1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074
|
#!/usr/bin/env python
"""Tests for ViennaStructure and related classes.
"""
from cogent.util.unit_test import TestCase, main
from cogent.struct.rna2d import ViennaStructure, Vienna, Pairs,\
Partners, EmptyPartners, WussStructure, wuss_to_vienna, StructureNode, \
Stem, classify, PairError
__author__ = "Rob Knight"
__copyright__ = "Copyright 2007-2009, The Cogent Project"
__credits__ = ["Rob Knight", "Sandra Smit"]
__license__ = "GPL"
__version__ = "1.4.1"
__maintainer__ = "Rob Knight"
__email__ = "rob@spot.colorado.edu"
__status__ = "Production"
class RnaAlphabet(object):
Pairs = {
('A','U'): True, #True vs False for 'always' vs 'sometimes' pairing
('C','G'): True,
('G','C'): True,
('U','A'): True,
('G','U'): False,
('U','G'): False,
}
class Rna(str):
Alphabet = RnaAlphabet
class StemTests(TestCase):
"""Tests for the Stem object"""
def test_init_empty(self):
"""Stem should init ok with no parameters."""
s = Stem()
self.assertEqual((s.Start, s.End, s.Length), (None, None, 0))
def test_init(self):
"""Stem should init with Start, End, and Length"""
s = Stem(Length=3)
self.assertEqual((s.Start, s.End, s.Length), (None, None, 3))
#should set Length to 0 if not supplied and unpaired
s = Stem(Start=3)
self.assertEqual((s.Start, s.End, s.Length), (3, None, 0))
s = Stem(End=3)
self.assertEqual((s.Start, s.End, s.Length), (None, 3, 0))
#should set Length to 1 if not supplied and paired
s = Stem(Start=3, End=5)
self.assertEqual((s.Start, s.End, s.Length), (3, 5, 1))
#parameters should be in order Start, End, Length
#note that you're allowed to initialize an invalid stem, like the
#following one (can't have 7 pairs between 3 and 5); this is often
#useful when building up a tree that you plan to renumber().
s = Stem(3, 5, 7)
self.assertEqual((s.Start, s.End, s.Length), (3, 5, 7))
#not allowed more than 3 parameters
self.assertRaises(TypeError, Stem, 1, 2, 3, 4)
def test_len(self):
"""Stem len() should return self.Length"""
s = Stem()
self.assertEqual(len(s), 0)
s.Length = 5
self.assertEqual(len(s), 5)
s.Length = None
self.assertRaises(TypeError, len, s)
def test_getitem(self):
"""Stem getitem should return a Stem object for the ith pair in the stem"""
s = Stem()
self.assertRaises(IndexError, s.__getitem__, 0)
s.Start = 5
s.End = 8
s.Length = 1
pairs = list(s)
self.assertEqual(pairs, [Stem(5, 8, 1)])
s.Length = 2
pairs = list(s)
self.assertEqual(pairs, [Stem(5,8,1),Stem(6,7,1)])
#WARNING: Stem will not complain when iterating over an invalid helix,
#as per the one below
s.Length = 5
pairs = list(s)
self.assertEqual(pairs, [Stem(5,8,1),Stem(6,7,1),Stem(7,6,1),\
Stem(8,5,1), Stem(9,4,1)])
def test_cmp(self):
"""Stems should compare equal when the data is the same"""
self.assertEqual(Stem(1,2,3), Stem(1,2,3))
self.assertNotEqual(Stem(1,2,5), Stem(1,2,3))
a = Stem(1, 10, 2)
b = Stem(2, 8, 1)
c = Stem(15, 20, 2)
l = [c, b, a]
l.sort()
self.assertEqual(l, [a,b,c])
def test_extract(self):
"""Stems extract should return a list of 'pairs' from a sequence"""
seq = 'UGAGAUUUUCU'
s = Stem(1, 10, 3)
self.assertEqual(s.extract(seq), [('G','U'),('A','C'),('G','U')])
s = Stem(0, 1)
self.assertEqual(s.extract(seq), [('U','G')])
#should put in None if either position hasn't been specified
s = Stem(5)
self.assertEqual(s.extract(seq), [('U', None)])
s = Stem()
self.assertEqual(s.extract(seq), [(None, None)])
#should raise IndexError if the stem contains bases outside the seq
s = Stem(50, 60, 5)
self.assertRaises(IndexError, s.extract, seq)
def test_hash(self):
"""Stems hash should allow use as dict keys if unchanged"""
#WARNING: if you change the Stem after putting it in a dict, all bets
#are off as to behavior. Don't do it!
