1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255
|
***************************
Estimating periodic signals
***************************
.. sectionauthor:: Gavin Huttley, Julien Epps, Hua Ying
We consider two different scenarios:
- estimating the periods in a signal
- estimating the power for a given period
- measuring statistical significance for the latter case
Estimating the periods in a signal
==================================
For numerical (continuous) data
-------------------------------
We first make some sample data. A periodic signal and some noise.
..
We set a seed for the random number generator so that we can get
consistent generation of the same series. This makes the document
robust for doctesting.
.. doctest::
:hide:
>>> import numpy
>>> numpy.random.seed(11)
.. doctest::
>>> import numpy
>>> t = numpy.arange(0, 10, 0.1)
>>> n = numpy.random.randn(len(t))
>>> nse = numpy.convolve(n, numpy.exp(-t/0.05))*0.1
>>> nse = nse[:len(t)]
>>> sig = numpy.sin(2*numpy.pi*t) + nse
Discrete Fourier transform
^^^^^^^^^^^^^^^^^^^^^^^^^^
We now use the discrete Fourier transform to estimate periodicity in this signal. Given we set the period to equal 10, we expect the maximum power for that index.
.. doctest::
>>> from cogent.maths.period import dft
>>> pwr, period = dft(sig)
>>> print period
[ 2. 2.04081633 2.08333333 2.12765957 2.17391304
2.22222222 2.27272727 2.3255814 2.38095238 2.43902439
2.5 2.56410256 2.63157895 2.7027027 2.77777778
2.85714286 2.94117647 3.03030303 3.125 3.22580645...
>>> print pwr
[ 1.06015801 +0.00000000e+00j 0.74686707 -1.93971914e-02j
0.36784793 -2.66370366e-02j 0.04384413 +2.86970840e-02j
1.54473269 -2.43777386e-02j 0.28522968 -2.33602932e-01j...
The power (``pwr``) is returned as an array of complex numbers, so we convert into real numbers using ``abs``. We then zip the power and corresponding periods and sort to identify the period with maximum signal.
>>> pwr = abs(pwr)
>>> max_pwr, max_period = sorted(zip(pwr,period))[-1]
>>> print max_pwr, max_period
50.7685934719 10.0
Auto-correlation
^^^^^^^^^^^^^^^^
We now use auto-correlation.
.. doctest::
>>> from cogent.maths.period import auto_corr
>>> pwr, period = auto_corr(sig)
>>> print period
[ 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24...
>>> print pwr
[ 1.63366075e+01 -1.47309007e+01 -3.99310414e+01 -4.94779387e+01...
We then zip the power and corresponding periods and sort to identify the period with maximum signal.
.. doctest::
>>> max_pwr, max_period = sorted(zip(pwr,period))[-1]
>>> print max_pwr, max_period
46.7917300733 10
For symbolic data
-----------------
We create a sequence as just a string
.. doctest::
>>> s = 'ATCGTTGGGACCGGTTCAAGTTTTGGAACTCGCAAGGGGTGAATGGTCTTCGTCTAACGCTGG'\
... 'GGAACCCTGAATCGTTGTAACGCTGGGGTCTTTAACCGTTCTAATTTAACGCTGGGGGGTTCT'\
... 'AATTTTTAACCGCGGAATTGCGTC'
We then specify the motifs whose occurrences will be converted into 1, with all other motifs converted into 0. As we might want to do this in batches for many sequences we use a factory function.
.. doctest::
>>> from cogent.maths.stats.period import SeqToSymbols
>>> seq_to_symbols = SeqToSymbols(['AA', 'TT', 'AT'])
>>> symbols = seq_to_symbols(s)
>>> len(symbols) == len(s)
True
>>> symbols
array([1, 0, 0, 0, 1, 0, 0, 0, 0, 0...
We then estimate the integer discrete Fourier transform for the full data. To do this, we need to pass in the symbols from full conversion of the sequence. The returned values are the powers and periods.
.. doctest::
>>> from cogent.maths.period import ipdft
>>> powers, periods = ipdft(symbols)
>>> powers #doctest: +SKIP
array([ 3.22082108e-14, 4.00000000e+00, 9.48683298e+00,
6.74585634e+00, 3.46410162e+00, 3.20674669e+00,...
>>> periods
array([ 2, 3, 4...
We can also compute the auto-correlation statistic, and the hybrid (which combines IPDFT and auto-correlation).
