows x 61 columns>
>>> type(alignment)
<class 'Bio.Blast.HSP'>
>>> from Bio.Align import Alignment
>>> isinstance(alignment, Alignment)
True
The ``alignment`` object has attributes pointing to the target and query
sequences, as well as a ``coordinates`` attribute describing the sequence
alignment.
.. cont-doctest
.. code:: pycon
>>> alignment.target
SeqRecord(seq=Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG'), id='gi|262205317|ref|NR_030195.1|', name='NR_030195', description='Homo sapiens microRNA 520b (MIR520B), microRNA', dbxrefs=[])
>>> alignment.query
SeqRecord(seq=Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG'), id='42291', name='<unknown name>', description='mystery_seq', dbxrefs=[])
>>> alignment.target
SeqRecord(seq=Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG'), id='gi|262205317|ref|NR_030195.1|', name='NR_030195', description='Homo sapiens microRNA 520b (MIR520B), microRNA', dbxrefs=[])
>>> alignment.query
SeqRecord(seq=Seq('CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTT...GGG'), id='42291', name='<unknown name>', description='mystery_seq', dbxrefs=[])
>>> print(alignment.coordinates)
[[ 0 61]
[ 0 61]]
For translated BLAST searches, the ``features`` attribute of the target or
query may contain a ``SeqFeature`` of type CDS that stores the amino acid
sequence region. The ``qualifiers`` attribute of such a feature is a
dictionary with a single key ``'coded_by'``; the corresponding value specifies
the nucleotide sequence region, in a GenBank-style string with 1-based
coordinates, that encodes the amino acid sequence.
Each ``Alignment`` object has the following additional attributes:
- ``score``: score of the High Scoring Pair (HSP);
- ``annotations``: a dictionary that may contain the following keys:
- ``'bit score'``: score (in bits) of HSP (float);
- ``'evalue'``: e-value of HSP (float);
- ``'identity``’: number of identities in HSP (integer);
- ``'positive'``: number of positives in HSP (integer);
- ``'gaps'``: number of gaps in HSP (integer);
- ``'midline'``: formatting middle line.
The usual ``Alignment`` methods (see Section :ref:`sec:alignmentobject`) can be
applied to the ``alignment``. For example, we can print the alignment:
.. cont-doctest
.. code:: pycon
>>> print(alignment)
Query : 42291 Length: 61 Strand: Plus
mystery_seq
Target: gi|262205317|ref|NR_030195.1| Length: 61 Strand: Plus
Homo sapiens microRNA 520b (MIR520B), microRNA
<BLANKLINE>
Score:111 bits(122), Expect:5e-23,
Identities:61/61(100%), Positives:61/61(100%), Gaps:0.61(0%)
<BLANKLINE>
gi|262205 0 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG
0 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
42291 0 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGG
<BLANKLINE>
gi|262205 60 G 61
60 | 61
42291 60 G 61
<BLANKLINE>
<BLANKLINE>
Let’s just print out some summary info about all hits in our BLAST record
greater than a particular threshold:
.. cont-doctest
.. code:: pycon
>>> E_VALUE_THRESH = 0.04
>>> for alignments in blast_record:
... for alignment in alignments:
... if alignment.annotations["evalue"] < E_VALUE_THRESH:
... print("****Alignment****")
... print("sequence:", alignment.target.id, alignment.target.description)
... print("length:", len(alignment.target))
... print("score:", alignment.score)
... print("e value:", alignment.annotations["evalue"])
... print(alignment[:, :50])
...
