1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82
|
#!/usr/bin/env python
from os import remove
from cogent.util.unit_test import TestCase, main
from cogent.core.info import Info
from cogent.app.mfold import Mfold
__author__ = "Shandy Wikman"
__copyright__ = "Copyright 2007-2009, The Cogent Project"
__contributors__ = ["Shandy Wikman"]
__license__ = "GPL"
__version__ = "1.4.1"
__maintainer__ = "Shandy Wikman"
__email__ = "ens01svn@cs.umu.se"
__status__ = "Development"
class MfoldTest(TestCase):
"""Tests for Mfold application controller"""
def setUp(self):
self.input = mfold_input
def test_stdout_input_as_lines(self):
"""Test Mfold stdout input as lines"""
m = Mfold(InputHandler='_input_as_lines')
res = m(self.input)
#Impossible to compare stdout since tmp filenames in app controller
#can't be predicted and are in stdout
#Test exitstatus = 0 and stdout is not none
self.assertEqual(res['ExitStatus'],0)
assert res['StdOut'] is not None
res.cleanUp()
def test_stdout_input_as_string(self):
"""Test Mfold stdout input as string"""
m = Mfold()
f = open('/tmp/single.fasta','w')
f.write('\n'.join(self.input))
f.close()
res = m('/tmp/single.fasta')
#Impossible to compare stdout since tmp filenames in app controller
#can't be predicted and are in stdout
#Test exitstatus = 0 and stdout is not none
assert res['StdOut'] is not None
self.assertEqual(res['ExitStatus'],0)
res.cleanUp()
remove('/tmp/single.fasta')
def test_get_result_path(self):
"""Tests mfold result path"""
m = Mfold(InputHandler='_input_as_lines')
res = m(self.input)
self.assertEqualItems(res.keys(),['ps','_1.ps','_1.ss','StdOut', 'StdErr', 'ExitStatus', 'ct_all', 'ct1', 'log', 'ann', 'h-num', 'det', 'pnt', 'sav', 'ss-count', '-local.seq', 'rnaml', 'out', 'plot','pdf1'])
self.assertEqual(res['ExitStatus'],0)
assert res['ct_all'] is not None
assert res['log'] is not None
assert res['ann'] is not None
assert res['h-num'] is not None
assert res['det'] is not None
assert res['pnt'] is not None
assert res['sav'] is not None
assert res['ss-count'] is not None
assert res['-local.seq'] is not None
assert res['rnaml'] is not None
assert res['out'] is not None
assert res['plot'] is not None
res.cleanUp()
mfold_input = ['>seq1\n', 'GGCUAGAUAGCUCAGAUGGUAGAGCAGAGGAUUGAAGAUCCUUGUGUCGUCGGUUCGAUCCCGGCUCUGGC\n', '\n']
if __name__ == '__main__':
main()
|