s = Stem(1, 5, 2)
t = Stem(1, 5, 2)
u = Stem(2, 4, 6)
v = Stem(2, 4, 6)
w = Stem(2, 4, 4)
d = {}
assert s is not t
for i in (s, t, u, v, w):
if i in d:
d[i] += 1
else:
d[i] = 1
self.assertEqual(len(d), 3)
self.assertEqual(d[Stem(1, 5, 2)], 2)
self.assertEqual(d[Stem(2, 4, 6)], 2)
self.assertEqual(d[Stem(2, 4, 4)], 1)
assert Stem(1,5) not in d
def test_str(self):
"""Stem str should print Start, End and Length as a tuple"""
self.assertEqual(str(Stem()), '(None,None,0)')
self.assertEqual(str(Stem(3)), '(3,None,0)')
self.assertEqual(str(Stem(3,4)), '(3,4,1)')
self.assertEqual(str(Stem(3,4,5)), '(3,4,5)')
def test_nonzero(self):
"""Stem nonzero should return True if paired (length > 0)"""
assert not Stem()
assert not Stem(1)
assert Stem(7, 10)
assert Stem(1, 7, 1)
assert Stem(2, 8, 3)
#go strictly by length; don't check if data is invalid
assert Stem(0, 0)
assert Stem(5, None, 10)
assert not Stem(5, 7, -1)
class PartnersTests(TestCase):
"""Tests for Partners object"""
def test_init(self):
"""Partners should init with empty list and stay free of conflicts"""
self.assertEqual(Partners([]),[])
empty = Partners([None]*6)
self.assertEqual(empty,[None,None,None,None,None,None])
self.assertRaises(ValueError,empty.__setitem__,2,2)
empty[2] = 3
self.assertEqual(empty,[None,None,3,2,None,None])
empty[3] = 1
self.assertEqual(empty,[None,3,None,1,None,None])
empty[3] = 5
self.assertEqual(empty,[None,None,None,5,None,3])
empty[1] = None
self.assertEqual(empty,[None,None,None,5,None,3])
def test_toPairs(self):
"""Partners toPairs() should return a Pairs object"""
p = Partners([None,3,None,1,5,4])
self.assertEqualItems(p.toPairs(),[(1,3),(4,5)])
assert isinstance(p.toPairs(),Pairs)
self.assertEqual(Partners([None]*10).toPairs(),[])
def test_not_implemented(self):
"""Partners not_implemented should raise error for 'naughty' methods"""
p = Partners([None,3,1,5,4])
self.assertRaises(NotImplementedError,p.pop)
self.assertRaises(NotImplementedError,p.sort)
self.assertRaises(NotImplementedError,p.__delitem__,3)
class PairsTests(TestCase):
"""Tests for Pairs object"""
def setUp(self):
"""Pairs SetUp method for all tests"""
self.Empty = Pairs([])
self.OneList = Pairs([[1,2]])
self.OneTuple = Pairs([(1,2)])
self.MoreLists = Pairs([[2,4],[3,9],[6,36],[7,49]])
self.MoreTuples = Pairs([(2,4),(3,9),(6,36),(7,49)])
self.MulNoOverlap = Pairs([(1,10),(2,9),(3,7),(4,12)])
self.MulOverlap = Pairs([(1,2),(2,3)])
self.Doubles = Pairs([[1,2],[1,2],[2,3],[1,3]])
self.Undirected = Pairs([(2,1),(6,4),(1,7),(8,3)])
self.UndirectedNone = Pairs([(5,None),(None,3)])
self.UndirectedDouble = Pairs([(2,1),(1,2)])
self.NoPseudo = Pairs([(1,20),(2,19),(3,7),(4,6),(10,15),(11,14)])
self.NoPseudo2 = Pairs([(1,3),(4,6)])
#((.(.)).)
self.p0 = Pairs([(0,6),(1,5),(3,8)])
#(.((..(.).).))
self.p1 = Pairs([(0,9),(2,12),(3,10),(5,7)])
#((.(.(.).)).)
self.p2 = Pairs([(0,10),(1,9),(3,12),(5,7)])
#((.((.(.)).).))
self.p3 = Pairs([(0,9),(1,8),(3,14),(4,13),(6,11)])
#(.(((.((.))).)).(((.((((..))).)))).)
self.p4 = Pairs([(0,35),(2,11),(3,10),(4,9),(6,14),(7,13),(16,28),\
(17,27),(18,26),(20,33),(21,32),(22,31),(23,30)])
#(.((.).))
self.p5 = Pairs([(0,5),(2,8),(3,7)])
self.p6 = Pairs([(0,19),(2,6),(3,5),(8,14),(9,13),(10,12),\
(16,22),(17,21)])
self.p7 = Pairs([(0,20),(2,6),(3,5),(8,14),(9,10),(11,16),(12,15),\
(17,23),(18,22)])
def test_init(self):
"""Pairs should initalize with both lists and tuples"""
self.assertEqual(self.Empty,[])
self.assertEqual(self.OneList,[[1,2]])
self.assertEqual(self.OneTuple,[(1,2)])
self.assertEqual(self.MulNoOverlap,[(1,10),(2,9),(3,7),(4,12)])
self.assertEqual(self.MulOverlap,[(1,2),(2,3)])
def test_toPartners(self):
"""Pairs toPartners() should return a Partners object"""
a = Pairs([(1,5),(3,4),(6,9),(7,8)]) #normal
b = Pairs([(0,4),(2,6)]) #pseudoknot
c = Pairs([(1,6),(3,6),(4,5)]) #conflict
self.assertEqual(a.toPartners(10),[None,5,None,4,3,1,9,8,7,6])
self.assertEqual(a.toPartners(13,3),\
[None,None,None,None,8,None,7,6,4,12,11,10,9])
assert isinstance(a.toPartners(10),Partners)
self.assertEqual(b.toPartners(7),[4,None,6,None,0,None,2])
self.assertRaises(ValueError,c.toPartners,7)
self.assertEqual(c.toPartners(7,strict=False),[None,None,None,6,5,4,3])
#raises an error when try to insert something at non-existing indices
self.assertRaises(IndexError,c.toPartners,0)
def test_toVienna(self):
"""Pairs toVienna() should return a ViennaStructure if possible"""
a = Pairs([(1,5),(3,4),(6,9),(7,8)]) #normal
b = Pairs([(0,4),(2,6)]) #pseudoknot
c = Pairs([(1,6),(3,6),(4,5)]) #conflict
d = Pairs([(1,6),(3,None)])
e = Pairs([(1,9),(8,2),(7,3)]) #not directed
f = Pairs([(1,6),(2,5),(10,15),(14,11)]) # not directed
self.assertEqual(a.toVienna(10),'.(.())(())')
self.assertEqual(a.toVienna(13,offset=3),'....(.())(())')
self.assertRaises(PairError,b.toVienna,7) #pseudoknot NOT accepted
self.assertRaises(Exception,b.toVienna,7) #old test for exception
self.assertRaises(ValueError,c.toVienna,7)
#pairs containging None are being skipped
self.assertEquals(d.toVienna(7),'.(....)')
#raises error when trying to insert at non-existing indices
self.assertRaises(IndexError,a.toVienna,3)
self.assertEqual(Pairs().toVienna(3),'...')
