1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164
|
#!/usr/bin/env python
"""test_sequence_generator.py: tests of the sequence_generator module.
"""
from cogent.seqsim.sequence_generators import permutations, combinations, \
SequenceGenerator, Partition, Composition, \
MageFrequencies, SequenceHandle, IUPAC_DNA, IUPAC_RNA, BaseFrequency, \
PairFrequency, BasePairFrequency, RegionModel, ConstantRegion, \
UnpairedRegion, ShuffledRegion, PairedRegion, MatchingRegion, \
SequenceModel, Rule, Motif, Module, SequenceEmbedder
from StringIO import StringIO
from operator import mul
from sys import path
from cogent.maths.stats.util import Freqs
from cogent.util.misc import app_path
from cogent.struct.rna2d import ViennaStructure
from cogent.util.unit_test import TestCase, main
__author__ = "Rob Knight"
__copyright__ = "Copyright 2007-2012, The Cogent Project"
__credits__ = ["Rob Knight", "Daniel McDonald"]
__license__ = "GPL"
__version__ = "1.5.3"
__maintainer__ = "Rob Knight"
__email__ = "rob@spot.colorado.edu"
__status__ = "Development"
#need to skip some tests if RNAfold absent
if app_path('RNAfold'):
RNAFOLD_PRESENT = True
else:
RNAFOLD_PRESENT = False
class FunctionTests(TestCase):
"""Tests of standalone functions"""
def setUp(self):
self.standards = (0, 1, 5, 30, 173, 1000, 4382)
def test_permuations_negative_k(self):
"""permutations should raise IndexError if k negative"""
self.assertRaises(IndexError, permutations, 3, -1)
def test_permutations_k_more_than_n(self):
"""permutations should raise IndexError if k > n"""
self.assertRaises(IndexError, permutations, 3, 4)
def test_permutations_negative_n(self):
"""permutations should raise IndexError if n negative"""
self.assertRaises(IndexError, permutations, -3, -2)
def test_permutations_k_equals_1(self):
"""permutations should return n if k=1"""
for n in self.standards[1:]:
self.assertEqual(permutations(n,1), n)
def test_permutations_k_equals_2(self):
"""permutations should return n*(n-1) if k=2"""
for n in self.standards[2:]:
self.assertEqual(permutations(n,2), n*(n-1))
def test_permutations_k_equals_n(self):
"""permutations should return n! if k=n"""
for n in self.standards[1:]:
self.assertEqual(permutations(n,n), reduce(mul, range(1,n+1)))
def test_combinations_k_equals_n(self):
"""combinations should return 1 if k = n"""
for n in self.standards:
self.assertEqual(combinations(n,n), 1)
def test_combinations_k_equals_n_minus_1(self):
"""combinations should return n if k=(n-1)"""
for n in self.standards[1:]:
self.assertEqual(combinations(n, n-1), n)
def test_combinations_zero_k(self):
"""combinations should return 1 if k is zero"""
for n in self.standards:
self.assertEqual(combinations(n, 0), 1)
def test_combinations_symmetry(self):
"""combinations(n,k) should equal combinations(n,n-k)"""
for n in self.standards[3:]:
for k in (0, 1, 5, 18):
self.assertEquals(combinations(n, k), combinations(n, n-k))
def test_combinations_arbitrary_values(self):
"""combinations(n,k) should equal results from spreadsheet"""
results = {
30:{0:1, 1:30, 5:142506, 18:86493225, 29:30, 30:1},
173:{0:1, 1:173, 5:1218218079, 18:1.204353e24, 29:7.524850e32, \
30:3.611928e33},
1000:{0:1, 1:1000, 5:8.2502913e12, 18:1.339124e38,29:7.506513e55, \
30:2.429608e57},
4382:{0:1, 1:4382, 5:1.343350e16, 18:5.352761e49, 29:4.184411e74, \
30:6.0715804e76},
}
for n in self.standards[3:]:
for k in (0, 1, 5, 18, 29, 30):
self.assertFloatEqualRel(combinations(n,k), results[n][k], 1e-5)
class SequenceGeneratorTests(TestCase):
"""Tests of SequenceGenerator, which fills in degenerate bases"""
def setUp(self):
"""Defines a few standard generators"""
self.rna_codons = SequenceGenerator('NNN')
self.dna_iupac_small = SequenceGenerator('RH', IUPAC_DNA)
self.empty = SequenceGenerator('')
self.huge = SequenceGenerator('N'*50)
self.binary = SequenceGenerator('01??01', {'0':'0','1':'1','?':'10'})
def test_len(self):
"""len(SequenceGenerator) should return number of possible matches"""
lengths = ((self.rna_codons, 64), (self.dna_iupac_small, 6),
(self.empty, 0), (self.binary, 4))
for item, expected in lengths:
self.assertEqual(len(item), expected)
try:
len(self.huge)
except OverflowError:
pass
else:
raise AssertionError, "Failed to raise expected OverflowError"
def test_numPossibilities(self):
"""SequenceGenerator.numPossibilities() should be robust to overflow"""
lengths = ((self.rna_codons, 64), (self.dna_iupac_small, 6),
(self.empty, 0), (self.binary, 4), (self.huge, 4**50))
for item, expected in lengths:
self.assertEqual(item.numPossibilities(), expected)
def test_sequences(self):
"""SequenceGenerator should produce the correct list of sequences"""
self.assertEqual(list(self.empty), [])
self.assertEqual(list(self.dna_iupac_small), \
['AT','AC','AA','GT','GC','GA'])
codons = []
for first in 'UCAG':
for second in 'UCAG':
for third in 'UCAG':
codons.append(''.join([first, second, third]))
self.assertEqual(list(self.rna_codons), codons)
#test that it still works if we call the generator a second time
self.assertEqual(list(self.rna_codons), codons)
def test_iter(self):
"""SequenceGenerator should act like a list with for..in syntax"""
as_list = list(self.rna_codons)
for obs, exp in zip(self.rna_codons, as_list):
self.assertEqual(obs, exp)
def test_getitem(self):
"""SequenceGenerator should allow __getitem__ like a list"""
as_list = list(self.rna_codons)
for i in range(64):
self.assertEqual(self.rna_codons[i], as_list[i])
for i in range(1,65):
self.assertEqual(self.rna_codons[-i], as_list[-i])
self.assertEqual(self.huge[-1], 'G'*50)
def test_getitem_slices(self):
"""SequenceGenerator slicing should work the same as a list"""
e = list(self.rna_codons)
o = self.rna_codons
values = (
(o[:], e[:]),
(o[0:], e[0:]),
(o[1:], e[1:]),
(o[5:], e[5:]),
(o[0:5], e[0:5]),
(o[1:5], e[1:5]),
(o[5:5], e[5:5]),
(o[0:1], e[0:1]),
(o[len(o)-1:len(o)], e[len(e)-1:len(e)]),
(o[len(o):len(o)], e[len(e):len(e)]),
)
testnum = 0
for obs, exp in values:
testnum += 1
self.assertEqual(list(obs), exp)
big = list(self.huge[1:5])
self.assertEqual(['U'*49+'C', 'U'*49+'A', 'U'*49+'G', 'U'*48+'CU'], big)
class PartitionTests(TestCase):
"""Tests of the Paritition object."""
