File: test_sequence_generators.py

package info (click to toggle)
python-cogent 1.9-14
  • links: PTS, VCS
  • area: main
  • in suites: buster
  • size: 19,752 kB
  • sloc: python: 137,485; makefile: 149; sh: 64
file content (1125 lines) | stat: -rw-r--r-- 49,087 bytes parent folder | download | duplicates (2)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
966
967
968
969
970
971
972
973
974
975
976
977
978
979
980
981
982
983
984
985
986
987
988
989
990
991
992
993
994
995
996
997
998
999
1000
1001
1002
1003
1004
1005
1006
1007
1008
1009
1010
1011
1012
1013
1014
1015
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032
1033
1034
1035
1036
1037
1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055
1056
1057
1058
1059
1060
1061
1062
1063
1064
1065
1066
1067
1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081
1082
1083
1084
1085
1086
1087
1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
1109
1110
1111
1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
#!/usr/bin/env python
"""test_sequence_generator.py: tests of the sequence_generator module.
"""
from cogent.seqsim.sequence_generators import permutations, combinations, \
    SequenceGenerator, Partition, Composition, \
    MageFrequencies, SequenceHandle, IUPAC_DNA, IUPAC_RNA, BaseFrequency, \
    PairFrequency, BasePairFrequency, RegionModel, ConstantRegion, \
    UnpairedRegion, ShuffledRegion, PairedRegion, MatchingRegion, \
    SequenceModel, Rule, Motif, Module, SequenceEmbedder
from StringIO import StringIO
from operator import mul
from sys import path
from cogent.maths.stats.util import Freqs
from cogent.util.misc import app_path
from cogent.struct.rna2d import ViennaStructure
from cogent.util.unit_test import TestCase, main

__author__ = "Rob Knight"
__copyright__ = "Copyright 2007-2016, The Cogent Project"
__credits__ = ["Rob Knight", "Daniel McDonald"]
__license__ = "GPL"
__version__ = "1.9"
__maintainer__ = "Rob Knight"
__email__ = "rob@spot.colorado.edu"
__status__ = "Development"

#need to skip some tests if RNAfold absent
if app_path('RNAfold'):
    RNAFOLD_PRESENT = True
else:
    RNAFOLD_PRESENT = False

class FunctionTests(TestCase):
    """Tests of standalone functions"""
    def setUp(self):
        self.standards = (0, 1, 5, 30, 173, 1000, 4382)
        
    def test_permuations_negative_k(self):
        """permutations should raise IndexError if k negative"""
        self.assertRaises(IndexError, permutations, 3, -1)
    
    def test_permutations_k_more_than_n(self):
        """permutations should raise IndexError if k > n"""
        self.assertRaises(IndexError, permutations, 3, 4)
    
    def test_permutations_negative_n(self):
        """permutations should raise IndexError if n negative"""
        self.assertRaises(IndexError, permutations, -3, -2)

    def test_permutations_k_equals_1(self):
        """permutations should return n if k=1"""
        for n in self.standards[1:]:
            self.assertEqual(permutations(n,1), n)

    def test_permutations_k_equals_2(self):
        """permutations should return n*(n-1) if k=2"""
        for n in self.standards[2:]:
            self.assertEqual(permutations(n,2), n*(n-1))

    def test_permutations_k_equals_n(self):
        """permutations should return n! if k=n"""
        for n in self.standards[1:]:
            self.assertEqual(permutations(n,n), reduce(mul, range(1,n+1)))
            
    def test_combinations_k_equals_n(self):
        """combinations should return 1 if k = n"""
        for n in self.standards:
            self.assertEqual(combinations(n,n), 1)
    
    def test_combinations_k_equals_n_minus_1(self):
        """combinations should return n if k=(n-1)"""
        for n in self.standards[1:]:
            self.assertEqual(combinations(n, n-1), n)

    def test_combinations_zero_k(self):
        """combinations should return 1 if k is zero"""
        for n in self.standards:
            self.assertEqual(combinations(n, 0), 1)

    def test_combinations_symmetry(self):
        """combinations(n,k) should equal combinations(n,n-k)"""
        for n in self.standards[3:]:
            for k in (0, 1, 5, 18):
                self.assertEquals(combinations(n, k), combinations(n, n-k))

