1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67
|
#!/usr/bin/env python
from os import remove
from cogent.util.unit_test import TestCase, main
from cogent.app.rnaforester import RNAforester
__author__ = "Shandy Wikman"
__copyright__ = "Copyright 2007-2012, The Cogent Project"
__contributors__ = ["Shandy Wikman"]
__license__ = "GPL"
__version__ = "1.5.3"
__maintainer__ = "Shandy Wikman"
__email__ = "ens01svn@cs.umu.se"
__status__ = "Development"
class RnaforesterTest(TestCase):
"""Tests for Rnaforester application controller"""
def setUp(self):
self.input = rnaforester_input
def test_stdout_input_as_lines(self):
"""Test rnaforester stdout input as lines"""
r = RNAforester(InputHandler='_input_as_lines')
exp = '%s\n' % '\n'.join([str(i).strip('\n') for i in rnaforester_stdout])
res = r(self.input)
obs = res['StdOut'].read()
self.assertEqual(obs,exp)
res.cleanUp()
def test_stdout_input_as_string(self):
"""Test rnaforester stdout input as string"""
r = RNAforester()
exp = '%s\n' % '\n'.join([str(i).strip('\n') for i in rnaforester_stdout])
f = open('/tmp/input.fasta','w')
txt = '\n'.join([str(i).strip('\n') for i in self.input])
f.write(txt)
f.close()
res = r('/tmp/input.fasta')
obs = res['StdOut'].read()
self.assertEqual(obs,exp)
res.cleanUp()
remove('/tmp/input.fasta')
def test_get_result_path(self):
"""Tests rnaforester result path"""
r = RNAforester(InputHandler='_input_as_lines')
res = r(self.input)
self.assertEqualItems(res.keys(),['StdOut','StdErr','ExitStatus'])
self.assertEqual(res['ExitStatus'],0)
assert res['StdOut'] is not None
res.cleanUp()
rnaforester_input = ['>seq1\n',
'GGCCACGTAGCTCAGTCGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGTTGGTTCAATTCCAACCGTGGCCACCA\n', '>seq2\n',
'GCCAGATAGCTCAGTCGGTAGAGCGTTCGCCTGAAAAGTGAAAGGTCGCCGGTTCGATCCCGGCTCTGGCCACCA\n']
rnaforester_stdout = ['*** Scoring parameters ***\n', '\n', 'Scoring type: similarity\n', 'Scoring parameters:\n', 'pm: 10\n', 'pd: -5\n', 'bm: 1\n', 'br: 0\n', 'bd: -10\n', '\n', '\n', 'Input string (upper or lower case); & to end for multiple alignments, @ to quit\n', '....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8\n', '\n', '*** Calculation ***\n', '\n', 'clustering threshold is: 0.7\n', 'join clusters cutoff is: 0\n', '\n', 'Computing all pairwise similarities\n', '2,1: 0.74606\n', '\n', 'joining alignments:\n', '1,2: 0.74606 -> 1\n', 'Calculate similarities to other clusters\n', '\n', '\n', '*** Results ***\n', '\n', 'Minimum basepair probability for consensus structure (-cmin): 0.5\n', '\n', 'RNA Structure Cluster Nr: 1\n', 'Score: 264.25\n', 'Members: 2\n', '\n', 'seq1 ggccacguagcucagucgguagagcaaaggacugaaaauccuugugucguugguu\n', 'seq2 -gccagauagcucagucgguagagcguucgccugaaaagugaaaggucgccgguu\n', ' **** ****************** * ******* **** ****\n', '\n', 'seq1 caauuccaaccguggccacca\n', 'seq2 cgaucccggcucuggccacca\n', ' * ** ** * *********\n', '\n', 'seq1 (((((((..((((........)))).(((((.......))))).....(((((..\n', 'seq2 -((((((..((((........)))).((((.((....)))))).....(((((..\n', ' ***************************** **** *****************\n', '\n', 'seq1 .....))))))))))))....\n', 'seq2 .....))))))))))).....\n', ' **************** ****\n', '\n', '\n', 'Consensus sequence/structure:\n', ' 100% **** ****************** * ******* **** ****\n', ' 90% **** ****************** * ******* **** ****\n', ' 80% **** ****************** * ******* **** ****\n', ' 70% **** ****************** * ******* **** ****\n', ' 60% **** ****************** * ******* **** ****\n', ' 50% *******************************************************\n', ' 40% *******************************************************\n', ' 30% *******************************************************\n', ' 20% *******************************************************\n', ' 10% *******************************************************\n', ' ggccacauagcucagucgguagagcaaacgacugaaaagccaaaggucgccgguu\n', ' (((((((..((((........)))).((((.((....)))))).....(((((..\n', ' 10% *******************************************************\n', ' 20% *******************************************************\n', ' 30% *******************************************************\n', ' 40% *******************************************************\n', ' 50% *******************************************************\n', ' 60% *******************************************************\n', ' 70% ****************************** **** ****************\n', ' 80% ****************************** **** ****************\n', ' 90% ****************************** **** ****************\n', ' 100% ****************************** **** ****************\n', '\n', ' 100% * ** ** * *********\n', ' 90% * ** ** * *********\n', ' 80% * ** ** * *********\n', ' 70% * ** ** * *********\n', ' 60% * ** ** * *********\n', ' 50% *********************\n', ' 40% *********************\n', ' 30% *********************\n', ' 20% *********************\n', ' 10% *********************\n', ' caaucccaacccuggccacca\n', ' .....))))))))))))....\n', ' 10% *********************\n', ' 20% *********************\n', ' 30% *********************\n', ' 40% *********************\n', ' 50% *********************\n', ' 60% *********************\n', ' 70% **************** ****\n', ' 80% **************** ****\n', ' 90% **************** ****\n', ' 100% **************** ****\n', '\n', '\n']
if __name__ == '__main__':
main()
|