def test_single_partition(self):
"""If number of objects = bins * min, only one way to partition"""
for num_bins in range(1, 10):
for occupancy in range(10):
self.assertEqual(len(Partition(num_bins*occupancy,
num_bins, occupancy)), 1)
def test_partitions(self):
"""Test several properties of partitions, especially start/end"""
for num_bins in range(1, 5):
for occupancy in range(5):
for num_items in \
range(num_bins*occupancy, num_bins*occupancy + 10):
p = Partition(num_items, num_bins, occupancy)
l = [i for i in p]
l2 = [i for i in p]
#check that calling it twice doesn't break it
self.assertEqual(l, l2)
#check the lengths
self.assertEqual(len(p), len(l))
#check the ranges are the same...
self.assertEqual(l[0][1:], l[-1][0:-1])
#and that they contain the right values.
self.assertEqual(l[0][1:], [occupancy]*(num_bins - 1))
#check the first and last elements
self.assertEqual(l[0][0], l[-1][-1])
self.assertEqual(l[0][0], \
num_items - occupancy * (num_bins - 1))
def test_values(self):
"""Partition should match precalculated values"""
self.assertEqual(len(Partition(20, 4, 1)), 969)
def test_str(self):
"""str(partition) should work as expected"""
p = Partition(20,4,1)
self.assertEqual(str(p), "Items: 20 Pieces: 4 Min Per Piece: 1")
p.NumItems = 13
p.NumPieces = 2
p.MinOccupancy = 0
self.assertEqual(len(p), len(Partition(13, 2, 0)))
self.assertEqual(str(p), "Items: 13 Pieces: 2 Min Per Piece: 0")
class CompositionTests(TestCase):
"""Tests of the Composition class."""
def setUp(self):
"""Define a few standard compositions."""
self.bases_10pct = Composition(10, 0, "ACGU")
self.bases_5pct = Composition(5, 1, "ACGU")
self.bases_extra = Composition(10, 0, "CYGEJ")
self.small = Composition(20, 0, "xy")
self.unique = Composition(20, 1, "z")
def test_lengths(self):
"""Composition should return correct number of elements"""
self.assertEqual(len(self.bases_10pct), len(Partition(10,4,0)))
self.assertEqual(len(self.bases_5pct), len(Partition(20,4,1)))
self.assertEqual(len(self.bases_extra), len(Partition(10,5,0)))
self.assertEqual(len(self.small), len(Partition(5, 2, 0)))
self.assertEqual(len(self.unique), len(Partition(5, 1, 1)))
def test_known_vals(self):
"""Composition should return precalculated elements for known cases"""
self.assertEqual(len(Composition(5,1,"ACGU")), 969)
self.assertEqual(len(Composition(5,0,"ACGU")), 1771)
as_list = list(Composition(5,1,"ACGU"))
self.assertEqual(as_list[0], Freqs('A'*17+'CGU'))
self.assertEqual(as_list[-1], Freqs('U'*17+'ACG'))
def test_updating(self):
"""Composition updates should reset frequencies correctly."""
exp_list = list(Composition(5, 1, "GCAUN"))
self.bases_10pct.Spacing = 5
self.bases_10pct.Alphabet = "GCAUN"
self.bases_10pct.MinOccupancy = 1
self.assertEqual(list(self.bases_10pct), exp_list)
class MageFrequenciesTests(TestCase):
"""Tests of the MageFrequencies class -- presentation for Composition."""
def setUp(self):
"""Define a few standard compositions."""
self.bases_10pct = Composition(10, 0, "ACGU")
def test_str(self):
"""MageFrequencies string conversions work correctly"""
obs_list = list(self.bases_10pct)
self.assertEqual(str(MageFrequencies(obs_list[0])), '1.0 0.0 0.0')
self.assertEqual(str(MageFrequencies(obs_list[-1], "last")), \
'{last} 0.0 0.0 0.0')
self.assertEqual(str(MageFrequencies({'C':2, 'A':3, 'T':5, 'x':17}, \
'bases')), '{bases} 0.3 0.2 0.0')
class SequenceHandleTests(TestCase):
"""Tests of the SequenceHandle class."""
def setUp(self):
"""Define some standard SequenceHandles."""