****Alignment****
sequence: gi|262205317|ref|NR_030195.1| Homo sapiens microRNA 520b (MIR520B), microRNA
length: 61
score: 122.0
e value: 4.91307e-23
gi|262205 0 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTC 50
0 |||||||||||||||||||||||||||||||||||||||||||||||||| 50
42291 0 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTC 50
<BLANKLINE>
****Alignment****
sequence: gi|301171311|ref|NR_035856.1| Pan troglodytes microRNA mir-520b (MIR520B), microRNA
length: 60
score: 120.0
e value: 1.71483e-22
gi|301171 0 CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCC 50
0 |||||||||||||||||||||||||||||||||||||||||||||||||| 50
42291 1 CCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCC 51
<BLANKLINE>
****Alignment****
sequence: gi|270133242|ref|NR_032573.1| Macaca mulatta microRNA mir-519a (MIR519A), microRNA
length: 85
score: 112.0
e value: 2.54503e-20
gi|270133 12 CCCTCTAGAGGGAAGCGCTTTCTGTGGTCTGAAAGAAAAGAAAGTGCTTC 62
0 |||||||.|||||||||||||||||.|||||||||||||||||||||||| 50
42291 0 CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTC 50
...
.. _`subsec:blast-sorting-filtering`:
Sorting and filtering BLAST output
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
If the ordering of hits in the BLAST output file doesn’t suit your taste, you
can use the ``sort`` method to resort the hits in the ``Bio.Blast.Record``
object. As an example, here we sort the hits based on the sequence length of
each target, setting the ``reverse`` flag to ``True`` so that we sort in
descending order.
.. cont-doctest
.. code:: pycon
>>> for hit in blast_record[:5]:
... print(f"{hit.target.id} {len(hit.target)}")
...
gi|262205317|ref|NR_030195.1| 61
gi|301171311|ref|NR_035856.1| 60
gi|270133242|ref|NR_032573.1| 85
gi|301171322|ref|NR_035857.1| 86
gi|301171267|ref|NR_035851.1| 80
>>> sort_key = lambda hit: len(hit.target)
>>> blast_record.sort(key=sort_key, reverse=True)
>>> for hit in blast_recordt[:5]:
... print(f"{hit.target.id} {len(hit.target)}")
...
gi|397513516|ref|XM_003827011.1| 6002
gi|390332045|ref|XM_776818.2| 4082
gi|390332043|ref|XM_003723358.1| 4079
gi|356517317|ref|XM_003527287.1| 3251
gi|356543101|ref|XM_003539954.1| 2936
This will sort ``blast_record`` in place.
Use ``original_blast_record = blast_record[:]`` before sorting if you want to
retain a copy of the original, unsorted BLAST output.
To filter BLAST hits based on their properties, you can use Python's built-in
``filter`` with the approciate callback function to evaluate each hit. The
callback function must accept as its argument a single ``Hit`` object and
return ``True`` or ``False``. Here is an example in which we filter out
``Hit`` objects that only have one HSP:
.. cont-doctest
.. code:: pycon
>>> filter_func = lambda hit: len(hit) > 1 # the callback function
>>> len(blast_record) # no. of hits before filtering
100
>>> blast_record[:] = filter(filter_func, blast_record)
>>> len(blast_record) # no. of hits after filtering
37
>>> for hit in blast_record[:5]: # quick check for the hit lengths
... print(f"{hit.target.id} {len(hit)}")
...
gi|301171322|ref|NR_035857.1| 2
gi|262205330|ref|NR_030198.1| 2
gi|301171447|ref|NR_035871.1| 2
gi|262205298|ref|NR_030190.1| 2
gi|270132717|ref|NR_032716.1| 2
Similarly, you can filter HSPs in each hit, for example on their e-value:
.. cont-doctest
.. code:: pycon
>>> filter_func = lambda hsp: hsp.annotations["evalue"] < 1.0e-12
>>> for hit in blast_record:
... hit[:] = filter(filter_func, hit)
...