    def test_combinations_arbitrary_values(self):
        """combinations(n,k) should equal results from spreadsheet"""
        results = {
            30:{0:1, 1:30, 5:142506, 18:86493225, 29:30, 30:1},
            173:{0:1, 1:173, 5:1218218079, 18:1.204353e24, 29:7.524850e32, \
                 30:3.611928e33},
            1000:{0:1, 1:1000, 5:8.2502913e12, 18:1.339124e38,29:7.506513e55, \
                  30:2.429608e57},
            4382:{0:1, 1:4382, 5:1.343350e16, 18:5.352761e49, 29:4.184411e74, \
                  30:6.0715804e76},
                  }
        for n in self.standards[3:]:
            for k in (0, 1, 5, 18, 29, 30):
                self.assertFloatEqualRel(combinations(n,k), results[n][k], 1e-5)
                
class SequenceGeneratorTests(TestCase):
    """Tests of SequenceGenerator, which fills in degenerate bases"""
    def setUp(self):
        """Defines a few standard generators"""
        self.rna_codons = SequenceGenerator('NNN')
        self.dna_iupac_small = SequenceGenerator('RH', IUPAC_DNA)
        self.empty = SequenceGenerator('')
        self.huge = SequenceGenerator('N'*50)
        self.binary = SequenceGenerator('01??01', {'0':'0','1':'1','?':'10'})

    def test_len(self):
        """len(SequenceGenerator) should return number of possible matches"""
        lengths = ((self.rna_codons, 64), (self.dna_iupac_small, 6),
                   (self.empty, 0), (self.binary, 4))
        for item, expected in lengths:
            self.assertEqual(len(item), expected)
        try:
            len(self.huge)
        except OverflowError:
            pass
        else:
            raise AssertionError, "Failed to raise expected OverflowError"

    def test_numPossibilities(self):
        """SequenceGenerator.numPossibilities() should be robust to overflow"""
        lengths = ((self.rna_codons, 64), (self.dna_iupac_small, 6),
                   (self.empty, 0), (self.binary, 4), (self.huge, 4**50))
        for item, expected in lengths:
            self.assertEqual(item.numPossibilities(), expected)

    def test_sequences(self):
        """SequenceGenerator should produce the correct list of sequences"""
        self.assertEqual(list(self.empty), [])
        self.assertEqual(list(self.dna_iupac_small), \
            ['AT','AC','AA','GT','GC','GA'])
        codons = []
        for first in 'UCAG':
            for second in 'UCAG':
                for third in 'UCAG':
                    codons.append(''.join([first, second, third]))
        self.assertEqual(list(self.rna_codons), codons)
        #test that it still works if we call the generator a second time
        self.assertEqual(list(self.rna_codons), codons)
        
    def test_iter(self):
        """SequenceGenerator should act like a list with for..in syntax"""
        as_list = list(self.rna_codons)
        for obs, exp in zip(self.rna_codons, as_list):
            self.assertEqual(obs, exp)

    def test_getitem(self):
        """SequenceGenerator should allow __getitem__ like a list"""
        as_list = list(self.rna_codons)
        for i in range(64):
            self.assertEqual(self.rna_codons[i], as_list[i])

        for i in range(1,65):
            self.assertEqual(self.rna_codons[-i], as_list[-i])

        self.assertEqual(self.huge[-1], 'G'*50)

    def test_getitem_slices(self):
        """SequenceGenerator slicing should work the same as a list"""
        e = list(self.rna_codons)
        o = self.rna_codons
        values = ( 
                    (o[:], e[:]),
                    (o[0:], e[0:]),
                    (o[1:], e[1:]),
                    (o[5:], e[5:]),
                    (o[0:5], e[0:5]),
                    (o[1:5], e[1:5]),
                    (o[5:5], e[5:5]),
                    (o[0:1], e[0:1]),
                    (o[len(o)-1:len(o)], e[len(e)-1:len(e)]),
                    (o[len(o):len(o)], e[len(e):len(e)]),
                )
        testnum = 0
        for obs, exp in values:
            testnum += 1
            self.assertEqual(list(obs), exp)

        big = list(self.huge[1:5])
        self.assertEqual(['U'*49+'C', 'U'*49+'A', 'U'*49+'G', 'U'*48+'CU'], big)

class PartitionTests(TestCase):
    """Tests of the Paritition object."""
    def test_single_partition(self):
        """If number of objects = bins * min, only one way to partition"""
        for num_bins in range(1, 10):
            for occupancy in range(10):
                self.assertEqual(len(Partition(num_bins*occupancy, 
                num_bins, occupancy)), 1)