self.rna = SequenceHandle('uuca', 'ucag')
self.any = SequenceHandle(['u', 1, None])
self.empty = SequenceHandle()
def test_init_good(self):
"""SequenceHandle should init OK without alphabet"""
self.assertEqual(SequenceHandle('abc123'), list('abc123'))
self.assertEqual(SequenceHandle(), list())
self.assertEqual(SequenceHandle('abcaaa', 'abcd'), list('abcaaa'))
self.assertEqual(SequenceHandle([1,2,3]), [1,2,3])
def test_init_bad(self):
"""SequenceHandle should raise ValueError if item not in alphabet"""
self.assertRaises(ValueError, SequenceHandle, 'abc1', 'abc')
self.assertRaises(ValueError, SequenceHandle, '1', [1])
def test_setitem_good(self):
"""SequenceHandle setitem should allow items in alphabet"""
self.rna[0] = 'c'
self.assertEqual(self.rna, list('cuca'))
self.rna[-1] = 'u'
self.assertEqual(self.rna, list('cucu'))
self.any[1] = [1, 2, 3]
self.assertEqual(self.any, ['u', [1, 2, 3], None])
def test_setitem_bad(self):
"""SequenceHandle setitem should reject items not in alphabet"""
self.assertRaises(ValueError, self.rna.__setitem__, 0, 'x')
def test_setslice_good(self):
"""SequenceHandle setslice should allow same-length slice"""
self.rna[:] = list('aaaa')
self.assertEqual(self.rna, list('aaaa'))
self.rna[0:1] = ['u']
self.assertEqual(self.rna, list('uaaa'))
self.rna[-2:] = ['g','g']
self.assertEqual(self.rna, list('uagg'))
def test_setslice_bad(self):
"""SequenceHandle setslice should reject bad items or length change"""
self.assertRaises(ValueError, self.rna.__setslice__, 0, len(self.rna), \
['a']*5)
self.assertRaises(ValueError, self.any.__setslice__, 0, len(self.any), \
['a']*5)
self.assertRaises(ValueError, self.rna.__setslice__, 0, 1, ['x'])
def test_string(self):
"""SequenceHandle str should join items without spaces"""
#use ''.join if items are strings
self.assertEqual(str(self.rna), 'uuca')
self.assertEqual(str(self.empty), '')
#if some of the items raise errors, use built-in method instead
self.assertEqual(str(self.any), str(['u', 1, None]))
def test_naughty_methods(self):
"""SequenceHandle list mutators should raise NotImplementedError"""
r = self.rna
naughty = [r.__delitem__, r.__delslice__, r.__iadd__, r.__imul__, \
r.append, r.extend, r.insert, r.pop, r.remove]
for n in naughty:
self.assertRaises(NotImplementedError, n)
class BaseFrequencyTests(TestCase):
"""Tests of BaseFrequency class: wrapper for FrequencyDistibution."""
def test_init(self):
"""BaseFrequency should init as expected"""
self.assertEqual(BaseFrequency('UUUCCCCAG'), \
Freqs('UUUCCCCAG', 'UCAG'))
self.assertEqual(BaseFrequency('TTTCAGG', RNA=False), \
Freqs('TTTCAGG'))
def test_init_bad(self):
"""BaseFrequency init should disallow bad characters"""
self.assertRaises(Exception, BaseFrequency, 'TTTCAGG')
self.assertRaises(Exception, BaseFrequency, 'UACGUA', False)
class PairFrequencyTests(TestCase):
"""Tests of PairFrequency class: wrapper for Freqs."""
def test_init_one_parameter(self):
"""PairFrequency should interpret single parameter as pair probs"""
obs = PairFrequency('UCCC')
exp = Freqs({('U','U'):0.0625, ('U','C'):0.1875,
('C','U'):0.1875, ('C','C'):0.5625})
for k, v in exp.items():
self.assertEqual(v, obs[k])
for k, v in obs.items():
if k not in exp:
self.assertEqual(v, 0)
self.assertEqual(PairFrequency('UCCC', [('U','U'),('C','C')]), \
Freqs({('U','U'):0.1, ('C','C'):0.9}))
#check that the alphabets are right: should not raise error on
#incrementing characters already there, but should raise KeyError
#on anything that's missing.
p = PairFrequency('UCCC')
p[('U','U')] += 1
try:
p[('X','U')] += 1
except KeyError:
pass
else:
raise AssertionError, "Expected KeyError."
p = PairFrequency('UCCC', (('C','C'),))
p[('C','C')] += 1
try:
p[('U','U')] += 1
except KeyError:
pass
else:
raise AssertionError, "Expected KeyError."
class BasePairFrequencyTests(TestCase):
"""Tests of the BaseFrequency class, constructed for easy initialization."""
def test_init(self):
"""BaseFrequency init should provide correct PairFrequency"""
WatsonCrick = [('A','U'), ('U','A'),('G','C'),('C','G')]
Wobble = WatsonCrick + [('G','U'), ('U','G')]
#by default, basepair should have the wobble alphabet
bpf = BasePairFrequency('UUACG')
pf = PairFrequency('UUACG', Wobble)
self.assertEqual(bpf, pf)
self.assertEqual(bpf.Constraint, pf.Constraint)
#can turn GU off, leading to watson-crickery
bpf = BasePairFrequency('UUACG', False)
#make sure this gives different results...
self.assertNotEqual(bpf, pf)
self.assertNotEqual(bpf.Constraint, pf.Constraint)
#...but that the results are the same when the correct alphabet is used
pf = PairFrequency('UUACG', WatsonCrick)
self.assertEqual(bpf, pf)
self.assertEqual(bpf.Constraint, pf.Constraint)
class RegionModelTests(TestCase):
"""Tests of the RegionModel class. Base class just returns the template."""
def test_init(self):
"""RegionModel base class should always return current template."""
#test blank region model
r = RegionModel()
self.assertEqual(str(r.Current), '')
self.assertEqual(len(r), 0)
#now assign it to a template
r.Template = ('ACGUUCGA')
self.assertEqual(str(r.Current), 'ACGUUCGA')
self.assertEqual(len(r), len('ACGUUCGA'))
#check that refresh doesn't break anything
r.refresh()
self.assertEqual(str(r.Current), 'ACGUUCGA')
self.assertEqual(len(r), len('ACGUUCGA'))
#check composition
self.assertEqual(r.Composition, None)
d = {'A':3, 'U':10}
r.Composition = Freqs(d)
self.assertEqual(r.Composition, d)
#check that composition doesn't break the update
r.refresh()
self.assertEqual(str(r.Current), 'ACGUUCGA')
self.assertEqual(len(r), len('ACGUUCGA'))
class ConstantRegionTests(TestCase):
"""Tests of the ConstantRegion class. Just returns the template."""
def test_init(self):
"""ConstantRegion should always return current template."""