#test when parsing in the sequence
self.assertEqual(a.toVienna('ACGUAGCUAG'),'.(.())(())')
self.assertEqual(a.toVienna(Rna('AACCGGUUAGCUA'), offset=3),\
'....(.())(())')
self.assertEqual(e.toVienna(10),'.(((...)))')
self.assertEqual(f.toVienna(20),'.((..))...((..))....')
def test_tuples(self):
"""Pairs tuples() should transform the elements of list to tuples"""
x = Pairs([])
x.tuples()
assert x == []
x = Pairs([[1,2],[3,4]])
x.tuples()
assert x == [(1,2),(3,4)]
x = Pairs([(1,2),(3,4)])
x.tuples()
assert x == [(1,2),(3,4)]
assert x != [[1,2],[3,4]]
def test_unique(self):
"""Pairs unique() should remove double occurences of certain tuples"""
self.assertEqual(self.Empty.unique(),[])
self.assertEqual(self.MoreTuples.unique(),self.MoreTuples)
self.assertEqual(self.Doubles.unique(),Pairs([(1,2),(2,3),(1,3)]))
def test_directed(self):
"""Pairs directed() should change all pairs so that a<b in (a,b)"""
self.assertEqual(self.Empty.directed(),[])
res = self.Undirected.directed()
res.sort()
self.assertEqual(res,Pairs([(1,2),(1,7),(3,8),(4,6)]))
res = self.UndirectedNone.directed()
self.assertEqual(res,Pairs([]))
res = self.UndirectedDouble.directed()
self.assertEqual(res,Pairs([(1,2)]))
def test_symmetric(self):
"""Pairs symmetric() should add (down,up) for each (up,down)"""
self.assertEqual(self.Empty.symmetric(),[])
self.assertEqualItems(self.OneTuple.symmetric(),[(2,1),(1,2)])
self.assertEqualItems(Pairs([(1,2),(1,2)]).symmetric(),[(1,2),(2,1)])
self.assertEqualItems(Pairs([(1,2),(3,4)]).symmetric(),\
[(1,2),(2,1),(3,4),(4,3)])
self.assertEqualItems(Pairs([(1,None)]).symmetric(),[])
def test_paired(self):
"""Pairs paired() should omit all pairs containing None"""
self.assertEqual(self.Empty.paired(),[])
self.assertEqual(Pairs([(1,2),(2,None),(None,3),(None,None)]).paired()\
,[(1,2)])
def test_hasConflicts(self):
"""Pairs hasConflicts() should return True if there are conflicts"""
assert not self.Empty.hasConflicts()
assert not Pairs([(1,2),(3,4)]).hasConflicts()
assert Pairs([(1,2),(2,3)]).hasConflicts()
assert Pairs([(1,2),(2,None)]).hasConflicts()
def test_mismatches(self):
"""Pairs mismatches() should return #pairs that can't be formed"""
# with plain string
self.assertEqual(Pairs([(0,1)]).mismatches('AC',{}),1)
self.assertEqual(Pairs([(0,1)]).mismatches('AC',{('A','C'):None}),0)
self.assertEqual(Pairs([(0,1)]).mismatches('AC',{('A','G'):None}),1)
self.assertEqual(Pairs([(0,1),(2,3),(3,1)]).\
mismatches('ACGU',{('A','U'):None}),3)
# using sequence with alphabet
sequence = Rna('ACGUA')
self.assertEqual(Pairs([(0,1),(0,4),(0,3)]).mismatches(sequence),2)
def test_hasPseudoknots(self):
"""Pairs hasPseudoknots() should return True if there's a pseudoknot"""
assert not self.NoPseudo.hasPseudoknots()
assert not self.NoPseudo2.hasPseudoknots()
#add tests for ((.))() etc
assert self.p0.hasPseudoknots()
assert self.p1.hasPseudoknots()
assert self.p2.hasPseudoknots()
assert self.p3.hasPseudoknots()
assert self.p4.hasPseudoknots()
assert self.p5.hasPseudoknots()
assert self.p6.hasPseudoknots()
assert self.p7.hasPseudoknots()
class StructureStringInitTests(TestCase):
"""Tests for initializing structures"""
def setUp(self):
self.Struct = ViennaStructure
self.Empty = ''
self.NoPairs = '.....'
self.OneHelix = '((((()))))'
self.ManyHelices = '(..(((...)).((.(((((..))).)))..((((..))))))...)'
self.Ends = '..(.)..' #has trailing bases at ends
self.Internal = '(((...)))..(()).' #has internal non-nested region
self.TooManyOpen = '(((...))..'
self.TooManyClosed = '((...)))..'
self.Invalid = 'fdjklgfj'
def test_init_empty(self):
"""StructureString initialization should accept an empty string"""
self.assertEqual(self.Empty, str(self.Struct(self.Empty)))
def test_init_no_pairs(self):
"""StructureString should allow a structure with no pairs"""
self.assertEqual(self.NoPairs, str(self.Struct(self.NoPairs)))
def test_init_one_helix(self):
"""StructureString should allow a structure with one helix"""
self.assertEqual(self.OneHelix, str(self.Struct(self.OneHelix)))
def test_init_long_nested(self):
"""StructureString should accept long structure w/ many nested pairs"""
self.assertEqual(self.ManyHelices,str(self.Struct(self.ManyHelices)))
def test_init_too_many_pairs_opened(self):
"""StructureString should raise IndexError if too many open pairs"""
self.assertRaises(IndexError, self.Struct, self.TooManyOpen)
def test_init_too_few_pairs_opened(self):
"""StructureString should raise IndexError if too few open pairs"""
self.assertRaises(IndexError, self.Struct, self.TooManyClosed)
def test_init_invalid_string(self):
"""StructureString should raise ValueError if invalid chars"""
self.assertRaises(ValueError, self.Struct, self.Invalid)
class WussStructureInitTests(StructureStringInitTests):
"""Test for initializing WussStructures"""
def setUp(self):
self.Struct = WussStructure
self.Empty = ''
self.NoPairs = '__--_'
self.OneHelix = '[{(<()>)}]'
self.ManyHelices = '<,,(({___})~((:((({{__}}),))),,<<[(__)]>>)):::>'
self.TooManyOpen = '{<[___]>::'
self.TooManyClosed = '<<___>>>::'
self.Invalid = '__!<><>'
class StructureStringTests(TestCase):
"""Test that StructureString methods and properties work.
