1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630
|
# This code is part of the Biopython distribution and governed by its
# license. Please see the LICENSE file that should have been included
# as part of this package.
#
"""Testing code for Restriction enzyme classes of Biopython."""
import unittest
from Bio import BiopythonWarning
from Bio.Restriction import AanI
from Bio.Restriction import Acc65I
from Bio.Restriction import AllEnzymes
from Bio.Restriction import Analysis
from Bio.Restriction import Asp718I
from Bio.Restriction import BamHI
from Bio.Restriction import BsmBI
from Bio.Restriction import CommOnly
from Bio.Restriction import EarI
from Bio.Restriction import EcoRI
from Bio.Restriction import EcoRV
from Bio.Restriction import FormattedSeq
from Bio.Restriction import KpnI
from Bio.Restriction import McrI
from Bio.Restriction import MluCI
from Bio.Restriction import NdeI
from Bio.Restriction import NonComm
from Bio.Restriction import Restriction
from Bio.Restriction import RestrictionBatch
from Bio.Restriction import SmaI
from Bio.Restriction import SnaI
from Bio.Restriction import SphI
from Bio.Restriction import BsaI
from Bio.Restriction import BsaXI
from Bio.Restriction import BspCNI
from Bio.Seq import MutableSeq
from Bio.Seq import Seq
class SequenceTesting(unittest.TestCase):
"""Tests for dealing with input."""
def test_sequence_object(self):
"""Test if sequence must be a Seq or MutableSeq object."""
with self.assertRaises(TypeError):
seq = FormattedSeq("GATC")
seq = FormattedSeq(Seq("TAGC"))
seq = FormattedSeq(MutableSeq("AGTC"))
seq = FormattedSeq(seq)
with self.assertRaises(TypeError):
EcoRI.search("GATC")
EcoRI.search(Seq("ATGC"))
EcoRI.search(MutableSeq("TCAG"))
def test_non_allowed_characters(self):
"""Test if non-allowed characters raise a TypeError."""
# Any letter is accepted, even if it's not a nucleotide
FormattedSeq(Seq("ABCDEFGHIJKLMNOPQRSTUVWXYZ"))
# Other characters are not accepted
with self.assertRaises(TypeError):
FormattedSeq(Seq("GATCZE-"))
def test_formatted_seq(self):
"""Test several methods of FormattedSeq."""
self.assertEqual(
str(FormattedSeq(Seq("GATC"))), "FormattedSeq(Seq('GATC'), linear=True)"
)
self.assertNotEqual(FormattedSeq(Seq("GATC")), FormattedSeq(Seq("TAGC")))
self.assertNotEqual(FormattedSeq(Seq("TAGC")), Seq("TAGC"))
self.assertEqual(FormattedSeq(Seq("ATGC")), FormattedSeq(Seq("ATGC")))
linear_seq = FormattedSeq(Seq("T"))
self.assertTrue(linear_seq.is_linear())
linear_seq.circularise()
self.assertFalse(linear_seq.is_linear())
linear_seq.linearise()
circular_seq = linear_seq.to_circular()
self.assertFalse(circular_seq.is_linear())
linear_seq = circular_seq.to_linear()
self.assertTrue(linear_seq.is_linear())
class SimpleEnzyme(unittest.TestCase):
"""Tests for dealing with basic enzymes using the Restriction package."""
def test_init(self):
"""Check for error during __init__."""
with self.assertRaises(ValueError) as ve:
Restriction.OneCut("bla-me", (Restriction.RestrictionType,), {})
self.assertIn("hyphen", str(ve.exception))
def setUp(self):
"""Set up some sequences for later use."""
base_seq = Seq("AAAA")
self.ecosite_seq = base_seq + Seq(EcoRI.site) + base_seq
self.smasite_seq = base_seq + Seq(SmaI.site) + base_seq
self.kpnsite_seq = base_seq + Seq(KpnI.site) + base_seq
def test_eco_cutting(self):
"""Test basic cutting with EcoRI (5'overhang)."""