#test blank region model
r = ConstantRegion()
self.assertEqual(str(r.Current), '')
self.assertEqual(len(r), 0)
#now assign it to a template
r.Template = ('ACGUUCGA')
self.assertEqual(str(r.Current), 'ACGUUCGA')
self.assertEqual(len(r), len('ACGUUCGA'))
#check that refresh doesn't break anything
r.refresh()
self.assertEqual(str(r.Current), 'ACGUUCGA')
self.assertEqual(len(r), len('ACGUUCGA'))
#check composition
self.assertEqual(r.Composition, None)
d = {'A':3, 'U':10}
r.Composition = Freqs(d)
self.assertEqual(r.Composition, d)
#check that composition doesn't break the update
r.refresh()
self.assertEqual(str(r.Current), 'ACGUUCGA')
self.assertEqual(len(r), len('ACGUUCGA'))
class UnpairedRegionTests(TestCase):
"""Tests of unpaired region: should fill in w/ single-base frequencies."""
def test_init(self):
"""Unpaired region should generate right freqs, even after change"""
freqs = Freqs({'C':10,'U':1, 'A':0})
r = UnpairedRegion('NN', freqs)
seq = r.Current
assert seq[0] in 'CU'
assert seq[1] in 'CU'
self.assertEqual(len(seq), 2)
fd = []
for i in range(1000):
r.refresh()
fd.append(str(seq))
fd = Freqs(''.join(fd))
observed = [fd['C'], fd['U']]
expected = [1800, 200]
self.assertSimilarFreqs(observed, expected)
self.assertEqual(fd['U'] + fd['C'], 2000)
freqs2 = Freqs({'A':5, 'U':5})
r.Composition = freqs2
r.Template = 'NNN' #note that changing the Template changes seq ref
seq = r.Current
self.assertEqual(len(seq), 3)
assert seq[0] in 'AU'
assert seq[1] in 'AU'
assert seq[2] in 'AU'
fd = []
for i in range(1000):
r.refresh()
fd.append(str(seq))
fd = Freqs(''.join(fd))
observed = [fd['A'], fd['U']]
expected = [1500, 1500]
self.assertSimilarFreqs(observed, expected)
self.assertEqual(fd['A'] + fd['U'], 3000)
class ShuffledRegionTests(TestCase):
"""Shuffled region should randomize string"""
def test_init(self):
"""Shuffled region should init ok with string, ignoring base freqs"""
#general strategy: seqs should be different, but sorted seqs should
#be the same
empty = ''
seq = 'UUUCCCCAAAGGG'
#check that we don't get errors on empty template
r = ShuffledRegion(empty)
r.refresh()
self.assertEqual(str(r.Current), '')
#check that changing the template changes the sequence
r.Template = seq
self.assertNotEqual(str(r.Current), '')
#check that it shuffled the sequence the first time
self.assertNotEqual(str(r.Current), seq)
curr = str(r.Current)
as_list = list(curr)
#check that we have the right number of each type of base
as_list.sort()
exp_as_list = list(seq)
exp_as_list.sort()
self.assertEqual(as_list, exp_as_list)
#check that we get something different if we refresh again
r.refresh()
self.assertNotEqual(str(r.Current), curr)
as_list = list(str(r.Current))
as_list.sort()
self.assertEqual(as_list, exp_as_list)
class PairedRegionTests(TestCase):
"""Tests of paired region generation."""
def test_init(self):
"""Paired region init and mutation should give expected results"""
WatsonCrick = {'A':'U', 'U':'A', 'C':'G', 'G':'C'}
Wobble = {'A':'U', 'U':'AG', 'C':'G', 'G':'UC'}
#check that empty init doesn't give errors
r = PairedRegion()
r.refresh()
#check that mutation works correctly
r.Template = "N"
self.assertEqual(len(r), 1)
r.monomers('UCCGGA')
upstream = r.Current[0]
downstream = r.Current[1]
states = {}
num_to_do = 10000
for i in range(num_to_do):
r.refresh()
curr = (upstream[0], downstream[0])
assert upstream[0] in Wobble[downstream[0]]
states[curr] = states.get(curr, 0) + 1
for i in states.keys():
assert i[1] in Wobble[i[0]]
for i in Wobble:
for j in Wobble[i]:
assert (i, j) in states.keys()
expected_dict = {('A','U'):num_to_do/14, ('U','A'):num_to_do/14,
('C','G'):num_to_do/14*4, ('G','C'):num_to_do/14*4,
('U','G'):num_to_do/14*2, ('G','U'):num_to_do/14*2,}
# the following for loop was replaced with the assertSimilarFreqs
# call below it
#for key, val in expected.items():
#self.assertFloatEqualAbs(val, states[key], 130) #conservative?
expected = [val for key, val in expected_dict.items()]
observed = [states[key] for key, val in expected_dict.items()]
self.assertSimilarFreqs(observed, expected)
assert ('G','U') in states
assert ('U','G') in states
r.monomers('UCGA', GU=False)
upstream = r.Current[0]
downstream = r.Current[1]
states = {}
num_to_do = 10000
for i in range(num_to_do):
r.refresh()
curr = (upstream[0], downstream[0])
assert upstream[0] in WatsonCrick[downstream[0]]
states[curr] = states.get(curr, 0) + 1
for i in states.keys():
assert i[1] in WatsonCrick[i[0]]
for i in WatsonCrick:
for j in WatsonCrick[i]:
assert (i, j) in states.keys()
expected_dict = {('A','U'):num_to_do/4, ('U','A'):num_to_do/4,
('C','G'):num_to_do/4, ('G','C'):num_to_do/4,}
expected = [val for key, val in expected_dict.items()]
observed = [states[key] for key, val in expected_dict.items()]
self.assertSimilarFreqs(observed, expected)
#for key, val in expected.items():
# self.assertFloatEqualAbs(val, states[key], 130) #3 std devs
assert ('G','U') not in states
assert ('U','G') not in states
class SequenceModelTests(TestCase):
"""Tests of the SequenceModel class."""
def test_init(self):
"""SequenceModel should init OK with Isoleucine motif."""