Probably you'd want to follow this up by removing all hits with no HSPs
remaining:
.. cont-doctest
.. code:: pycon
>>> filter_func = lambda hit: len(hit) > 0
>>> blast_record[:] = filter(filter_func, blast_record)
>>> len(blast_record)
16
Use Python's built-in ``map`` function to modify hits or HSPs in the BLAST
record. The ``map`` function accepts a callback function returning the modified
hit object. For example, we can use ``map`` to rename the hit IDs:
.. cont-doctest
.. code:: pycon
>>> for hit in blast_record[:5]:
... print(hit.target.id)
...
gi|301171322|ref|NR_035857.1|
gi|262205330|ref|NR_030198.1|
gi|301171447|ref|NR_035871.1|
gi|262205298|ref|NR_030190.1|
gi|270132717|ref|NR_032716.1|
>>> import copy
>>> original_blast_record = copy.deepcopy(blast_record)
>>> def map_func(hit):
... # renames "gi|301171322|ref|NR_035857.1|" to "NR_035857.1"
... hit.target.id = hit.target.id.split("|")[3]
... return hit
...
>>> blast_record[:] = map(map_func, blast_record)
>>> for hit in blast_record[:5]:
... print(hit.target.id)
...
NR_035857.1
NR_030198.1
NR_035871.1
NR_030190.1
NR_032716.1
>>> for hit in original_blast_record[:5]:
... print(hit.target.id)
...
gi|301171322|ref|NR_035857.1|
gi|262205330|ref|NR_030198.1|
gi|301171447|ref|NR_035871.1|
gi|262205298|ref|NR_030190.1|
gi|270132717|ref|NR_032716.1|
Note that in this example, ``map_func`` modifies the hit in-place.
In contrast to sorting and filtering (see above), using
``original_blast_record = blast_record[:]`` is not sufficient to retain a copy
of the unmodified BLAST record, as it creates a shallow copy of the BLAST
record, consisting of pointers to the same ``Hit`` objects. Instead, we use
``copy.deepcopy`` to create a copy of the BLAST record in which each ``Hit``
object is duplicated.
Writing BLAST records
---------------------
Use the ``write`` function in ``Bio.Blast`` to save BLAST records as an XML
file. By default, the (DTD-based) XML format is used; you can also save the
BLAST records in the (schema-based) XML2 format by using the ``fmt="XML2"``
argument to the ``write`` function.
.. code:: pycon
>>> from Bio import Blast
>>> stream = Blast.qblast("blastn", "nt", "8332116")
>>> records = Blast.parse(stream)
>>> Blast.write(records, "my_qblast_output.xml")
or
.. code:: pycon
>>> Blast.write(records, "my_qblast_output.xml", fmt="XML2")
In this example, we could have saved the data returned by ``Blast.qblast``
directly to an XML file (see section :ref:`subsec:saving-blast-results`).
However, by parsing the data returned by qblast into records, we can sort or
filter the BLAST records before saving them. For example, we may be interested
only in BLAST HSPs with a positive score of at least 400:
.. code:: pycon
>>> filter_func = lambda hsp: hsp.annotations["positive"] >= 400
>>> for hit in records[0]:
... hit[:] = filter(filter_func, hit)
...
>>> Blast.write(records, "my_qblast_output_selected.xml")
Instead of a file name, the second argument to ``Blast.write`` can also be a
file stream. In that case, the stream must be opened in binary format for
writing:
.. code:: pycon
>>> with open("my_qblast_output.xml", "wb") as stream:
... Blast.write(records, stream)
...
Dealing with PSI-BLAST
----------------------
You can run the standalone version of PSI-BLAST (``psiblast``) directly
from the command line or using python’s ``subprocess`` module.
At the time of writing, the NCBI do not appear to support tools running
a PSI-BLAST search via the internet.
Note that the ``Bio.Blast`` parser can read the XML output from current
versions of PSI-BLAST, but information like which sequences in each
iteration is new or reused isn’t present in the XML file.
Dealing with RPS-BLAST
----------------------
You can run the standalone version of RPS-BLAST (``rpsblast``) directly
from the command line or using python’s ``subprocess`` module.
At the time of writing, the NCBI do not appear to support tools running
an RPS-BLAST search via the internet.
You can use the ``Bio.Blast`` parser to read the XML output from current
versions of RPS-BLAST.