By default tested on a ViennaStructure. These tests should
work for every StructureString.
"""
Struct = ViennaStructure
def setUp(self):
"""SetUp for all StructureString tests"""
self.Energy1 = 0.0
self.Energy2 = -1e-02
self.NoPairsStr = '.....'
self.NoPairs = self.Struct('.....',self.Energy1)
self.OneHelixStr = '((((()))))'
self.OneHelix = self.Struct('((((()))))',self.Energy2)
self.TwoHelixStr = '((.))(()).'
self.TwoHelix = self.Struct('((.))(()).',self.Energy1)
self.ThreeHelixStr = '(((((..))..(((..)))..)))'
self.ThreeHelix = self.Struct('(((((..))..(((..)))..)))')
self.EmptyStr = ''
self.ManyHelicesStr = '(..(((...)).((.(((((..))).)))..((((..))))))...)'
self.EndsStr = '..(.)..' #has trailing bases at ends
self.InternalStr = '(((...)))..(()).' #has internal non-nested region
def test_len(self):
"""StructureString len() should match structure length"""
self.assertEqual(len(self.TwoHelix), 10)
#Do you want the init possible with Vienna() for empty str???
self.assertEqual(len(Vienna('')), 0)
def test_getitem(self):
"""StructureString struct[index] should return char at index in struct"""
self.assertEqual(self.NoPairs[0], self.NoPairsStr[0]) #dot
self.assertEqual(self.OneHelix[0], self.OneHelixStr[0]) #close pair
#negative index, end
self.assertEqual(self.OneHelix[-1], self.OneHelixStr[-1])
#middle of sequence
self.assertEqual(self.TwoHelix[4], self.TwoHelixStr[4])
def test_getslice(self):
"""StructureString struct[a:b] should return slice from a to b"""
self.assertEqual(self.OneHelix[0:3], self.OneHelixStr[0:3])
self.assertEqual(self.OneHelix[0:0], self.OneHelixStr[0:0])
self.assertEqual(self.OneHelix[:], self.OneHelixStr[:])
self.assertEqual(self.OneHelix[4:7], self.OneHelixStr[4:7])
self.assertEqual(self.OneHelix[5:], self.OneHelixStr[5:])
def test_str(self):
"""StructureString str() should print structure and energy, if known"""
self.assertEqual(str(self.NoPairs), '..... (0.0)')
self.assertEqual(str(self.OneHelix), '((((())))) (-0.01)')
self.assertEqual(str(self.TwoHelix), '((.))(()). (0.0)')
self.assertEqual(str(self.ThreeHelix), '(((((..))..(((..)))..)))')
def test_toPartners(self):
"""StructureString toPartners() should return Partners object"""
self.assertEqual(self.NoPairs.toPartners(), [None]*5)
self.assertEqual(self.OneHelix.toPartners(),[9,8,7,6,5,4,3,2,1,0])
self.assertEqual(self.TwoHelix.toPartners(),\
[4,3,None,1,0,8,7,6,5,None])
self.assertEqual(self.ThreeHelix.toPartners(),[23,22,21,8,7,None,\
None,4,3,None,None,18,17,16,None,None,13,12,11,None,None,2,1,0])
def test_toPairs(self):
"""StructureString toPairs() should return Pairs object"""
self.assertEqual(self.NoPairs.toPairs(), [])
self.assertEqualItems(self.OneHelix.toPairs(), \
[(0,9),(1,8),(2,7),(3,6),(4,5)])
self.assertEqualItems(self.TwoHelix.toPairs(), \
[(0,4),(1,3),(5,8),(6,7)])
self.assertEqualItems(self.ThreeHelix.toPairs(), \
[(0,23),(1,22),(2,21),(3,8),(4,7),(11,18),(12,17),(13,16)])
def test_toTree(self):
"""StructureString toTree should produce correct tree"""
for struct in [self.EmptyStr, self.NoPairsStr, self.OneHelixStr, \
self.ManyHelicesStr, self.EndsStr, self.InternalStr]:
self.assertEqual(str(self.Struct(struct).toTree()), struct)
test = self.Struct(self.ManyHelicesStr).toTree()
n = test[0]
self.assertEqual(n.Start, 0)
self.assertEqual(n.End, 46)
n = test[0][2][0][0][1]
self.assertEqual(n.Start, 7)
self.assertEqual(n.End, None)
n = test[0][2][1]
self.assertEqual(n.Start, 11)
self.assertEqual(n.End, None)
n = test[0][2][2][0][1][0][0][0][0][1]
self.assertEqual(n.Start, 21)
self.assertEqual(n.End, None)
test = self.Struct(self.InternalStr).toTree()
self.assertEqual([i.Start for i in test], [0, 9, 10, 11, 15])
self.assertEqual([i.End for i in test], [8, None, None, 14, None])
class WussStructureTests(StructureStringTests):
"""Test that WussStructure methods and properties work"""
def setUp(self):
"""Define three standard structures: note differences in whitespace
and number formatting"""
self.Struct = WussStructure
super(WussStructureTests,self).setUp()
self.WussNoPairs = WussStructure('.-_,~:')
self.WussOneHelix = WussStructure('[-{<(__)-->}]',-0.01)
self.WussTwoHelix = WussStructure('{[.]}(<>).',1.11)
self.WussThreeHelix = WussStructure('::(<<({__}),,([(__)])-->>)')
self.WussPseudo = WussStructure('<<__AA>>_aa::')
def test_wuss_toPairs(self):
"""WussStructure toPairs() should return a valid Pairs object"""
self.assertEqual(self.WussNoPairs.toPairs(),[])
self.assertEqualItems(self.WussOneHelix.toPairs(),\
[(0,12),(2,11),(3,10),(4,7)])
self.assertEqualItems(self.WussTwoHelix.toPairs(),\
[(0,4),(1,3),(5,8),(6,7)])
self.assertEqualItems(self.WussThreeHelix.toPairs(),\
[(2,25),(3,24),(4,23),(5,10),(6,9),(13,20),(14,19),(15,18)])
self.assertEqualItems(self.WussPseudo.toPairs(),\
[(0,7),(1,6)])
def test_wuss_toPartners(self):
"""WussStructure toPartners() should return valid Partners object"""
self.assertEqual(self.WussNoPairs.toPartners(),[None]*6)
self.assertEqualItems(self.WussThreeHelix.toPartners(),\
[None,None,25,24,23,10,9,None,None,6,5,None,None,20,19,\
18,None,None,15,14,13,None,None,4,3,2])
self.assertEqualItems(self.WussPseudo.toPartners(),\
[7,6,None,None,None,None,1,0,None,None,None,None,None])
class Rna2dTests(TestCase):
def test_Vienna(self):
"""Vienna should initalize from several formats"""
self.NoPairs = Vienna('.......... (0.0)')
self.OneHelix = Vienna('((((())))) (-1e-02)')
self.TwoHelix = Vienna('((.))(()). \t(1.11)')
self.ThreeHelix = Vienna('(((((..))..(((..)))..)))')