helices = [PairedRegion('NNN'), PairedRegion('NNNNN')]
constants = [ConstantRegion('CUAC'), ConstantRegion('UAUUGGGG')]
order = "H0 C0 H1 - H1 C1 H0"
isoleucine = SequenceModel(order=order, constants=constants, \
helices=helices)
isoleucine.Composition = BaseFrequency('UCAG')
#print
#print
for i in range(10):
isoleucine.refresh()
#print list(isoleucine)
#print
isoleucine.Composition = BaseFrequency('UCAG')
isoleucine.GU = False
#print
for i in range(10):
isoleucine.refresh()
#print list(isoleucine)
#print
class RuleTests(TestCase):
"""Tests of the Rule class"""
def test_init_bad_params(self):
"""Rule should fail validation except with exactly 5 parameters"""
self.assertRaises(TypeError, Rule, 1, 1, 1, 1)
self.assertRaises(TypeError, Rule, 1, 1, 1, 1, 1, 1)
def test_init_bad_length(self):
"""Rule should fail validation if helix extends past downstream start"""
self.assertRaises(ValueError, Rule, 0, 0, 1, 0, 2)
self.assertRaises(ValueError, Rule, 0, 0, 10, 10, 12)
def test_init_bad_negative_params(self):
"""Rule should fail validation if any parameters are negative"""
self.assertRaises(ValueError, Rule, -1, 0, 1, 0, 1)
self.assertRaises(ValueError, Rule, 0, -1, 1, 1, 1)
self.assertRaises(ValueError, Rule, 0, 0, -1, 0, 5)
self.assertRaises(ValueError, Rule, 0, 0, 0, -1, 1)
self.assertRaises(ValueError, Rule, 0, 0, 1, 1, -1)
def test_init_bad_zero_length(self):
"""Rule should fail validation if length is zero"""
self.assertRaises(ValueError, Rule, 0, 0, 1, 1, 0)
def test_init_overlap(self):
"""Rule should fail validation if bases must pair with themselves"""
self.assertRaises(ValueError, Rule, 0, 0, 0, 0, 1)
self.assertRaises(ValueError, Rule, 0, 10, 0, 15, 4)
def test_init_wrong_order(self):
"""First sequence must have lower index"""
self.assertRaises(ValueError, Rule, 1, 0, 0, 5, 3)
def test_init_ok_length(self):
"""Rule should init OK if helix extends to exactly downstream start"""
x = Rule(0, 0, 1, 0, 1)
self.assertEqual(str(x), \
"Up Seq: 0 Up Pos: 0 Down Seq: 1 Down Pos: 0 Length: 1")
#check adjacent bases
x = Rule(0, 0, 0, 1, 1)
self.assertEqual(str(x), \
"Up Seq: 0 Up Pos: 0 Down Seq: 0 Down Pos: 1 Length: 1")
x = Rule(1, 10, 2, 8, 7)
#check rule that would cause overlap if motifs weren't different
self.assertEqual(str(x), \
"Up Seq: 1 Up Pos: 10 Down Seq: 2 Down Pos: 8 Length: 7")
def test_str(self):
"""Rule str method should give expected results"""
x = Rule(1, 10, 2, 8, 7)
self.assertEqual(str(x), \
"Up Seq: 1 Up Pos: 10 Down Seq: 2 Down Pos: 8 Length: 7")
class RuleTests_compatibility(TestCase):
"""Tests to see whether the Rule compatibility code works"""
def setUp(self):
"""Sets up some standard rules"""
self.x = Rule(1, 5, 2, 10, 3)
self.x_ok = Rule(1, 8, 2, 14, 4)
self.x_ok_diff_sequences = Rule(3, 5, 5, 10, 3)
self.x_bad_first = Rule(1, 0, 3, 10, 10)
self.x_bad_first_2 = Rule(0, 0, 1, 8, 2)
self.x_bad_second = Rule(1, 15, 2, 15, 8)
self.x_bad_second_2 = Rule(1, 14, 2, 8, 4)
def test_is_compatible_ok(self):
"""Rule.isCompatible should return True if rules don't overlap"""
self.assertEqual(self.x.isCompatible(self.x_ok), True) #no return value
self.assertEqual(self.x.isCompatible(self.x_ok_diff_sequences), True)
#check that it's transitive
self.assertEqual(self.x_ok.isCompatible(self.x), True)
self.assertEqual(self.x_ok_diff_sequences.isCompatible(self.x), True)
def test_is_compatible_bad(self):
"""Rule.isComaptible should return False if rules overlap"""
tests = [ (self.x, self.x_bad_first),
(self.x, self.x_bad_first_2),
(self.x, self.x_bad_second),
(self.x, self.x_bad_second_2),
]
for first, second in tests:
self.assertEqual(first.isCompatible(second), False)
#check that it's transitive
self.assertEqual(second.isCompatible(first), False)
def test_fits_in_sequence(self):
"""Rule.fitsInSequence should return True if sequence long enough"""
sequences = map('x'.__mul__, range(21)) #0 to 20 copies of 'x'
rules = [self.x, self.x_ok, self.x_ok_diff_sequences, self.x_bad_first,
self.x_bad_first_2, self.x_bad_second, self.x_bad_second_2]
#test a bunch of values for all the rules we have handy
for s in sequences:
for r in rules:
if r.UpstreamPosition + r.Length > len(s):
self.assertEqual(r.fitsInSequence(s), False)
else:
self.assertEqual(r.fitsInSequence(s), True)
#test a couple of specific boundary cases
#length-1 helix
r = Rule(0, 0, 1, 0, 1)
self.assertEqual(r.fitsInSequence(''), False)
self.assertEqual(r.fitsInSequence('x'), True)
self.assertEqual(r.fitsInSequence('xx'), True)
#length-2 helix starting one base from the start
r = Rule(1, 1, 2, 2, 2)
self.assertEqual(r.fitsInSequence(''), False)
self.assertEqual(r.fitsInSequence('x'), False)
self.assertEqual(r.fitsInSequence('xx'), False)
self.assertEqual(r.fitsInSequence('xxx'), True)
self.assertEqual(r.fitsInSequence('xxxx'), True)
class ModuleTests(TestCase):
"""Tests of the Module class, which holds sequences and structures."""
def test_init_bad(self):
"""Module init should fail if seq/struct missing, or mismatched lengths"""
#test incorrect param number
self.assertRaises(TypeError, Module, 'abc')
self.assertRaises(TypeError, Module, 'abc', 'def', 'ghi')
#test incorrect lengths
self.assertRaises(ValueError, Module, 'abc', 'abcd')
self.assertRaises(ValueError, Module, 'abcd', 'acb')
def test_init_good(self):
"""Module init should work if seq and struct same length"""
m = Module('U', '.')