self.assertEqual(EcoRI.site, "GAATTC")
self.assertTrue(EcoRI.cut_once())
self.assertFalse(EcoRI.is_blunt())
self.assertTrue(EcoRI.is_5overhang())
self.assertFalse(EcoRI.is_3overhang())
self.assertEqual(EcoRI.overhang(), "5' overhang")
self.assertTrue(EcoRI.is_defined())
self.assertFalse(EcoRI.is_ambiguous())
self.assertFalse(EcoRI.is_unknown())
self.assertTrue(EcoRI.is_palindromic())
self.assertTrue(EcoRI.is_comm())
self.assertIn("Thermo Fisher Scientific", EcoRI.supplier_list())
self.assertEqual(EcoRI.elucidate(), "G^AATT_C")
self.assertEqual(EcoRI.search(self.ecosite_seq), [6])
self.assertEqual(EcoRI.characteristic(), (1, -1, None, None, "GAATTC"))
parts = EcoRI.catalyse(self.ecosite_seq)
self.assertEqual(len(parts), 2)
self.assertEqual(str(parts[1]), "AATTCAAAA")
parts = EcoRI.catalyze(self.ecosite_seq)
self.assertEqual(len(parts), 2)
def test_kpn_cutting(self):
"""Test basic cutting with KpnI (3'overhang)."""
self.assertTrue(KpnI.is_3overhang())
self.assertFalse(KpnI.is_5overhang())
self.assertFalse(KpnI.is_blunt())
self.assertEqual(KpnI.overhang(), "3' overhang")
parts = KpnI.catalyse(self.kpnsite_seq)
self.assertEqual(len(parts), 2)
self.assertEqual(
KpnI.catalyse(self.kpnsite_seq), KpnI.catalyze(self.kpnsite_seq)
)
def test_sma_cutting(self):
"""Test basic cutting with SmaI (blunt cutter)."""
self.assertTrue(SmaI.is_blunt())
self.assertFalse(SmaI.is_3overhang())
self.assertFalse(SmaI.is_5overhang())
self.assertEqual(SmaI.overhang(), "blunt")
parts = SmaI.catalyse(self.smasite_seq)
self.assertEqual(len(parts), 2)
self.assertEqual(str(parts[1]), "GGGAAAA")
parts = SmaI.catalyze(self.smasite_seq)
self.assertEqual(len(parts), 2)
def test_ear_cutting(self):
"""Test basic cutting with EarI (ambiguous overhang)."""
self.assertFalse(EarI.is_palindromic())
self.assertFalse(EarI.is_defined())
self.assertTrue(EarI.is_ambiguous())
self.assertFalse(EarI.is_unknown())
self.assertEqual(EarI.elucidate(), "CTCTTCN^NNN_N")
def test_sna_cutting(self):
"""Test basic cutting with SnaI (unknown)."""
self.assertEqual(SnaI.elucidate(), "? GTATAC ?")
self.assertFalse(SnaI.is_defined())
self.assertFalse(SnaI.is_ambiguous())
self.assertTrue(SnaI.is_unknown())
self.assertFalse(SnaI.is_comm())
self.assertIsNone(SnaI.suppliers())
self.assertEqual(SnaI.supplier_list(), [])
with self.assertRaises(TypeError):
SnaI.buffers("no company")
def test_circular_sequences(self):
"""Deal with cutting circular sequences."""
parts = EcoRI.catalyse(self.ecosite_seq, linear=False)
self.assertEqual(len(parts), 1)
locations = EcoRI.search(parts[0], linear=False)
self.assertEqual(locations, [1])
parts = KpnI.catalyse(self.kpnsite_seq, linear=False)
self.assertEqual(len(parts), 1)
locations = KpnI.search(parts[0], linear=False)
self.assertEqual(locations, [1])
parts = SmaI.catalyse(self.smasite_seq, linear=False)
self.assertEqual(len(parts), 1)
locations = SmaI.search(parts[0], linear=False)
self.assertEqual(locations, [1])
self.assertEqual(
EarI.search(FormattedSeq(Seq("CTCTTCAAAAA")), linear=False), [8]
)
self.assertEqual(
SnaI.search(FormattedSeq(Seq("GTATACAAAAA")), linear=False), [1]
)
def test_shortcuts(self):
"""Check if '/' and '//' work as '.search' and '.catalyse'."""
self.assertEqual(EcoRI / self.ecosite_seq, [6])
self.assertEqual(self.ecosite_seq / EcoRI, [6])
self.assertEqual(len(EcoRI // self.ecosite_seq), 2)
self.assertEqual(len(self.ecosite_seq // EcoRI), 2)
def test_cutting_border_positions(self):
"""Check if cutting after first and penultimate position works."""