self.GivenEnergy = Vienna('((.))',0.1)
self.TwoEnergies = Vienna('((.)) (4.6)',2.1)
self.assertEqual(self.NoPairs, '..........')
self.assertEqual(self.NoPairs.Energy, 0.0)
self.assertEqual(self.OneHelix, '((((()))))')
self.assertEqual(self.OneHelix.Energy, -1e-2)
self.assertEqual(self.TwoHelix, '((.))(()).')
self.assertEqual(self.TwoHelix.Energy, 1.11)
self.assertEqual(self.ThreeHelix, '(((((..))..(((..)))..)))')
self.assertEqual(self.ThreeHelix.Energy, None)
self.assertEqual(self.GivenEnergy.Energy,0.1)
self.assertEqual(self.TwoEnergies.Energy,2.1)
def test_EmptyPartners(self):
"""EmptyPartners should return list of 'None's of given length"""
self.assertEqual(EmptyPartners(0),[])
self.assertEqual(EmptyPartners(1),[None])
self.assertEqual(EmptyPartners(10),[None]*10)
def test_wuss_to_vienna(self):
"""wuss_to_vienna() should transform Wuss into Vienna"""
empty = WussStructure('.....')
normal = WussStructure('[.{[<...}}}}')
pseudo = WussStructure('[..AA..]..aa')
self.assertEqual(wuss_to_vienna(normal),'(.(((...))))')
self.assertEqual(wuss_to_vienna(empty),'.....')
self.assertEqual(wuss_to_vienna(pseudo),'(......)....')
def test_classify(self):
"""classify() should classify valid structures correctly"""
Empty = ''
NoPairs = '.....'
OneHelix = '((((()))))'
ManyHelices = '(..(((...)).((.(((((..))).)))..((((..))))))...)'
Ends = '..(.)..'
FirstEnd = '..((()))'
LastEnd = '((..((.))))...'
Internal = '(((...)))..((.)).'
#following structure is from p 25 of Eddy's WUSS description manual
Eddy = '..((((.(((...)))...((.((....))..)).)).))'
structs = [Empty, NoPairs, OneHelix, ManyHelices, Ends, \
FirstEnd, LastEnd, Internal, Eddy]
EmptyResult = ''
NoPairsResult = 'EEEEE'
OneHelixResult = 'SSSSSSSSSS'
ManyHelicesResult = 'SBBSSSLLLSSJSSBSSSSSLLSSSBSSSJJSSSSLLSSSSSSBBBS'
EndsResult = 'EESLSEE'
FirstEndResult = 'EESSSSSS'
LastEndResult = 'SSBBSSLSSSSEEE'
InternalResult = 'SSSLLLSSSFFSSLSSE'
#following structure is from p 25 of Eddy's WUSS description manual
Eddy = 'EESSSSJSSSLLLSSSJJJSSBSSLLLLSSBBSSJSSBSS'
results = [EmptyResult, NoPairsResult, OneHelixResult,
ManyHelicesResult, EndsResult, FirstEndResult, LastEndResult,
InternalResult, Eddy]
for s, r in zip(structs, results):
c = classify(s)
self.assertEqual(classify(s), r)
long_struct = ".((((((((((((((.((((((..((((.....)))))))))).))..))))))))))))....(((.((((.((((((((......((((((.((..(((((((....)))).)))..))))))))...))))))))...........(((((.(..(((((((((......((((((((((((.........))))))))))))....))))).))))..)..)))))..(((((((((((((((((((......(((((((((((((((((((((((((((((((...(((.......((((((((........)))))))).......)))...))))))))))))))))))))))))))))))).((((........(((((((((((((((((((...))))))))))))))))))).......)))).....((((((((((((((((((((((((((((((.(((...))).)))))))))))))))))))))))...........))))))).))))))))))))))))))).....)))).)))......"
#compare standalone method with classification from tree
c = classify(long_struct)
d = ViennaStructure(long_struct).toTree().classify()
self.assertEqual(c,d)
#Error is raised when trying to classify invalid structures
invalid_structure = '(((..)).))))(...)(...'
self.assertRaises(IndexError, classify, invalid_structure)
class ViennaNodeTests(TestCase):
"""Tests of the ViennaNode class."""
def setUp(self):
"""Instantiate some standard ViennaNodes."""
self.EmptyStr = ''
self.NoPairsStr = '.....'
self.OneHelixStr = '((((()))))'
self.ManyHelicesStr = '(..(((...)).((.(((((..))).)))..((((..))))))...)'
self.EndsStr = '..(.)..'
self.FirstEndStr = '..((()))'
self.LastEndStr = '((..((.))))...'
self.InternalStr = '(((...)))..((.)).'