self.assertEqual(m.Sequence, 'U')
self.assertEqual(m.Structure, '.')
m.Sequence = ''
m.Structure = ''
self.assertEqual(m.Sequence, '')
self.assertEqual(m.Structure, '')
m.Sequence = 'CCUAGG'
m.Structure = '((..))'
self.assertEqual(m.Sequence, 'CCUAGG')
self.assertEqual(m.Structure, '((..))')
m.Structure = ''
self.assertRaises(ValueError, m.__len__)
def test_len(self):
"""Module len should work if seq and struct same length"""
m = Module('CUAG', '....')
self.assertEqual(len(m), 4)
m = Module('', '')
self.assertEqual(len(m), 0)
m.Sequence = 'AUCGAUCGA'
self.assertRaises(ValueError, m.__len__)
def test_str(self):
"""Module str should contain sequence and structure"""
m = Module('CUAG', '....')
self.assertEqual(str(m), 'Sequence: CUAG\nStructure: ....')
m = Module('', '')
self.assertEqual(str(m), 'Sequence: \nStructure: ')
def test_matches(self):
"""Module matches should return correct result for seq/struct match"""
empty = Module('', '')
short_p = Module('AC', '((')
short_u = Module('UU', '..')
short_up = Module('UU', '((')
long_all = Module('GGGACGGUUGGUUGGUU', ')))((..((....((((') #struct+seq
long_seq = Module('GGGACGGUUGGUU', ')))))))))))))') #seq but not struct
long_struct = Module('GGGGGGGGGGGGG', ')))((..((....') #struct, not seq
long_none = Module('GGGGGGGGGGGGG', ')))))))))))))') #not struct or seq
#test overall matching
for matcher in [empty, short_p, short_u, short_up]:
self.assertEqual(matcher.matches(long_all), True)
for longer in [long_seq, long_struct, long_none]:
if matcher is empty:
self.assertEqual(matcher.matches(longer), True)
else:
self.assertEqual(matcher.matches(longer), False)
#test specific positions
positions = {3:short_p, 11:short_u, 7:short_up, 15:short_up}
for module in [short_p, short_u, short_up]:
for i in range(len(long_all)):
result = module.matches(long_all, i)
if positions.get(i, None) is module:
self.assertEqual(result, True)
else:
self.assertEqual(result, False)
class MotifTests(TestCase):
"""Tests of the Motif object, which has a set of Modules and Rules."""
def setUp(self):
"""Defines a few standard motifs"""
self.ile_mod_0 = Module('NNNCUACNNNNN', '(((((..(((((')
self.ile_mod_1 = Module('NNNNNUAUUGGGGNNN', ')))))......)))))')
self.ile_rule_0 = Rule(0, 0, 1, 15, 3)
self.ile_rule_1 = Rule(0, 7, 1, 4, 5)
self.ile = Motif([self.ile_mod_0, self.ile_mod_1], \
[self.ile_rule_0, self.ile_rule_1])
self.hh_mod_0 = Module('NNNNUNNNNN', '(((((.((((')
self.hh_mod_1 = Module('NNNNCUGANGAGNNN', ')))).......((((')
self.hh_mod_2 = Module('NNNCGAAANNNN', '))))...)))))')
self.hh_rule_0 = Rule(0, 0, 2, 11, 5)
self.hh_rule_1 = Rule(0, 6, 1, 3, 4)
self.hh_rule_2 = Rule(1, 11, 2, 3, 4)
self.hh = Motif([self.hh_mod_0, self.hh_mod_1, self.hh_mod_2], \
[self.hh_rule_0, self.hh_rule_1, self.hh_rule_2])
self.simple_0 = Module('CCCCC', '(((..')
self.simple_1 = Module('GGGGG', '..)))')
self.simple_r = Rule(0, 0, 1, 4, 3)
self.simple = Motif([self.simple_0, self.simple_1], [self.simple_r])
def test_init_bad_rule_lengths(self):
"""Motif init should fail if rules don't match module lengths"""
bad_rule = Rule(0, 0, 1, 8, 6)
self.assertRaises(ValueError, Motif, [self.simple_0, self.simple_1], \
[bad_rule])
def test_init_conflicting_rules(self):
"""Motif init should fail if rules overlap"""
interferer = Rule(0, 2, 2, 20, 4)
self.assertRaises(ValueError, Motif, [self.ile_mod_0, self.ile_mod_1, \
self.ile_mod_0], [self.ile_rule_0, interferer])
def test_matches_simple(self):
"""Test of simple match should work correctly"""
index = '01234567890123456789012345678901'
seq = 'AAACCCCCUUUGGGGGAAACCCCCUUUGGGGG'
struct = ViennaStructure('((..((..))....))...(((.......)))')
struct_2 = ViennaStructure('((((((..((())))))))).....(((.)))')
#substring right, not pair
self.assertEqual(self.simple.matches(seq, struct, [19, 27]), True)
self.assertEqual(self.simple.matches(seq, struct_2, [19,27]), False)
for first_pos in range(len(seq) - len(self.simple_0) + 1):
for second_pos in range(len(seq) - len(self.simple_1) + 1):
#should match struct only at one location
match=self.simple.matches(seq, struct, [first_pos, second_pos])
if (first_pos == 19) and (second_pos == 27):
self.assertEqual(match, True)
else:
self.assertEqual(match, False)
#should never match in struct_2
self.assertEqual(self.simple.matches(seq, struct_2, \
[first_pos, second_pos]), False)
#check that it doesn't fail if there are _two_ matches
index = '01234567890123456789'
seq = 'CCCCCGGGGGCCCCCGGGGG'
struct = '(((....)))(((....)))'
struct = ViennaStructure(struct)
self.assertEqual(self.simple.matches(seq, struct, [0, 5]), True)
self.assertEqual(self.simple.matches(seq, struct, [10,15]), True)
#not allowed to cross-pair
self.assertEqual(self.simple.matches(seq, struct, [0, 15]), False)
def test_matches_ile(self):
"""Test of isoleucine match should work correctly"""
index = '012345678901234567890123456789012345'
seq_good = 'AAACCCCUACUUUUUCCCAAAAAUAUUGGGGGGGAA'
seq_bad = 'AAACCCCUACUUUUUCCCAAAAAUAUUGGGCGGGAA'
st_good = '...(((((..(((((...)))))......)))))..'