# Use EarI, cuts as follows: CTCTTCN^NNN_N
# Only when the cut produces double stranded DNA on both outputs
# it is returned.
seq = Seq("CTCTTCA")
self.assertEqual(EarI.search(seq), [])
seq += "AAA"
self.assertEqual(EarI.search(seq), [])
seq += "A"
self.assertEqual(EarI.search(seq), [8])
# Recognition site on reverse-complement strand
seq = Seq("AAAAGAAGAG")
self.assertEqual(EarI.search(seq), [])
seq = "A" + seq
self.assertEqual(EarI.search(seq), [2])
# Examples from https://github.com/biopython/biopython/issues/4604
self.assertEqual(BsaI.search(Seq("GGTCTCATAAAA")), [8])
self.assertEqual(BsaI.search(Seq("GGTCTCATAAA")), [])
self.assertEqual(BsaI.search(Seq("GGTCTCGT")), [])
self.assertEqual(BsaI.search(Seq("GGTCTCGT").reverse_complement()), [])
self.assertEqual(BsaXI.search(Seq("AAATAAAAAAAAAACAAAAACTCC")), [5])
self.assertEqual(BsaXI.search(Seq("AATAAAAAAAAAACAAAAACTCC")), [])
self.assertEqual(BspCNI.search(Seq("CTCAGAAAAAAAAAT")), [15])
self.assertEqual(BspCNI.search(Seq("CTCAGAAAAAAAAA")), [])
def test_recognition_site_on_both_strands(self):
"""Check if recognition sites on both strands are properly handled."""
seq = Seq("CTCTTCGAAGAG")
self.assertEqual(EarI.search(seq), [3, 8])
def test_overlapping_cut_sites(self):
"""Check if overlapping recognition sites are properly handled."""
seq = Seq("CATGCACGCATGCATGCACGC")
self.assertEqual(SphI.search(seq), [13, 17])
class EnzymeComparison(unittest.TestCase):
"""Tests for comparing various enzymes."""
def test_basic_isochizomers(self):
"""Test to be sure isochizomer and neoschizomers are as expected."""
self.assertEqual(Acc65I.isoschizomers(), [Asp718I, KpnI])
self.assertEqual(Acc65I.elucidate(), "G^GTAC_C")
self.assertEqual(Asp718I.elucidate(), "G^GTAC_C")
self.assertEqual(KpnI.elucidate(), "G_GTAC^C")
self.assertTrue(Acc65I.is_isoschizomer(KpnI))
self.assertFalse(Acc65I.is_equischizomer(KpnI))
self.assertTrue(Acc65I.is_neoschizomer(KpnI))
self.assertIn(Acc65I, Asp718I.equischizomers())
self.assertIn(KpnI, Asp718I.neoschizomers())
self.assertIn(KpnI, Acc65I.isoschizomers())
def test_comparisons(self):
"""Test comparison operators between different enzymes."""
# Comparison of iso- and neoschizomers
self.assertEqual(Acc65I, Acc65I)
self.assertNotEqual(Acc65I, KpnI)
self.assertFalse(Acc65I == Asp718I) # noqa: A500
# self.assertNotEqual(Acc65I, Asp718I) it doesn't work as expected
self.assertFalse(Acc65I != Asp718I) # noqa: A500
self.assertNotEqual(Acc65I, EcoRI)
self.assertTrue(Acc65I >> KpnI)
self.assertFalse(Acc65I >> Asp718I)
# Compare length of recognition sites
self.assertFalse(EcoRI >= EcoRV)
self.assertGreaterEqual(EcoRV, EcoRI)
with self.assertRaises(NotImplementedError):
EcoRV >= 3
self.assertFalse(EcoRI > EcoRV)
self.assertGreater(EcoRV, EcoRI)
with self.assertRaises(NotImplementedError):
EcoRV > 3
self.assertLessEqual(EcoRI, EcoRV)
self.assertFalse(EcoRV <= EcoRI)
with self.assertRaises(NotImplementedError):
EcoRV <= 3
self.assertLess(EcoRI, EcoRV)
self.assertFalse(EcoRV < EcoRI)
with self.assertRaises(NotImplementedError):
EcoRV < 3
# Compare compatible overhangs
self.assertTrue(Acc65I % Asp718I)
self.assertTrue(Acc65I % Acc65I)
self.assertFalse(Acc65I % KpnI)
with self.assertRaises(TypeError):
Acc65I % "KpnI"
self.assertTrue(SmaI % EcoRV)
self.assertTrue(EarI % EarI)
self.assertIn(EcoRV, SmaI.compatible_end())
self.assertIn(Acc65I, Asp718I.compatible_end())
class RestrictionBatchPrintTest(unittest.TestCase):
"""Tests Restriction.Analysis printing functionality."""
def createAnalysis(self, seq_str, batch_ary):
"""Restriction.Analysis creation helper method."""
rb = Restriction.RestrictionBatch(batch_ary)
seq = Seq(seq_str)
return Restriction.Analysis(rb, seq)
def assertAnalysisFormat(self, analysis, expected):
"""Test make_format.
