1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90
|
#!/usr/bin/env python
"""Provides Tests for Sfold application controller.
IMPORTANT!!! don't forget to set param_dir variable in sfold
application controller IMPORTANT!!!
"""
from os import remove
from cogent.util.unit_test import TestCase, main
from cogent.core.info import Info
from cogent.app.sfold import Sfold
__author__ = "Shandy Wikman"
__copyright__ = "Copyright 2007-2009, The Cogent Project"
__contributors__ = ["Shandy Wikman"]
__license__ = "GPL"
__version__ = "1.4.1"
__maintainer__ = "Shandy Wikman"
__email__ = "ens01svn@cs.umu.se"
__status__ = "Development"
class SfoldTest(TestCase):
"""Tests for Sfold application controller"""
def setUp(self):
self.input = sfold_input
def test_stdout_input_as_lines(self):
"""Test Sfold stdout input as lines"""
s = Sfold(InputHandler='_input_as_lines')
res = s(self.input)
self.assertEqual(res['ExitStatus'],0)
assert res['StdOut'] is not None
res.cleanUp()
def test_stdout_input_as_string(self):
"""Test Sfold stdout input as string"""
s = Sfold()
f = open('/tmp/single.fasta','w')
f.write('\n'.join(self.input))
f.close()
res = s('/tmp/single.fasta')
self.assertEqual(res['ExitStatus'],0)
assert res['StdOut'] is not None
res.cleanUp()
remove('/tmp/single.fasta')
def test_get_result_path(self):
"""Tests sfold result path"""
s = Sfold(InputHandler='_input_as_lines')
res = s(self.input)
self.assertEqualItems(res.keys(),['StdOut','StdErr','ExitStatus',
'10structure','10structure_2','Dharmacon_thermo','bp',
'bprob','cdf','fe','loopr','oligo','oligo_f','pdf',
'sample','sample_1000','sirna','sirna_f','sirna_s',
'smfe','sstrand','stability'])
self.assertEqual(res['ExitStatus'],0)
assert res['10structure'] is not None
assert res['10structure_2'] is not None
assert res['Dharmacon_thermo'] is not None
assert res['bp'] is not None
assert res['cdf'] is not None
assert res['fe'] is not None
assert res['loopr'] is not None
assert res['oligo'] is not None
assert res['oligo_f'] is not None
assert res['pdf'] is not None
assert res['sample'] is not None
assert res['sample_1000'] is not None
assert res['sirna'] is not None
assert res['sirna_f'] is not None
assert res['sirna_s'] is not None
assert res['smfe'] is not None
assert res['sstrand'] is not None
assert res['stability'] is not None
res.cleanUp()
sfold_input = ['>seq1\n',
'GGCUAGAUAGCUCAGAUGGUAGAGCAGAGGAUUGAAGAUCCUUGUGUCGUCGGUUCGAUCCCGGCUCUGGC\n',
'\n']
if __name__ == '__main__':
main()
|