st_bad = '((((((((..(((((...)))))...))))))))..'
st_good = ViennaStructure(st_good)
st_bad = ViennaStructure(st_bad)
for first_pos in range(len(seq_good) - len(self.ile_mod_0) + 1):
for second_pos in range(len(seq_good) - len(self.ile_mod_1) + 1):
#seq_good and struct_good should match at one location
match=self.ile.matches(seq_good,st_good,[first_pos,second_pos])
if (first_pos == 3) and (second_pos == 18):
self.assertEqual(match, True)
else:
self.assertEqual(match, False)
self.assertEqual(self.ile.matches(seq_good, st_bad, \
[first_pos, second_pos]), False)
self.assertEqual(self.ile.matches(seq_bad, st_good, \
[first_pos, second_pos]), False)
self.assertEqual(self.ile.matches(seq_bad, st_bad, \
[first_pos, second_pos]), False)
def test_matches_hh(self):
"""Test of hammerhead match should work correctly"""
index = '0123456789012345678901234567890123456'
seq_good = 'CCCCUAGGGGCCCCCUGAAGAGAAAUUUCGAAAGGGG'
seq_bad ='CCCCCAGGGGCCCCCUGAAGAGAAAUUUCGAAGGGGG'
structure ='(((((.(((()))).......(((())))...)))))'
struct = ViennaStructure(structure)
self.assertEqual(self.hh.matches(seq_good, struct, [0, 10, 25]), True)
self.assertEqual(self.hh.matches(seq_bad, struct, [0, 10, 25]), False)
def test_structureMatches_hh(self):
"""Test of hammerhead structureMatch should work correctly"""
index = '0123456789012345678901234567890123456'
seq_good = 'CCCCUAGGGGCCCCCUGAAGAGAAAUUUCGAAAGGGG'
seq_bad ='CCCCCAGGGGCCCCCUGAAGAGAAAUUUCGAAGGGGG'
structure ='(((((.(((()))).......(((())))...)))))'
struct = ViennaStructure(structure)
self.assertEqual(self.hh.structureMatches(struct, [0, 10, 25]), True)
self.assertEqual(self.hh.structureMatches(struct, [0, 10, 25]), True)
class SequenceEmbedderTests(TestCase):
"""Tests of the SequenceEmbedder class."""
def setUp(self):
"""Define a few standard models and motifs"""
ile_mod_0 = Module('NNNCUACNNNNN', '(((((..(((((')
ile_mod_1 = Module('NNNNNUAUUGGGGNNN', ')))))......)))))')
ile_rule_0 = Rule(0, 0, 1, 15, 5)
ile_rule_1 = Rule(0, 7, 1, 4, 5)
ile_motif = Motif([ile_mod_0, ile_mod_1], \
[ile_rule_0, ile_rule_1])
helices = [PairedRegion('NNN'), PairedRegion('NNNNN')]
constants = [ConstantRegion('CUAC'), ConstantRegion('UAUUGGGG')]
order = "H0 C0 H1 - H1 C1 H0"
ile_model = SequenceModel(order=order, constants=constants, \
helices=helices, composition=BaseFrequency('UCAG'))
self.ile_embedder = SequenceEmbedder(length=50, num_to_do=10, \
motif=ile_motif, model=ile_model, composition=BaseFrequency('UCAG'))
short_ile_mod_0 = Module('NCUACNN', '(((..((')
short_ile_mod_1 = Module('NNUAUUGGGGN', '))......)))')
short_ile_rule_0 = Rule(0, 0, 1, 10, 3)
short_ile_rule_1 = Rule(0, 5, 1, 1, 2)
short_ile_motif = Motif([short_ile_mod_0, short_ile_mod_1], \
[short_ile_rule_0, short_ile_rule_1])
short_helices = [PairedRegion('N'), PairedRegion('NN')]
short_constants = [ConstantRegion('CUAC'), ConstantRegion('UAUUGGGG')]
short_order = "H0 C0 H1 - H1 C1 H0"
short_ile_model = SequenceModel(order=short_order, \
constants=short_constants, \
helices=short_helices, composition=BaseFrequency('UCAG'))
self.short_ile_embedder = SequenceEmbedder(length=50, num_to_do=10, \
motif=short_ile_motif, model=short_ile_model, \
composition=BaseFrequency('UCAG'))
def test_composition_change(self):
"""Changes in composition should propagate."""