Test that the Restriction.Analysis make_format(print_that) matches
some string.
"""
dct = analysis.mapping
ls, nc = [], []
for k, v in dct.items():
if v:
ls.append((k, v))
else:
nc.append(k)
result = analysis.make_format(ls, "", [], "")
self.assertEqual(result.replace(" ", ""), expected.replace(" ", ""))
def test_make_format_map1(self):
"""Test that print_as('map'); print_that() correctly wraps round.
1. With no marker.
"""
analysis = self.createAnalysis(
"CCAGTCTATAATTCG"
+ Restriction.BamHI.site
+ "GCGGCATCATACTCGAATATCGCGTGATGATACGTAGTAATTACGCATG",
["BamHI"],
)
analysis.print_as("map")
expected = [
" 17 BamHI",
" | ",
"CCAGTCTATAATTCGGGATCCGCGGCATCATACTCGAATATCGCGTGATGATACGTAGTA",
"||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||",
"GGTCAGATATTAAGCCCTAGGCGCCGTAGTATGAGCTTATAGCGCACTACTATGCATCAT",
"1 60",
"",
"ATTACGCATG",
"||||||||||",
"TAATGCGTAC",
"61 70",
"",
"",
]
self.assertAnalysisFormat(analysis, "\n".join(expected))
def test_make_format_map2(self):
"""Test that print_as('map'); print_that() correctly wraps round.
2. With marker.
"""
analysis = self.createAnalysis(
"CCAGTCTATAATTCG"
+ Restriction.BamHI.site
+ "GCGGCATCATACTCGA"
+ Restriction.BamHI.site
+ "ATATCGCGTGATGATA"
+ Restriction.NdeI.site
+ "CGTAGTAATTACGCATG",
["NdeI", "EcoRI", "BamHI", "BsmBI"],
)
analysis.print_as("map")
expected = [
" 17 BamHI",
" | ",
" | 39 BamHI",
" | | ",
"CCAGTCTATAATTCGGGATCCGCGGCATCATACTCGAGGATCCATATCGCGTGATGATAC",
"||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||",
"GGTCAGATATTAAGCCCTAGGCGCCGTAGTATGAGCTCCTAGGTATAGCGCACTACTATG",
"1 60",
"",
" 62 NdeI",
" | ",
"ATATGCGTAGTAATTACGCATG",
"||||||||||||||||||||||",
"TATACGCATCATTAATGCGTAC",
"61 82",
"",
"",
]
self.assertAnalysisFormat(analysis, "\n".join(expected))
def test_make_format_map3(self):
"""Test that print_as('map'); print_that() correctly wraps round.
3. With marker restricted.
"""
analysis = self.createAnalysis(
"CCAGTCTATAATTCG"
+ Restriction.BamHI.site
+ "GCGGCATCATACTCGA"
+ Restriction.BamHI.site
+ "ATATCGCGTGATGATA"
+ Restriction.EcoRV.site
+ "CGTAGTAATTACGCATG",
["NdeI", "EcoRI", "BamHI", "BsmBI"],
)
analysis.print_as("map")
expected = [
" 17 BamHI",
" | ",
" | 39 BamHI",
" | | ",
"CCAGTCTATAATTCGGGATCCGCGGCATCATACTCGAGGATCCATATCGCGTGATGATAG",
"||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||",
"GGTCAGATATTAAGCCCTAGGCGCCGTAGTATGAGCTCCTAGGTATAGCGCACTACTATC",
"1 60",
"",
"ATATCCGTAGTAATTACGCATG",
"||||||||||||||||||||||",
"TATAGGCATCATTAATGCGTAC",
"61 82",
"",
"",
]
self.assertAnalysisFormat(analysis, "\n".join(expected))
def test_change(self):
"""Test that change() changes something."""