.. _`chapter:blast_old`:
BLAST (old)
===========
Hey, everybody loves BLAST right? I mean, geez, how can it get any
easier to do comparisons between one of your sequences and every other
sequence in the known world? But, of course, this section isn’t about
how cool BLAST is, since we already know that. It is about the problem
with BLAST – it can be really difficult to deal with the volume of data
generated by large runs, and to automate BLAST runs in general.
Fortunately, the Biopython folks know this only too well, so they’ve
developed lots of tools for dealing with BLAST and making things much
easier. This section details how to use these tools and do useful things
with them.
Dealing with BLAST can be split up into two steps, both of which can be
done from within Biopython. Firstly, running BLAST for your query
sequence(s), and getting some output. Secondly, parsing the BLAST output
in Python for further analysis.
Your first introduction to running BLAST was probably via the NCBI
web-service. In fact, there are lots of ways you can run BLAST, which
can be categorized in several ways. The most important distinction is
running BLAST locally (on your own machine), and running BLAST remotely
(on another machine, typically the NCBI servers). We’re going to start
this chapter by invoking the NCBI online BLAST service from within a
Python script.
*NOTE*: The following Chapter :ref:`chapter:searchio`
describes ``Bio.SearchIO``. We intend this to ultimately replace the
older ``Bio.Blast`` module, as it provides a more general framework
handling other related sequence searching tools as well. However, for
now you can use either that or the older ``Bio.Blast`` module for
dealing with NCBI BLAST.
Running BLAST over the Internet
-------------------------------
We use the function ``qblast()`` in the ``Bio.Blast.NCBIWWW`` module to
call the online version of BLAST. This has three non-optional arguments:
- The first argument is the blast program to use for the search, as a
lower case string. The options and descriptions of the programs are
available at https://blast.ncbi.nlm.nih.gov/Blast.cgi. Currently
``qblast`` only works with blastn, blastp, blastx, tblast and
tblastx.
- The second argument specifies the databases to search against. Again,
the options for this are available on the NCBI Guide to BLAST
https://blast.ncbi.nlm.nih.gov/doc/blast-help/.
- The third argument is a string containing your query sequence. This
can either be the sequence itself, the sequence in fasta format, or
an identifier like a GI number.
The NCBI guidelines, from
https://blast.ncbi.nlm.nih.gov/doc/blast-help/developerinfo.html#developerinfo
state:
#. Do not contact the server more often than once every 10 seconds.
#. Do not poll for any single RID more often than once a minute.
#. Use the URL parameter email and tool, so that the NCBI can contact
you if there is a problem.
#. Run scripts weekends or between 9 pm and 5 am Eastern time on
weekdays if more than 50 searches will be submitted.
To fulfill the third point, one can set the ``NCBIWWW.email`` variable.
.. doctest
.. code:: pycon
>>> from Bio.Blast import NCBIWWW
>>> NCBIWWW.email = "A.N.Other@example.com"
The ``qblast`` function also takes a number of other option arguments,
which are basically analogous to the different parameters you can set on
the BLAST web page. We’ll just highlight a few of them here:
- The argument ``url_base`` sets the base URL for running BLAST over
the internet. By default it connects to the NCBI.
- The ``qblast`` function can return the BLAST results in various
formats, which you can choose with the optional ``format_type``
keyword: ``"HTML"``, ``"Text"``, ``"ASN.1"``, or ``"XML"``. The
default is ``"XML"``, as that is the format expected by the parser,
described in section :ref:`sec:parsing-blast` below.
- The argument ``expect`` sets the expectation or e-value threshold.
For more about the optional BLAST arguments, we refer you to the NCBI’s
own documentation, or that built into Biopython:
.. code:: pycon
>>> from Bio.Blast import NCBIWWW
>>> help(NCBIWWW.qblast)
Note that the default settings on the NCBI BLAST website are not quite
the same as the defaults on QBLAST. If you get different results, you’ll
need to check the parameters (e.g., the expectation value threshold and
the gap values).