rr = str(self.ile_embedder.RandomRegion.Current)
#for base in 'UCAG':
# assert base in rr
#the above two lines should generally be true but fail stochastically
self.ile_embedder.Composition = BaseFrequency('CG')
self.assertEqual(self.ile_embedder.Model.Composition, \
BaseFrequency('CG'))
self.assertEqual(self.ile_embedder.RandomRegion.Composition, \
BaseFrequency('CG'))
self.ile_embedder.RandomRegion.refresh()
self.assertEqual(len(self.ile_embedder.RandomRegion), 22)
rr = str(self.ile_embedder.RandomRegion.Current)
assert ('C' in rr or 'G' in rr)
assert 'A' not in rr
assert 'U' not in rr
def test_choose_locations_too_short(self):
"""SequenceEmbedder _choose_locations should fail if too little space"""
self.ile_embedder.Length = 28 #no positions left over
self.assertRaises(ValueError, self.ile_embedder._choose_locations)
self.ile_embedder.Length = 29 #one position left over
self.assertRaises(ValueError, self.ile_embedder._choose_locations)
def test_choose_locations_exact(self):
"""SequenceEmbedder _choose_locations should pick all locations"""
self.ile_embedder.Length = 30 #two positions left: must both be filled
for i in range(10):
first, second = self.ile_embedder._choose_locations()
self.assertEqual(first, 0)
self.assertEqual(second, 1)
def test_choose_locations_even(self):
"""SequenceEmbedder _choose_locations should pick locations evenly"""
self.ile_embedder.Length = 31 #three positions left
counts = {}
for i in range(1000):
key = tuple(self.ile_embedder._choose_locations())
assert key[0] != key[1]
curr = counts.get(key, 0)
counts[key] = curr + 1
expected = [333, 333, 333]
observed = [counts[(0,1)], counts[(0,2)], counts[(1,2)]]
self.assertSimilarFreqs(observed, expected)
#make sure nothing else snuck in there
self.assertEqual(counts[(0,1)]+counts[(0,2)]+counts[(1,2)], 1000)
def test_choose_locations_with_replacement(self):
"""SequenceEmbedder _choose_locations can sample with replacement"""
self.ile_embedder.Length = 28 #exact fit
self.ile_embedder.WithReplacement = True
for i in range(10):
first, second = self.ile_embedder._choose_locations()
self.assertEqual(first, 0)
self.assertEqual(second, 0)
self.ile_embedder.Length = 29 #one left over: can be 0,0 0,1 1,1
counts = {}
for i in range(1000):
key = tuple(self.ile_embedder._choose_locations())
curr = counts.get(key, 0)
counts[key] = curr + 1
expected = [250, 500, 250]
observed = [counts[(0,0)], counts[(0,1)], counts[(1,1)]]
self.assertSimilarFreqs(observed, expected)
#make sure nothing else snuck in there
self.assertEqual(counts[(0,0)]+counts[(0,1)]+counts[(1,1)], 1000)
def test_insert_modules(self):
"""SequenceEmbedder _insert_modules should make correct sequence"""
ile = self.ile_embedder
ile.Length = 50
ile.RandomRegion.Current[:] = ['A'] * 22
modules = list(ile.Model)
ile.Positions = [0, 0] #try inserting at first position
self.assertEqual(str(ile), modules[0] + modules[1] + 'A'*22)
ile.Positions = [3, 20]
self.assertEqual(str(ile), 'A'*3+modules[0]+'A'*17+modules[1]+'A'*2)
def test_refresh(self):
"""SequenceEmbedder refresh should change module sequences"""
modules_before = list(self.ile_embedder.Model)
random_before = str(self.ile_embedder.RandomRegion.Current)
self.ile_embedder.refresh()
random_after = str(self.ile_embedder.RandomRegion.Current)
self.assertNotEqual(random_before, random_after)
modules_after = list(self.ile_embedder.Model)
for before, after in zip(modules_before, modules_after):
self.assertNotEqual(before, after)
#check that it works twice
self.ile_embedder.refresh()
random_third = str(self.ile_embedder.RandomRegion.Current)
modules_third = list(self.ile_embedder.Model)
self.assertNotEqual(random_third, random_before)
self.assertNotEqual(random_third, random_after)
for first, second, third in \
zip(modules_before, modules_after, modules_third):
self.assertNotEqual(first, third)
self.assertNotEqual(second, third)
def test_countMatches(self):
"""Shouldn't find any Ile matches if all the pairs are GU"""
if not RNAFOLD_PRESENT:
return
self.ile_embedder.NumToDo = 100
self.ile_embedder.Composition = BaseFrequency('GGGGGGGGGU')
self.ile_embedder.Length = 40
good_count = self.ile_embedder.countMatches()
self.assertEqual(good_count, 0)
def test_countMatches_pass(self):
"""Should find some matches against a random background"""
if not RNAFOLD_PRESENT:
return
self.ile_embedder.NumToDo = 100
self.ile_embedder.Composition = BaseFrequency('UCAG')
self.ile_embedder.Length = 40
good_count = self.ile_embedder.countMatches()
self.assertNotEqual(good_count, 0)
def test_refresh_specific_position(self):
"""Should always find the module in the same position if specified"""
first_module = Module('AAAAA', '(((((')
second_module = Module('UUUUU', ')))))')
rule_1 = Rule(0, 0, 1, 4, 5)
helix = Motif([first_module, second_module], [rule_1])
model = SequenceModel(constants=[ConstantRegion('AAAAA'), \
ConstantRegion('UUUUU')], order='C0 - C1', \
composition=BaseFrequency('A'))
embedder = SequenceEmbedder(length=30, num_to_do=100, \
motif=helix, model=model, composition=BaseFrequency('CG'), \
positions=[3, 6])
last = ''
for i in range(100):
embedder.refresh()
curr = str(embedder)
self.assertEqual(curr[3:8], 'AAAAA')
self.assertEqual(curr[11:16], 'UUUUU')
self.assertEqual(curr.count('A'), 5)
self.assertEqual(curr.count('U'), 5)
self.assertNotEqual(last, curr)
last = curr
def test_refresh_primers(self):
"""Module should appear in correct location with primers"""
first_module = Module('AAAAA', '(((((')
second_module = Module('UUUUU', ')))))')
rule_1 = Rule(0, 0, 1, 4, 5)
helix = Motif([first_module, second_module], [rule_1])
model = SequenceModel(constants=[ConstantRegion('AAAAA'), \
ConstantRegion('UUUUU')], order='C0 - C1', \
composition=BaseFrequency('A'))
embedder = SequenceEmbedder(length=30, num_to_do=100, \
motif=helix, model=model, composition=BaseFrequency('CG'), \
positions=[3, 6], primer_5 = 'UUU', primer_3 = 'AAA')
last = ''
for i in range(100):
embedder.refresh()
curr = str(embedder)
self.assertEqual(curr[0:3], 'UUU')
self.assertEqual(curr[6:11], 'AAAAA')
self.assertEqual(curr[14:19], 'UUUUU')
self.assertEqual(curr.count('A'), 8)
self.assertEqual(curr.count('U'), 8)
self.assertEqual(curr[-3:], 'AAA')
self.assertNotEqual(last, curr)
last = curr
def xxx_test_count_long(self):
self.ile_embedder.NumToDo = 100000
self.ile_embedder.Composition = BaseFrequency('UCAG')
print
print "Extended helices"
for length in range(30, 150):
self.ile_embedder.Length = length
good_count = self.ile_embedder.countMatches()
print "Length: %s Matches: %s/100000" % (length, good_count)
print
def xxx_test_count_short(self):
self.short_ile_embedder.NumToDo = 10000
self.short_ile_embedder.Composition = BaseFrequency('UCAG')
print
print "Minimal motif"
for length in range(20, 150):
self.short_ile_embedder.Length = length
good_count = self.short_ile_embedder.countMatches()
print "Length: %s Matches: %s/10000" % (length, good_count)
print
if __name__ == '__main__':
main()
|