    def test_partitions(self):
        """Test several properties of partitions, especially start/end"""
        for num_bins in range(1, 5):
            for occupancy in range(5):
                for num_items in \
                range(num_bins*occupancy, num_bins*occupancy + 10):
                    p = Partition(num_items, num_bins, occupancy)
                    l = [i for i in p]
                    l2 = [i for i in p]
                    #check that calling it twice doesn't break it
                    self.assertEqual(l, l2)
                    #check the lengths
                    self.assertEqual(len(p), len(l))
                    #check the ranges are the same...
                    self.assertEqual(l[0][1:], l[-1][0:-1])
                    #and that they contain the right values.
                    self.assertEqual(l[0][1:], [occupancy]*(num_bins - 1))
                    #check the first and last elements
                    self.assertEqual(l[0][0], l[-1][-1])
                    self.assertEqual(l[0][0], \
                    num_items - occupancy * (num_bins - 1))
                    
    def test_values(self):
        """Partition should match precalculated values"""
        self.assertEqual(len(Partition(20, 4, 1)), 969)

    def test_str(self):
        """str(partition) should work as expected"""
        p = Partition(20,4,1)
        self.assertEqual(str(p), "Items: 20 Pieces: 4 Min Per Piece: 1")

        p.NumItems = 13
        p.NumPieces = 2
        p.MinOccupancy = 0
        self.assertEqual(len(p), len(Partition(13, 2, 0)))
        self.assertEqual(str(p), "Items: 13 Pieces: 2 Min Per Piece: 0")

class CompositionTests(TestCase):
    """Tests of the Composition class."""
    def setUp(self):
        """Define a few standard compositions."""
        self.bases_10pct = Composition(10, 0, "ACGU")
        self.bases_5pct = Composition(5, 1, "ACGU")
        self.bases_extra = Composition(10, 0, "CYGEJ")
        self.small = Composition(20, 0, "xy")
        self.unique = Composition(20, 1, "z")

    def test_lengths(self):
        """Composition should return correct number of elements"""
        self.assertEqual(len(self.bases_10pct), len(Partition(10,4,0)))
        self.assertEqual(len(self.bases_5pct), len(Partition(20,4,1)))
        self.assertEqual(len(self.bases_extra), len(Partition(10,5,0)))
        self.assertEqual(len(self.small), len(Partition(5, 2, 0)))
        self.assertEqual(len(self.unique), len(Partition(5, 1, 1)))

    def test_known_vals(self):
        """Composition should return precalculated elements for known cases"""
        self.assertEqual(len(Composition(5,1,"ACGU")), 969) 
        self.assertEqual(len(Composition(5,0,"ACGU")), 1771)
        as_list = list(Composition(5,1,"ACGU"))
        self.assertEqual(as_list[0], Freqs('A'*17+'CGU'))
        self.assertEqual(as_list[-1], Freqs('U'*17+'ACG'))

    def test_updating(self):
        """Composition updates should reset frequencies correctly."""
        exp_list = list(Composition(5, 1, "GCAUN"))
        self.bases_10pct.Spacing = 5
        self.bases_10pct.Alphabet = "GCAUN"
        self.bases_10pct.MinOccupancy = 1
        self.assertEqual(list(self.bases_10pct), exp_list)

class MageFrequenciesTests(TestCase):
    """Tests of the MageFrequencies class -- presentation for Composition."""
    def setUp(self):
        """Define a few standard compositions."""
        self.bases_10pct = Composition(10, 0, "ACGU")
    def test_str(self):
        """MageFrequencies string conversions work correctly"""
        obs_list = list(self.bases_10pct)
        self.assertEqual(str(MageFrequencies(obs_list[0])), '1.0 0.0 0.0')
        self.assertEqual(str(MageFrequencies(obs_list[-1], "last")), \
            '{last} 0.0 0.0 0.0')
        self.assertEqual(str(MageFrequencies({'C':2, 'A':3, 'T':5, 'x':17}, \
        'bases')), '{bases} 0.3 0.2 0.0')

class SequenceHandleTests(TestCase):
    """Tests of the SequenceHandle class."""
    def setUp(self):
        """Define some standard SequenceHandles."""
        self.rna = SequenceHandle('uuca', 'ucag')
        self.any = SequenceHandle(['u', 1, None])
        self.empty = SequenceHandle()
        