#following structure is from p 25 of Eddy's WUSS description manual
self.EddyStr = '..((((.(((...)))...((.((....))..)).)).))'
#add in the tree versions by deleting trailing 'Str'
for s in self.__dict__.keys():
if s.endswith('Str'):
self.__dict__[s[:-3]] = \
ViennaStructure(self.__dict__[s]).toTree()
def test_str(self):
"""ViennaNode str should return Vienna-format string"""
for s in [self.EmptyStr, self.NoPairsStr, self.OneHelixStr,
self.ManyHelicesStr, self.EndsStr, self.InternalStr]:
self.assertEqual(str(ViennaStructure(s).toTree()), s)
#test with multiple-base helix in a node
r = StructureNode()
r.append(StructureNode())
r.append(StructureNode(Data=Stem(1,7,5)))
r[1].append(StructureNode())
r.append(StructureNode())
r.append(StructureNode())
r.renumber()
self.assertEqual(str(r), '.(((((.)))))..')
def test_classify(self):
"""ViennaNode classify should return correct classification string"""
self.assertEqual(self.Empty.classify(), '')
self.assertEqual(self.NoPairs.classify(), 'EEEEE')
self.assertEqual(self.OneHelix.classify(), 'SSSSSSSSSS')
self.assertEqual(self.ManyHelices.classify(), \
'SBBSSSLLLSSJSSBSSSSSLLSSSBSSSJJSSSSLLSSSSSSBBBS')
self.assertEqual(self.Ends.classify(), 'EESLSEE')
self.assertEqual(self.FirstEnd.classify(), 'EESSSSSS')
self.assertEqual(self.LastEnd.classify(), 'SSBBSSLSSSSEEE')
self.assertEqual(self.Internal.classify(), 'SSSLLLSSSFFSSLSSE')
self.assertEqual(self.Eddy.classify(), \
'EESSSSJSSSLLLSSSJJJSSBSSLLLLSSBBSSJSSBSS')
def test_renumber(self):
"""ViennaNode renumber should assign correct numbers to nodes"""
#should have no effect on empty structure
se = self.Empty
self.assertEqual(se.renumber(5), 5)
self.assertEqual((se.Start, se.End, se.Length), (None, None, 0))
#with no pairs, should number consecutively
sn = self.NoPairs
self.assertEqual(sn.renumber(5), 10)
self.assertEqual([i.Start for i in sn], [5, 6, 7, 8, 9])
self.assertEqual([i.End for i in sn], [None]*5)
self.assertEqual([i.Length for i in sn], [0]*5)
#spot checks on a complex structure
sm = self.ManyHelices
self.assertEqual(sm.renumber(5), 52)
s0 = sm[0]
self.assertEqual((s0.Start, s0.End, s0.Length), (5, 51, 1))
s5 = sm[0][2][2][0]
self.assertEqual(len(s5), 2)
self.assertEqual((s5.Start, s5.End, s5.Length), (18, 33, 1))
s6 = s5[0]
self.assertEqual((s6.Start, s6.End, s6.Length), (19,None,0))
#test with some helices of different lengths
root = StructureNode()
root.extend([StructureNode() for i in range(3)])
root.insert(1, StructureNode(Data=Stem(3, 7, 5)))
root.insert(3, StructureNode(Data=Stem(6,2,2)))
root.append(StructureNode())
self.assertEqual(root.renumber(0), 18)
self.assertEqual(len(root), 6)
curr = root[0]
self.assertEqual((curr.Start,curr.End,curr.Length), (0, None, 0))
curr = root[1]
self.assertEqual((curr.Start, curr.End, curr.Length), (1, 10, 5))
curr = root[2]
self.assertEqual((curr.Start, curr.End, curr.Length), (11, None, 0))
curr = root[3]
self.assertEqual((curr.Start, curr.End, curr.Length), (12, 15, 2))
curr = root[4]
self.assertEqual((curr.Start, curr.End, curr.Length), (16, None, 0))
curr = root[5]
self.assertEqual((curr.Start, curr.End, curr.Length), (17, None, 0))
def test_unpair(self):
"""StructureNode unpair should break a base pair and add correct nodes"""
i = self.Internal
self.assertEqual(i[0].unpair(), True)
self.assertEqual(str(i), '.((...))...((.)).')
e = self.Ends
self.assertEqual(e[0].unpair(), False)
self.assertEqual(str(e), self.EndsStr)
o = self.OneHelix
self.assertEqual(o[0].unpair(), True)
self.assertEqual(str(o), '.(((()))).')
self.assertEqual(o[1][0][0].unpair(), True)
self.assertEqual(str(o), '.((.().)).')
self.assertEqual(o[1].unpair(), True)
self.assertEqual(str(o), '..(.().)..')
self.assertEqual(o[2][1].unpair(), True)
self.assertEqual(str(o), '..(....)..')
self.assertEqual(o[2].unpair(), True)
self.assertEqual(str(o), '..........')
#test with multiple bases in helix
r = StructureNode()
r.append(StructureNode(Data=Stem(0,0, 5)))
r.renumber()
self.assertEqual(str(r), '((((()))))')
self.assertEqual(r[0].unpair(), True)
self.assertEqual(str(r), '.(((()))).')
def test_pairBefore(self):
"""StructureNode pairBefore should make a pair before the current node"""
#shouldn't be able to make any pairs if everything is paired already
o = self.OneHelix
for i in o:
self.assertEqual(i.pairBefore(), False)
n = self.NoPairs
#shouldn't be able to pair at the start...
self.assertEqual(n[0].pairBefore(), False)
#...or at the end...
self.assertEqual(n[-1].pairBefore(), False)
#...but should work OK in the middle
self.assertEqual(n[1].pairBefore(), True)
self.assertEqual(str(n), '(.)..')
e = self.Ends
self.assertEqual(e[2].pairBefore(), True)
self.assertEqual(e[1].pairBefore(), True)
self.assertEqual(str(e), '(((.)))')