For example, if you have a nucleotide sequence you want to search
against the nucleotide database (nt) using BLASTN, and you know the GI
number of your query sequence, you can use:
.. code:: pycon
>>> from Bio.Blast import NCBIWWW
>>> result_handle = NCBIWWW.qblast("blastn", "nt", "8332116")
Alternatively, if we have our query sequence already in a FASTA
formatted file, we just need to open the file and read in this record as
a string, and use that as the query argument:
.. code:: pycon
>>> from Bio.Blast import NCBIWWW
>>> fasta_string = open("m_cold.fasta").read()
>>> result_handle = NCBIWWW.qblast("blastn", "nt", fasta_string)
We could also have read in the FASTA file as a ``SeqRecord`` and then
supplied just the sequence itself:
.. code:: pycon
>>> from Bio.Blast import NCBIWWW
>>> from Bio import SeqIO
>>> record = SeqIO.read("m_cold.fasta", format="fasta")
>>> result_handle = NCBIWWW.qblast("blastn", "nt", record.seq)
Supplying just the sequence means that BLAST will assign an identifier
for your sequence automatically. You might prefer to use the
``SeqRecord`` object’s format method to make a FASTA string (which will
include the existing identifier):
.. code:: pycon
>>> from Bio.Blast import NCBIWWW
>>> from Bio import SeqIO
>>> record = SeqIO.read("m_cold.fasta", format="fasta")
>>> result_handle = NCBIWWW.qblast("blastn", "nt", record.format("fasta"))
This approach makes more sense if you have your sequence(s) in a
non-FASTA file format which you can extract using ``Bio.SeqIO`` (see
Chapter :ref:`chapter:seqio`).
Whatever arguments you give the ``qblast()`` function, you should get
back your results in a handle object (by default in XML format). The
next step would be to parse the XML output into Python objects
representing the search results (Section :ref:`sec:parsing-blast`),
but you might want to save a local copy of the output file first. I find
this especially useful when debugging my code that extracts info from
the BLAST results (because re-running the online search is slow and
wastes the NCBI computer time).
We need to be a bit careful since we can use ``result_handle.read()`` to
read the BLAST output only once – calling ``result_handle.read()`` again
returns an empty string.
.. code:: pycon
>>> with open("my_blast.xml", "w") as out_handle:
... out_handle.write(result_handle.read())
...
>>> result_handle.close()
After doing this, the results are in the file ``my_blast.xml`` and the
original handle has had all its data extracted (so we closed it).
However, the ``parse`` function of the BLAST parser (described
in :ref:`sec:parsing-blast`) takes a file-handle-like object, so we
can just open the saved file for input:
.. code:: pycon
>>> result_handle = open("my_blast.xml")
Now that we’ve got the BLAST results back into a handle again, we are
ready to do something with them, so this leads us right into the parsing
section (see Section :ref:`sec:parsing-blast` below). You may want
to jump ahead to that now ….
Running BLAST locally
---------------------
.. _introduction-1:
Introduction
~~~~~~~~~~~~
Running BLAST locally (as opposed to over the internet, see
Section :ref:`sec:running-www-blast`) has at least major two
advantages:
- Local BLAST may be faster than BLAST over the internet;
- Local BLAST allows you to make your own database to search for
sequences against.
Dealing with proprietary or unpublished sequence data can be another
reason to run BLAST locally. You may not be allowed to redistribute the
sequences, so submitting them to the NCBI as a BLAST query would not be
an option.
Unfortunately, there are some major drawbacks too – installing all the
bits and getting it setup right takes some effort:
- Local BLAST requires command line tools to be installed.
- Local BLAST requires (large) BLAST databases to be setup (and
potentially kept up to date).
To further confuse matters there are several different BLAST packages
available, and there are also other tools which can produce imitation
BLAST output files, such as BLAT.