    def test_init_good(self):
        """SequenceHandle should init OK without alphabet"""
        self.assertEqual(SequenceHandle('abc123'), list('abc123'))
        self.assertEqual(SequenceHandle(), list())
        self.assertEqual(SequenceHandle('abcaaa', 'abcd'), list('abcaaa'))
        self.assertEqual(SequenceHandle([1,2,3]), [1,2,3])

    def test_init_bad(self):
        """SequenceHandle should raise ValueError if item not in alphabet"""
        self.assertRaises(ValueError, SequenceHandle, 'abc1', 'abc')
        self.assertRaises(ValueError, SequenceHandle, '1', [1])

    def test_setitem_good(self):
        """SequenceHandle setitem should allow items in alphabet"""
        self.rna[0] = 'c'
        self.assertEqual(self.rna, list('cuca'))
        self.rna[-1] = 'u'
        self.assertEqual(self.rna, list('cucu'))
        self.any[1] = [1, 2, 3]
        self.assertEqual(self.any, ['u', [1, 2, 3], None])

    def test_setitem_bad(self):
        """SequenceHandle setitem should reject items not in alphabet"""
        self.assertRaises(ValueError, self.rna.__setitem__, 0, 'x')

    def test_setslice_good(self):
        """SequenceHandle setslice should allow same-length slice"""
        self.rna[:] = list('aaaa')
        self.assertEqual(self.rna, list('aaaa'))
        self.rna[0:1] = ['u']
        self.assertEqual(self.rna, list('uaaa'))
        self.rna[-2:] = ['g','g']
        self.assertEqual(self.rna, list('uagg'))

    def test_setslice_bad(self):
        """SequenceHandle setslice should reject bad items or length change"""
        self.assertRaises(ValueError, self.rna.__setslice__, 0, len(self.rna), \
            ['a']*5)
        self.assertRaises(ValueError, self.any.__setslice__, 0, len(self.any), \
            ['a']*5)
        self.assertRaises(ValueError, self.rna.__setslice__, 0, 1, ['x'])

    def test_string(self):
        """SequenceHandle str should join items without spaces"""
        #use ''.join if items are strings
        self.assertEqual(str(self.rna), 'uuca')
        self.assertEqual(str(self.empty), '')
        #if some of the items raise errors, use built-in method instead
        self.assertEqual(str(self.any), str(['u', 1, None]))

    def test_naughty_methods(self):
        """SequenceHandle list mutators should raise NotImplementedError"""
        r = self.rna
        naughty = [r.__delitem__, r.__delslice__, r.__iadd__, r.__imul__, \
                   r.append, r.extend, r.insert, r.pop, r.remove]
        for n in naughty:
            self.assertRaises(NotImplementedError, n)

class BaseFrequencyTests(TestCase):
    """Tests of BaseFrequency class: wrapper for FrequencyDistibution."""
    def test_init(self):
        """BaseFrequency should init as expected"""
        self.assertEqual(BaseFrequency('UUUCCCCAG'), \
                         Freqs('UUUCCCCAG', 'UCAG'))
        self.assertEqual(BaseFrequency('TTTCAGG', RNA=False), \
                         Freqs('TTTCAGG'))
    def test_init_bad(self):
        """BaseFrequency init should disallow bad characters"""
        self.assertRaises(Exception, BaseFrequency, 'TTTCAGG')
        self.assertRaises(Exception, BaseFrequency, 'UACGUA', False)

class PairFrequencyTests(TestCase):
    """Tests of PairFrequency class: wrapper for Freqs."""
    def test_init_one_parameter(self):
        """PairFrequency should interpret single parameter as pair probs"""
        obs = PairFrequency('UCCC')
        exp = Freqs({('U','U'):0.0625, ('U','C'):0.1875, 
                      ('C','U'):0.1875, ('C','C'):0.5625})
        
        for k, v in exp.items():
            self.assertEqual(v, obs[k])
        for k, v in obs.items():
            if k not in exp:
                self.assertEqual(v, 0)

        self.assertEqual(PairFrequency('UCCC', [('U','U'),('C','C')]), \
            Freqs({('U','U'):0.1, ('C','C'):0.9}))
        #check that the alphabets are right: should not raise error on
        #incrementing characters already there, but should raise KeyError
        #on anything that's missing.
        p = PairFrequency('UCCC')
        p[('U','U')] += 1
        try:
            p[('X','U')] += 1
        except KeyError:
            pass
        else:
            raise AssertionError, "Expected KeyError."
        p = PairFrequency('UCCC', (('C','C'),))
        p[('C','C')] += 1
        try:
            p[('U','U')] += 1
        except KeyError:
            pass
        else:
            raise AssertionError, "Expected KeyError."