.. doctest::
>>> from cogent.maths.period import auto_corr, hybrid
>>> powers, periods = auto_corr(symbols)
>>> powers
array([ 11., 9., 11., 9., 6...
>>> periods
array([ 2, 3, 4...
>>> powers, periods = hybrid(symbols)
>>> powers #doctest: +SKIP
array([ 3.54290319e-13, 3.60000000e+01, 1.04355163e+02,
6.07127071e+01, 2.07846097e+01, 2.88607202e+01,...
>>> periods
array([ 2, 3, 4...
Estimating power for specified period
=====================================
For numerical (continuous) data
-------------------------------
We just use ``sig`` created above. The Goertzel algorithm gives the same result as the ``dft``.
.. doctest::
>>> from cogent.maths.period import goertzel
>>> pwr = goertzel(sig, 10)
>>> print pwr
50.7685934719
For symbolic data
-----------------
.. take example above and show how to compute it using autocorrelation
We use the symbols from the above example. For the ``ipdft``, ``auto_corr`` and ``hybrid`` functions we just need to identify the array index containing the period of interest and slice the corresponding value from the returned powers. The reported periods start at ``llim``, which defaults to 2, but indexes start at 0, the index for a period-5 is simply 5-``llim``.
.. doctest::
>>> powers, periods = auto_corr(symbols)
>>> llim = 2
>>> period5 = 5-llim
>>> periods[period5]
5
>>> powers[period5]
9.0
For Fourier techniques, we can compute the power for a specific period more efficiently using Goertzel algorithm.
.. doctest::
>>> from cogent.maths.period import goertzel
>>> period = 4
>>> power = goertzel(symbols, period)
>>> ipdft_powers, periods = ipdft(symbols)
>>> ipdft_power = abs(ipdft_powers[period-llim])
>>> round(power, 6) == round(ipdft_power, 6)
True
>>> power
9.4868...
It's also possible to specify a period to the stand-alone functions. As per the ``goertzel`` function, just the power is returned.
.. doctest::
>>> power = hybrid(symbols, period=period)
>>> power
104.355...
Measuring statistical significance of periodic signals
======================================================
For numerical (continuous data)
-------------------------------
We use the signal provided above. Because significance testing is being done using a resampling approach, we define a calculator which precomputes some values to improve compute performance. For a continuous signal, we'll use the Goertzel algorithm.
.. doctest::
>>> from cogent.maths.period import Goertzel
>>> goertzel_calc = Goertzel(len(sig), period=10)
Having defined this, we then just pass this calculator to the ``blockwise_bootstrap`` function. The other critical settings are the ``block_size`` which specifies the size of segments of contiguous sequence positions to use for sampling and ``num_reps`` which is the number of permuted replicate sequences to generate.
.. doctest::
>>> from cogent.maths.stats.period import blockwise_bootstrap
>>> obs_stat, p = blockwise_bootstrap(sig, calc=goertzel_calc, block_size=10,
... num_reps=1000)
>>> print obs_stat
50.7685934719
>>> print p
0.0
For symbolic data
-----------------
Permutation testing
^^^^^^^^^^^^^^^^^^^
The very notion of permutation testing for periods, applied to a genome, requires the compute performance be as quick as possible. This means providing as much information up front as possible. We have made the implementation flexible by not assuming how the user will convert sequences to symbols. It's also the case that numerous windows of exactly the same size are being assessed. Accordingly, we use a class to construct a fixed signal length evaluator. We do this for the hybrid metric first.
.. doctest::
>>> from cogent.maths.period import Hybrid
>>> len(s)
150
>>> hybrid_calculator = Hybrid(len(s), period = 4)
.. note:: We defined the period length of interest in defining this calculator because we're interested in dinucleotide motifs.
We then construct a seq-to-symbol convertor.
.. doctest::
>>> from cogent.maths.stats.period import SeqToSymbols
>>> seq_to_symbols = SeqToSymbols(['AA', 'TT', 'AT'], length=len(s))
The rest is as per the analysis using ``Goertzel`` above.
.. doctest::
>>> from cogent.maths.stats.period import blockwise_bootstrap
>>> stat, p = blockwise_bootstrap(s, calc=hybrid_calculator,
... block_size=10, num_reps=1000, seq_to_symbols=seq_to_symbols)
...
>>> print stat
104.35...
>>> p < 0.1
True
|