.. _standalone-ncbi-blast-1:
Standalone NCBI BLAST+
~~~~~~~~~~~~~~~~~~~~~~
The “new” `NCBI
BLAST+ <https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=Download>`__
suite was released in 2009. This replaces the old NCBI “legacy” BLAST
package (see below).
This section will show briefly how to use these tools from within
Python. If you have already read or tried the alignment tool examples in
Section :ref:`sec:alignment-tools` this should all
seem quite straightforward. First, we construct a command line string
(as you would type in at the command line prompt if running standalone
BLAST by hand). Then we can execute this command from within Python.
For example, taking a FASTA file of gene nucleotide sequences, you might
want to run a BLASTX (translation) search against the non-redundant (NR)
protein database. Assuming you (or your systems administrator) has
downloaded and installed the NR database, you might run:
.. code:: console
$ blastx -query opuntia.fasta -db nr -out opuntia.xml -evalue 0.001 -outfmt 5
This should run BLASTX against the NR database, using an expectation
cut-off value of :math:`0.001` and produce XML output to the specified
file (which we can then parse). On my computer this takes about six
minutes - a good reason to save the output to a file so you can repeat
any analysis as needed.
From within python we can use the ``subprocess`` module to build the
command line string, and run it:
.. code:: pycon
>>> import subprocess
>>> cmd = "blastx -query opuntia.fasta -db nr -out opuntia.xml"
>>> cmd += " -evalue 0.001 -outfmt 5"
>>> subprocess.run(cmd, shell=True)
In this example there shouldn’t be any output from BLASTX to the
terminal. You may want to check the output file ``opuntia.xml`` has been
created.
As you may recall from earlier examples in the tutorial, the
``opuntia.fasta`` contains seven sequences, so the BLAST XML output
should contain multiple results. Therefore use
``Bio.Blast.NCBIXML.parse()`` to parse it as described below in
Section :ref:`sec:parsing-blast`.
Other versions of BLAST
~~~~~~~~~~~~~~~~~~~~~~~
NCBI BLAST+ (written in C++) was first released in 2009 as a replacement
for the original NCBI “legacy” BLAST (written in C) which is no longer
being updated. There were a lot of changes – the old version had a
single core command line tool ``blastall`` which covered multiple
different BLAST search types (which are now separate commands in
BLAST+), and all the command line options were renamed. Biopython’s
wrappers for the NCBI “legacy” BLAST tools have been deprecated and will
be removed in a future release. To try to avoid confusion, we do not
cover calling these old tools from Biopython in this tutorial.
You may also come across `Washington University
BLAST <http://blast.wustl.edu/>`__ (WU-BLAST), and its successor,
`Advanced Biocomputing BLAST <https://blast.advbiocomp.com>`__
(AB-BLAST, released in 2009, not free/open source). These packages
include the command line tools ``wu-blastall`` and ``ab-blastall``,
which mimicked ``blastall`` from the NCBI “legacy” BLAST suite.
Biopython does not currently provide wrappers for calling these tools,
but should be able to parse any NCBI compatible output from them.
Parsing BLAST output
--------------------
As mentioned above, BLAST can generate output in various formats, such
as XML, HTML, and plain text. Originally, Biopython had parsers for
BLAST plain text and HTML output, as these were the only output formats
offered at the time. Unfortunately, the BLAST output in these formats
kept changing, each time breaking the Biopython parsers. Our HTML BLAST
parser has been removed, while the deprecated plain text BLAST parser is
now only available via ``Bio.SearchIO``. Use it at your own risk, it may
or may not work, depending on which BLAST version you’re using.
As keeping up with changes in BLAST became a hopeless endeavor,
especially with users running different BLAST versions, we now recommend
to parse the output in XML format, which can be generated by recent
versions of BLAST. Not only is the XML output more stable than the plain
text and HTML output, it is also much easier to parse automatically,
making Biopython a whole lot more stable.
You can get BLAST output in XML format in various ways. For the parser,
it doesn’t matter how the output was generated, as long as it is in the
XML format.