self.assertEqual((e[0].Start, e[0].End, e[0].Length), (0,6,1))
def test_pairAfter(self):
"""StructureNode pairAfter should create pairs after a node"""
n = self.NoPairs
self.assertEqual(n.pairAfter(), True)
self.assertEqual(str(n), '(...)')
self.assertEqual(n[0].pairAfter(), True)
self.assertEqual(str(n), '((.))')
self.assertEqual(n[0][0].pairAfter(), False)
self.assertEqual(str(n), '((.))')
curr = n[0][0]
#check that child is correct
self.assertEqual(len(curr), 1)
self.assertEqual((curr[0].Start, curr[0].End, curr[0].Length), \
(2,None,0))
#check that pair is correct
self.assertEqual((curr.Start, curr.End, curr.Length), (1,3,1))
m = self.ManyHelices
n = m[0][2][0][0]
self.assertEqual(n.pairAfter(), True)
self.assertEqual(str(m), \
'(..((((.))).((.(((((..))).)))..((((..))))))...)')
self.assertEqual(n[0].pairAfter(), False)
def test_pairChildren(self):
"""StructureNode PairChildren should make the correct pairs"""
n = ViennaStructure('.....').toTree() #same as self.NoPairs
self.assertEqual(n.pairChildren(0, 4), True)
self.assertEqual(str(n), '(...)')
n = ViennaStructure('.....').toTree() #same as self.NoPairs
self.assertEqual(n.pairChildren(1, 4), True)
self.assertEqual(str(n), '.(..)')
n = ViennaStructure('.....').toTree() #same as self.NoPairs
#can't pair same object
self.assertEqual(n.pairChildren(1, 1), False)
self.assertEqual(str(n), '.....')
self.assertEqual(n.pairChildren(1, -1), True)
self.assertEqual(str(n), '.(..)')
#can't pair something already paired
self.assertEqual(n.pairChildren(0,1), False)
#IndexError if out of range
self.assertRaises(IndexError, n.pairChildren, 0, 5)
n.append(StructureNode())
n.append(StructureNode())
n.renumber()
self.assertEqual(str(n), '.(..)..')
self.assertEqual(n.pairChildren(0, -2), True)
self.assertEqual(str(n), '((..)).')
def test_expand(self):
"""StructureNode expand should extend helices."""
s = StructureNode(Data=(Stem(1, 10, 3)))
s.append(StructureNode())
#need to make a root node for consistency
r = StructureNode()
r.append(s)
self.assertEqual(str(s), '(((.)))')
s.expand()
self.assertEqual(str(s), '(((.)))')
self.assertEqual((s.Start, s.End, s.Length), (1, 10, 1))
n = s[0]
self.assertEqual((n.Start, n.End, n.Length), (2, 9, 1))
n = s[0][0]
self.assertEqual((n.Start, n.End, n.Length), (3, 8, 1))
n = s[0][0][0]
self.assertEqual((n.Start, n.End, n.Length), (None, None, 0))
s.renumber()
self.assertEqual((s.Start, s.End, s.Length), (0, 6, 1))
n = s[0]
self.assertEqual((n.Start, n.End, n.Length), (1, 5, 1))
n = s[0][0]
self.assertEqual((n.Start, n.End, n.Length), (2, 4, 1))
n = s[0][0][0]
self.assertEqual((n.Start, n.End, n.Length), (3, None, 0))
#check that it's not recursive
s[0][0].append(StructureNode(Data=Stem(20, 24, 2)))
s.expand()
n = s[0][0][-1]
self.assertEqual((n.Start, n.End, n.Length), (20, 24, 2))
n.expand()
self.assertEqual((n.Start, n.End, n.Length), (20, 24, 1))
n = n[0]
self.assertEqual((n.Start, n.End, n.Length), (21, 23, 1))
def test_expandAll(self):
"""StructureNode expandAll should act recursively"""
r = StructureNode()
r.append(StructureNode(Data=Stem(0, 6, 4)))
r.append(StructureNode(Data=Stem(0, 6, 3)))
r.append(StructureNode())
r[0].append(StructureNode())
r[0].append(StructureNode(Data=Stem(0,6,2)))
r[0][-1].append(StructureNode())
r.renumber()
self.assertEqual(str(r), '((((.((.))))))((())).')
r.expandAll()
self.assertEqual(str(r), '((((.((.))))))((())).')
expected_nodes = [
(None, None, 0),
(0, 13, 1),
(1, 12, 1),
(2, 11, 1),
(3, 10, 1),
(4, None, 0),
(5, 9, 1),
(6, 8, 1),
(7, None, 0),
(14, 19, 1),
(15, 18, 1),
(16, 17, 1),
(20, None, 0),
]
for obs, exp in zip(r.traverse(), expected_nodes):
self.assertEqual((obs.Start, obs.End, obs.Length), exp)
def test_collapse(self):
"""StructureNode collapse should collapse consecutive pairs from self"""
one = ViennaStructure('(.)').toTree()
self.assertEqual(one.collapse(), False)
self.assertEqual(str(one), '(.)')
two = ViennaStructure('((.))').toTree()
#can't collapse root node
self.assertEqual(two.collapse(), False)
#should be able to collapse next node
self.assertEqual(two[0].collapse(), True)
self.assertEqual((two[0].Start, two[0].End, two[0].Length), (0,4,2))
self.assertEqual(str(two), '((.))')
three = ViennaStructure('(((...)))..').toTree()
self.assertEqual(three[0].collapse(), True)
self.assertEqual((three[0].Start, three[0].End, three[0].Length), \
(0,8,3))
self.assertEqual(str(three), '(((...)))..')