seq = Seq(
"CCAGTCTATAATTCG"
+ BamHI.site
+ "GCGGCATCATACTCGA"
+ BamHI.site
+ "ATATCGCGTGATGATA"
+ EcoRV.site
+ "CGTAGTAATTACGCATG"
)
batch = NdeI + EcoRI + BamHI + BsmBI
analysis = Analysis(batch, seq)
self.assertEqual(analysis.full()[BamHI], [17, 39])
batch = NdeI + EcoRI + BsmBI
seq += NdeI.site
analysis.change(sequence=seq)
analysis.change(rb=batch)
self.assertEqual(len(analysis.full()), 3)
self.assertEqual(analysis.full()[NdeI], [85])
with self.assertRaises(AttributeError):
analysis.change(**{"NameWidth": 3, "KonsoleWidth": 40}) # Console
class RestrictionBatches(unittest.TestCase):
"""Tests for dealing with batches of restriction enzymes."""
def test_creating_batch(self):
"""Creating and modifying a restriction batch."""
batch = RestrictionBatch()
self.assertEqual(batch.suppl_codes()["N"], "New England Biolabs")
self.assertTrue(batch.is_restriction(EcoRI))
batch = RestrictionBatch([EcoRI])
batch.add(KpnI)
batch += EcoRV
self.assertEqual(len(batch), 3)
self.assertEqual(batch.elements(), ["EcoRI", "EcoRV", "KpnI"])
# Problem with Python 3, as sequence of list may be different:
# self.assertEqual(batch.as_string(), ['EcoRI', 'KpnI', 'EcoRV'])
self.assertIn("EcoRI", batch.as_string())
# The usual way to test batch membership
self.assertIn(EcoRV, batch)
self.assertIn(EcoRI, batch)
self.assertIn(KpnI, batch)
self.assertNotIn(SmaI, batch)
# Syntax sugar for the above
self.assertIn("EcoRV", batch)
self.assertNotIn("SmaI", batch)
batch.get(EcoRV)
self.assertRaises(ValueError, batch.get, SmaI)
batch.get(SmaI, add=True)
self.assertEqual(len(batch), 4)
batch.remove(SmaI)
batch.remove(EcoRV)
self.assertEqual(len(batch), 2)
self.assertNotIn(EcoRV, batch)
self.assertNotIn("EcoRV", batch)
# Creating a batch by addition of restriction enzymes
new_batch = EcoRI + KpnI
self.assertEqual(batch, new_batch)
# or by addition of a batch with an enzyme
another_new_batch = new_batch + EcoRV
new_batch += EcoRV
self.assertEqual(another_new_batch, new_batch)
self.assertRaises(TypeError, EcoRI.__add__, 1)
# Create a batch with suppliers and other supplier related methods
# These tests may be 'update sensitive' since company names and
# products may change often...
batch = RestrictionBatch((), ("S")) # Sigma
self.assertEqual(batch.current_suppliers(), ["Sigma Chemical Corporation"])
self.assertIn(EcoRI, batch)
self.assertNotIn(AanI, batch)
batch.add_supplier("B") # Thermo Fisher Scientific
self.assertIn(AanI, batch)
def test_batch_analysis(self):
"""Sequence analysis with a restriction batch."""
seq = Seq("AAAA" + EcoRV.site + "AAAA" + EcoRI.site + "AAAA")
batch = RestrictionBatch([EcoRV, EcoRI])
hits = batch.search(seq)
self.assertEqual(hits[EcoRV], [8])
self.assertEqual(hits[EcoRI], [16])
def test_premade_batches(self):
"""Test content of premade batches CommOnly, NoComm, AllEnzymes."""
self.assertEqual(len(AllEnzymes), (len(CommOnly) + len(NonComm)))
self.assertTrue(len(AllEnzymes) > len(CommOnly) > len(NonComm))
def test_search_premade_batches(self):
"""Test search with pre-made batches CommOnly, NoComm, AllEnzymes."""
seq = Seq("ACCCGAATTCAAAACTGACTGATCGATCGTCGACTG")
search = AllEnzymes.search(seq)
self.assertEqual(search[MluCI], [6])
# Check if '/' operator works as 'search':
search = CommOnly / seq
self.assertEqual(search[MluCI], [6])
# Also in reverse order:
search = seq / NonComm
self.assertEqual(search[McrI], [28])
def test_analysis_restrictions(self):
"""Test Fancier restriction analysis."""