- You can use Biopython to run BLAST over the internet, as described in
section :ref:`sec:running-www-blast`.
- You can use Biopython to run BLAST locally, as described in
section :ref:`sec:running-local-blast`.
- You can do the BLAST search yourself on the NCBI site through your
web browser, and then save the results. You need to choose XML as the
format in which to receive the results, and save the final BLAST page
you get (you know, the one with all of the interesting results!) to a
file.
- You can also run BLAST locally without using Biopython, and save the
output in a file. Again, you need to choose XML as the format in
which to receive the results.
The important point is that you do not have to use Biopython scripts to
fetch the data in order to be able to parse it. Doing things in one of
these ways, you then need to get a handle to the results. In Python, a
handle is just a nice general way of describing input to any info source
so that the info can be retrieved using ``read()`` and ``readline()``
functions (see
Section :ref:`sec:appendix-handles`).
If you followed the code above for interacting with BLAST through a
script, then you already have ``result_handle``, the handle to the BLAST
results. For example, using a GI number to do an online search:
.. code:: pycon
>>> from Bio.Blast import NCBIWWW
>>> result_handle = NCBIWWW.qblast("blastn", "nt", "8332116")
If instead you ran BLAST some other way, and have the BLAST output (in
XML format) in the file ``my_blast.xml``, all you need to do is to open
the file for reading:
.. code:: pycon
>>> result_handle = open("my_blast.xml")
Now that we’ve got a handle, we are ready to parse the output. The code
to parse it is really quite small. If you expect a single BLAST result
(i.e., you used a single query):
.. code:: pycon
>>> from Bio.Blast import NCBIXML
>>> blast_record = NCBIXML.read(result_handle)
or, if you have lots of results (i.e., multiple query sequences):
.. code:: pycon
>>> from Bio.Blast import NCBIXML
>>> blast_records = NCBIXML.parse(result_handle)
Just like ``Bio.SeqIO`` and ``Bio.Align`` (see
Chapters :ref:`chapter:seqio`
and :ref:`chapter:align`), we have a pair of input
functions, ``read`` and ``parse``, where ``read`` is for when you have
exactly one object, and ``parse`` is an iterator for when you can have
lots of objects – but instead of getting ``SeqRecord`` or
``MultipleSeqAlignment`` objects, we get BLAST record objects.
To be able to handle the situation where the BLAST file may be huge,
containing thousands of results, ``NCBIXML.parse()`` returns an
iterator. In plain English, an iterator allows you to step through the
BLAST output, retrieving BLAST records one by one for each BLAST search
result:
.. code:: pycon
>>> from Bio.Blast import NCBIXML
>>> blast_records = NCBIXML.parse(result_handle)
>>> blast_record = next(blast_records)
# ... do something with blast_record
>>> blast_record = next(blast_records)
# ... do something with blast_record
>>> blast_record = next(blast_records)
# ... do something with blast_record
>>> blast_record = next(blast_records)
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
StopIteration
# No further records
Or, you can use a ``for``-loop:
.. code:: pycon
>>> for blast_record in blast_records:
... pass # Do something with blast_record
...
Note though that you can step through the BLAST records only once.
Usually, from each BLAST record you would save the information that you
are interested in. If you want to save all returned BLAST records, you
can convert the iterator into a list:
.. code:: pycon
>>> blast_records = list(blast_records)
Now you can access each BLAST record in the list with an index as usual.
If your BLAST file is huge though, you may run into memory problems
trying to save them all in a list.
Usually, you’ll be running one BLAST search at a time. Then, all you
need to do is to pick up the first (and only) BLAST record in
``blast_records``:
.. code:: pycon
>>> from Bio.Blast import NCBIXML
>>> blast_records = NCBIXML.parse(result_handle)
>>> blast_record = next(blast_records)
or more elegantly:
.. code:: pycon
>>> from Bio.Blast import NCBIXML
>>> blast_record = NCBIXML.read(result_handle)
I guess by now you’re wondering what is in a BLAST record.