self.assertEqual(three[0].collapse(), False)
self.assertEqual(three[-1].collapse(), False)
oh = self.OneHelix
self.assertEqual(oh[0].collapse(), True)
self.assertEqual(str(oh), '((((()))))')
def test_collapseAll(self):
"""StructureNode collapseAll should collapse consecutive pairs"""
for s in [self.Empty, self.NoPairs, self.OneHelix, self.ManyHelices,\
self.Ends, self.FirstEnd, self.LastEnd, self.Internal, self.Eddy]:
before = str(s)
s.collapseAll()
after = str(s)
self.assertEqual(after, before)
oh = self.OneHelix[0]
self.assertEqual((oh.Start, oh.End, oh.Length), (0,9,5))
m_obs = self.ManyHelices.traverse()
m_exp = [
(None, None, 0),
(0, 46, 1),
(1, None, 0),
(2, None, 0),
(3, 42, 1),
(4, 10, 2),
(6, None, 0),
(7, None, 0),
(8, None, 0),
(11, None, 0),
(12, 41, 1),
(13, 28, 1),
(14, None, 0),
(15, 27, 2),
(17, 24, 3),
(20, None, 0),
(21, None, 0),
(25, None, 0),
(29, None, 0),
(30, None, 0),
(31, 40, 4),
(35, None, 0),
(36, None, 0),
(43, None, 0),
(44, None, 0),
(45, None, 0),
(46, None, 0),
]
for obs, exp in zip([(i.Start, i.End, i.Length) for i in m_obs], m_exp):
self.assertEqual(obs, exp)
def test_breakBadPairs(self):
"""StructureNode breakBadPairs should eliminate mispaired bases."""
oh_str = ViennaStructure(self.OneHelixStr)
#no change if all pairs valid
oh = oh_str.toTree()
oh.breakBadPairs(Rna('CCCCCGGGGG'))
self.assertEqual(str(oh), str(oh_str))
#break everything if all pairs invalid
oh.breakBadPairs(Rna('CCCCCAAAAA'))
self.assertEqual(str(oh), '..........')
#break a single pair
oh = oh_str.toTree()
oh.breakBadPairs(Rna('GCCCCGGGGG'))
self.assertEqual(str(oh), '.(((()))).')
#break two pairs
oh = oh_str.toTree()
oh.breakBadPairs(Rna('GCCCCCGGGG'))
self.assertEqual(str(oh), '.(((..))).')
#break internal pairs
oh = oh_str.toTree()
oh.breakBadPairs(Rna('GCCGCGGGGG'))
self.assertEqual(str(oh), '.((.().)).')
#repeat with multiple independent helices
th_str = ViennaStructure('((.)).((.))')
th = th_str.toTree()
th.breakBadPairs(Rna('CCUGGCUUCGG'))
self.assertEqual(str(th), th_str)
th.breakBadPairs(Rna('CGUAGCAGUUU'))
self.assertEqual(str(th), '(...).((.))')
th = th_str.toTree()
th.breakBadPairs(Rna('UUUUUUUUUUU'))
self.assertEqual(str(th), '...........')
def test_extendHelix(self):
"""StructureNode extendHelix should extend the helix as far as possible
"""
#single paired node is root[4]
op_str = ViennaStructure('....(......)...')
op = op_str.toTree()
#can't extend if base pairs not allowed
op[4].extendHelix(Rna('AAAAAAAAAAAAAAA'))
self.assertEqual(str(op), op_str)
#should extend a pair 5'
op[4].extendHelix(Rna('AAACCAAAAAAGGAA'))
self.assertEqual(str(op), '...((......))..')
#should extend multiple pairs 5'
op = op_str.toTree()
op[4].extendHelix(Rna('CCCCCUUUUUUGGGG'))
self.assertEqual(str(op), '.((((......))))')
#should extend a pair 3', but must leave > 2-base loop
op = op_str.toTree()
op[4].extendHelix(Rna('AAAACCCCGGGGAAA'))
self.assertEqual(str(op), '....((....))...')
op[4][0].insert(1, StructureNode(Data=Stem(Start=1,End=1,Length=1)))
op.renumber()
self.assertEqual(str(op), '....((.()...))...')
op[4][0].extendHelix(Rna( 'AAAACCCUACGGGGAAA'))
self.assertEqual(str(op), '....(((()..)))...')
#should extend a pair in both directions if possible
op = op_str.toTree()
op[4].extendHelix(Rna('AAACCCAAAAGGGAA'))
self.assertEqual(str(op), '...(((....)))..')
def test_extendHelices(self):
"""StructureNode extendHelices should extend all helices"""
e = ViennaStructure('........')
t = e.toTree()
t.extendHelices(Rna('CCCCCCCCCC'))
self.assertEqual(str(t), e)
#no pairs if sequence can't form them
s = ViennaStructure('(.....(...)..)...((.....))...')
r = Rna('AAAAAAAAAAAAAAAAAAAAAAAAAAAAA')
t = s.toTree()
t.extendHelices(r)
self.assertEqual(str(t), s)
#should be able to extend a single helix
s = ViennaStructure('(.....(...)..)...((.....))...')
r = Rna('CAAAAACAAAGAAGCCCCCCCAGGGGGGG')
t = s.toTree()
t.extendHelices(r)
self.assertEqual(str(t), '(.....(...)..)((((((...))))))')
#should be able to extend multiple helices
s = ViennaStructure('(.....(...)..)...((.....))...')
r = Rna('AAAAACCCAGGGUUCCCCCAUAAAGGGAA')
t = s.toTree()
t.extendHelices(r)
self.assertEqual(str(t), '((...((...))))..(((.....)))..')
def test_fitSeq(self):
"""StructureNode fitSeq should adjust structure to match sequence"""
#this is just a minimal test, since we know that both breakBadPairs()
#and extendHelices() work fine with more extensive tests.
s = ViennaStructure('..(((.....)))......(((.....)))...')
r = Rna( 'UCCCCACUGAGGGGUUUGGGGGGUUUUCGCCCU')
t = s.toTree()
t.fitSeq(r)
self.assertEqual(str(t), '.((((.....))))...(((.((...)).))).')
#run the test suites if invoked as a script from the command line
if __name__ == "__main__":
main()
|