class BasePairFrequencyTests(TestCase):
    """Tests of the BaseFrequency class, constructed for easy initialization."""
    def test_init(self):
        """BaseFrequency init should provide correct PairFrequency"""
        WatsonCrick = [('A','U'), ('U','A'),('G','C'),('C','G')]
        Wobble = WatsonCrick + [('G','U'), ('U','G')]
        #by default, basepair should have the wobble alphabet
        bpf = BasePairFrequency('UUACG')
        pf = PairFrequency('UUACG', Wobble)
        self.assertEqual(bpf, pf)
        self.assertEqual(bpf.Constraint, pf.Constraint)
        #can turn GU off, leading to watson-crickery
        bpf = BasePairFrequency('UUACG', False)
        #make sure this gives different results...
        self.assertNotEqual(bpf, pf)
        self.assertNotEqual(bpf.Constraint, pf.Constraint)
        #...but that the results are the same when the correct alphabet is used
        pf = PairFrequency('UUACG', WatsonCrick)
        self.assertEqual(bpf, pf)
        self.assertEqual(bpf.Constraint, pf.Constraint)

class RegionModelTests(TestCase):
    """Tests of the RegionModel class. Base class just returns the template."""
    def test_init(self):
        """RegionModel base class should always return current template."""
        #test blank region model
        r = RegionModel()
        self.assertEqual(str(r.Current), '')
        self.assertEqual(len(r), 0)
        #now assign it to a template
        r.Template = ('ACGUUCGA')
        self.assertEqual(str(r.Current), 'ACGUUCGA')
        self.assertEqual(len(r), len('ACGUUCGA'))
        #check that refresh doesn't break anything
        r.refresh()
        self.assertEqual(str(r.Current), 'ACGUUCGA')
        self.assertEqual(len(r), len('ACGUUCGA'))
        #check composition
        self.assertEqual(r.Composition, None)
        d = {'A':3, 'U':10}
        r.Composition = Freqs(d)
        self.assertEqual(r.Composition, d)
        #check that composition doesn't break the update
        r.refresh()
        self.assertEqual(str(r.Current), 'ACGUUCGA')
        self.assertEqual(len(r), len('ACGUUCGA'))
 
class ConstantRegionTests(TestCase):
    """Tests of the ConstantRegion class. Just returns the template."""
    def test_init(self):
        """ConstantRegion should always return current template."""
        #test blank region model
        r = ConstantRegion()
        self.assertEqual(str(r.Current), '')
        self.assertEqual(len(r), 0)
        #now assign it to a template
        r.Template = ('ACGUUCGA')
        self.assertEqual(str(r.Current), 'ACGUUCGA')
        self.assertEqual(len(r), len('ACGUUCGA'))
        #check that refresh doesn't break anything
        r.refresh()
        self.assertEqual(str(r.Current), 'ACGUUCGA')
        self.assertEqual(len(r), len('ACGUUCGA'))
        #check composition
        self.assertEqual(r.Composition, None)
        d = {'A':3, 'U':10}
        r.Composition = Freqs(d)
        self.assertEqual(r.Composition, d)
        #check that composition doesn't break the update
        r.refresh()
        self.assertEqual(str(r.Current), 'ACGUUCGA')
        self.assertEqual(len(r), len('ACGUUCGA'))

class ShuffledRegionTests(TestCase):
    """Shuffled region should randomize string"""
    def test_init(self):
        """Shuffled region should init ok with string, ignoring base freqs"""
        #general strategy: seqs should be different, but sorted seqs should
        #be the same
        empty = ''
        seq = 'UUUCCCCAAAGGG'
        #check that we don't get errors on empty template
        r = ShuffledRegion(empty)
        r.refresh()
        self.assertEqual(str(r.Current), '')
        #check that changing the template changes the sequence
        r.Template = seq
        self.assertNotEqual(str(r.Current), '')
        #check that it shuffled the sequence the first time
        self.assertNotEqual(str(r.Current), seq)
        curr = str(r.Current)
        as_list = list(curr)
        #check that we have the right number of each type of base
        as_list.sort()
        exp_as_list = list(seq)
        exp_as_list.sort()
        self.assertEqual(as_list, exp_as_list)
        #check that we get something different if we refresh again
        r.refresh()
        self.assertNotEqual(str(r.Current), curr)
        as_list = list(str(r.Current))
        as_list.sort()
        self.assertEqual(as_list, exp_as_list)