The BLAST record class
----------------------
A BLAST Record contains everything you might ever want to extract from
the BLAST output. Right now we’ll just show an example of how to get
some info out of the BLAST report, but if you want something in
particular that is not described here, look at the info on the record
class in detail, and take a gander into the code or automatically
generated documentation – the docstrings have lots of good info about
what is stored in each piece of information.
To continue with our example, let’s just print out some summary info
about all hits in our blast report greater than a particular threshold.
The following code does this:
.. code:: pycon
>>> E_VALUE_THRESH = 0.04
>>> for alignment in blast_record.alignments:
... for hsp in alignment.hsps:
... if hsp.expect < E_VALUE_THRESH:
... print("****Alignment****")
... print("sequence:", alignment.title)
... print("length:", alignment.length)
... print("e value:", hsp.expect)
... print(hsp.query[0:75] + "...")
... print(hsp.match[0:75] + "...")
... print(hsp.sbjct[0:75] + "...")
...
This will print out summary reports like the following:
.. code:: text
****Alignment****
sequence: >gb|AF283004.1|AF283004 Arabidopsis thaliana cold acclimation protein WCOR413-like protein
alpha form mRNA, complete cds
length: 783
e value: 0.034
tacttgttgatattggatcgaacaaactggagaaccaacatgctcacgtcacttttagtcccttacatattcctc...
||||||||| | ||||||||||| || |||| || || |||||||| |||||| | | |||||||| ||| ||...
tacttgttggtgttggatcgaaccaattggaagacgaatatgctcacatcacttctcattccttacatcttcttc...
Basically, you can do anything you want to with the info in the BLAST
report once you have parsed it. This will, of course, depend on what you
want to use it for, but hopefully this helps you get started on doing
what you need to do!
An important consideration for extracting information from a BLAST
report is the type of objects that the information is stored in. In
Biopython, the parsers return ``Record`` objects, either ``Blast`` or
``PSIBlast`` depending on what you are parsing. These objects are
defined in ``Bio.Blast.Record`` and are quite complete.
Figures :ref:`fig:blastrecord` and :ref:`fig:psiblastrecord` and
are my attempts at UML class diagrams for the ``Blast`` and ``PSIBlast``
record classes. The PSIBlast record object is similar, but has support
for the rounds that are used in the iteration steps of PSIBlast.
.. figure:: ../images/BlastRecord.png
:alt: Class diagram for the Blast Record class representing a report
:name: fig:blastrecord
:width: 80.0%
Class diagram for the Blast Record class representing a BLAST report.
.. figure:: ../images/PSIBlastRecord.png
:alt: Class diagram for the PSIBlast Record class.
:name: fig:psiblastrecord
:width: 80.0%
Class diagram for the PSIBlast Record class.
If you are good at UML and see mistakes/improvements that can be made,
please let me know.
.. _dealing-with-psi-blast-1:
Dealing with PSI-BLAST
----------------------
You can run the standalone version of PSI-BLAST (the legacy NCBI command
line tool ``blastpgp``, or its replacement ``psiblast``) directly from
the command line or using python’s ``subprocess`` module.
At the time of writing, the NCBI do not appear to support tools running
a PSI-BLAST search via the internet.
Note that the ``Bio.Blast.NCBIXML`` parser can read the XML output from
current versions of PSI-BLAST, but information like which sequences in
each iteration is new or reused isn’t present in the XML file.
.. _dealing-with-rps-blast-1:
Dealing with RPS-BLAST
----------------------
You can run the standalone version of RPS-BLAST (either the legacy NCBI
command line tool ``rpsblast``, or its replacement with the same name)
directly from the command line or using python’s ``subprocess`` module.
At the time of writing, the NCBI do not appear to support tools running
an RPS-BLAST search via the internet.
You can use the ``Bio.Blast.NCBIXML`` parser to read the XML output from
current versions of RPS-BLAST.
|