new_seq = Seq("TTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAA")
rb = RestrictionBatch([EcoRI, KpnI, EcoRV])
ana = Analysis(rb, new_seq, linear=False)
# Output only the result for enzymes which cut blunt:
self.assertEqual(ana.blunt(), {EcoRV: []})
self.assertEqual(ana.full(), {KpnI: [], EcoRV: [], EcoRI: [33]})
# Output only the result for enzymes which have a site:
self.assertEqual(ana.with_sites(), {EcoRI: [33]})
# Output only the enzymes which have no site:
self.assertEqual(ana.without_site(), {KpnI: [], EcoRV: []})
self.assertEqual(ana.with_site_size([32]), {})
# Output only enzymes which produce 5' overhangs
self.assertEqual(ana.overhang5(), {EcoRI: [33]})
# Output only enzymes which produce 3' overhangs
self.assertEqual(ana.overhang3(), {KpnI: []})
# Output only enzymes which produce defined ends
self.assertEqual(ana.defined(), {KpnI: [], EcoRV: [], EcoRI: [33]})
# Output only enzymes hich cut N times
self.assertEqual(ana.with_N_sites(2), {})
# The enzymes which cut between position x and y:
with self.assertRaises(TypeError):
ana.only_between("t", 20)
with self.assertRaises(TypeError):
ana.only_between(1, "t")
self.assertEqual(ana.only_between(1, 20), {})
self.assertEqual(ana.only_between(20, 34), {EcoRI: [33]})
# Mix start/end order:
self.assertEqual(ana.only_between(34, 20), {EcoRI: [33]})
self.assertEqual(ana.only_outside(20, 34), {})
with self.assertWarns(BiopythonWarning):
ana.with_name(["fake"])
self.assertEqual(ana.with_name([EcoRI]), {EcoRI: [33]})
self.assertEqual((ana._boundaries(1, 20)[:2]), (1, 20))
# Reverse order:
self.assertEqual((ana._boundaries(20, 1)[:2]), (1, 20))
# Fix negative start:
self.assertEqual((ana._boundaries(-1, 20)[:2]), (20, 33))
# Fix negative end:
self.assertEqual((ana._boundaries(1, -1)[:2]), (1, 33))
# Sites in- and outside of boundaries
new_seq = Seq("GAATTCAAAAAAGAATTC")
rb = RestrictionBatch([EcoRI])
ana = Analysis(rb, new_seq)
# Cut at least inside
self.assertEqual(ana.between(1, 7), {EcoRI: [2, 14]})
# Cut at least inside and report only inside site
self.assertEqual(ana.show_only_between(1, 7), {EcoRI: [2]})
# Cut at least outside
self.assertEqual(ana.outside(1, 7), {EcoRI: [2, 14]})
# Don't cut within
self.assertEqual(ana.do_not_cut(7, 12), {EcoRI: [2, 14]})
class TestPrintOutputs(unittest.TestCase):
"""Class to test various print outputs."""
import sys
from io import StringIO
def test_supplier(self):
"""Test output of supplier list for different enzyme types."""
out = self.StringIO()
self.sys.stdout = out
EcoRI.suppliers()
self.assertIn("Thermo Fisher Scientific", out.getvalue())
self.assertIsNone(SnaI.suppliers())
EcoRI.all_suppliers() # Independent of enzyme, list of all suppliers
self.assertIn("Agilent Technologies", out.getvalue())
batch = EcoRI + SnaI
batch.show_codes()
self.assertIn("N = New England Biolabs", out.getvalue())
self.sys.stdout = self.sys.__stdout__
def test_print_that(self):
"""Test print_that function."""
out = self.StringIO()
self.sys.stdout = out
my_batch = EcoRI + SmaI + KpnI
my_seq = Seq("GAATTCCCGGGATATA") # EcoRI and SmaI sites
analysis = Analysis(my_batch, my_seq)
analysis.print_that(None, title="My sequence\n\n", s1="Non Cutters\n\n")
self.assertIn("My sequence", out.getvalue())
self.assertIn("Non Cutters", out.getvalue())
self.assertIn("2.", out.getvalue())
self.sys.stdout = self.sys.__stdout__
def test_str_method(self):
"""Test __str__ and __repr__ outputs."""
batch = EcoRI + SmaI + KpnI
self.assertEqual(str(batch), "EcoRI+KpnI+SmaI")
batch += Asp718I
batch += SnaI
self.assertEqual(str(batch), "Asp718I+EcoRI...SmaI+SnaI")
self.assertEqual(
repr(batch),
"RestrictionBatch(['Asp718I', 'EcoRI', 'KpnI', 'SmaI', 'SnaI'])",
)
if __name__ == "__main__":
runner = unittest.TextTestRunner(verbosity=2)
unittest.main(testRunner=runner)
|