class PairedRegionTests(TestCase):
    """Tests of paired region generation."""
    def test_init(self):
        """Paired region init and mutation should give expected results"""
        WatsonCrick = {'A':'U', 'U':'A', 'C':'G', 'G':'C'}
        Wobble = {'A':'U', 'U':'AG', 'C':'G', 'G':'UC'}
        #check that empty init doesn't give errors
        r = PairedRegion()
        r.refresh()
        #check that mutation works correctly
        r.Template = "N"
        self.assertEqual(len(r), 1)
        r.monomers('UCCGGA')
        upstream = r.Current[0]
        downstream = r.Current[1]
        states = {}
        num_to_do = 10000
        for i in range(num_to_do):
            r.refresh()
            curr = (upstream[0], downstream[0])
            assert upstream[0] in Wobble[downstream[0]]
            states[curr] = states.get(curr, 0) + 1
        for i in states.keys():
            assert i[1] in Wobble[i[0]]
        for i in Wobble:
            for j in Wobble[i]:
                assert (i, j) in states.keys()
        expected_dict = {('A','U'):num_to_do/14, ('U','A'):num_to_do/14,
                        ('C','G'):num_to_do/14*4, ('G','C'):num_to_do/14*4,
                        ('U','G'):num_to_do/14*2, ('G','U'):num_to_do/14*2,}
        # the following for loop was replaced with the assertSimilarFreqs
        # call below it
        #for key, val in expected.items():
            #self.assertFloatEqualAbs(val, states[key], 130) #conservative?
        expected = [val for key, val in expected_dict.items()]
        observed = [states[key] for key, val in expected_dict.items()]
        self.assertSimilarFreqs(observed, expected)

        assert ('G','U') in states
        assert ('U','G') in states
            
        r.monomers('UCGA', GU=False)
        upstream = r.Current[0]
        downstream = r.Current[1]
        states = {}
        num_to_do = 10000
        for i in range(num_to_do):
            r.refresh()
            curr = (upstream[0], downstream[0])
            assert upstream[0] in WatsonCrick[downstream[0]]
            states[curr] = states.get(curr, 0) + 1
        for i in states.keys():
            assert i[1] in WatsonCrick[i[0]]
        for i in WatsonCrick:
            for j in WatsonCrick[i]:
                assert (i, j) in states.keys()
        expected_dict = {('A','U'):num_to_do/4, ('U','A'):num_to_do/4,
                        ('C','G'):num_to_do/4, ('G','C'):num_to_do/4,}
        expected = [val for key, val in expected_dict.items()]
        observed = [states[key] for key, val in expected_dict.items()]
        self.assertSimilarFreqs(observed, expected)
        #for key, val in expected.items():
        #    self.assertFloatEqualAbs(val, states[key], 130) #3 std devs
        assert ('G','U') not in states
        assert ('U','G') not in states

class SequenceModelTests(TestCase):
    """Tests of the SequenceModel class."""
    def test_init(self):
        """SequenceModel should init OK with Isoleucine motif."""
        helices = [PairedRegion('NNN'), PairedRegion('NNNNN')]
        constants = [ConstantRegion('CUAC'), ConstantRegion('UAUUGGGG')]
        order = "H0 C0 H1 - H1 C1 H0"
        isoleucine = SequenceModel(order=order, constants=constants, \
            helices=helices)
        isoleucine.Composition = BaseFrequency('UCAG')
        #print
        #print
        for i in range(10):
            isoleucine.refresh()
            #print list(isoleucine)

        #print
        isoleucine.Composition = BaseFrequency('UCAG')
        isoleucine.GU = False
        #print
        for i in range(10):
            isoleucine.refresh()
            #print list(isoleucine)
        #print

class RuleTests(TestCase):
    """Tests of the Rule class"""
    
    def test_init_bad_params(self):
        """Rule should fail validation except with exactly 5 parameters"""
        self.assertRaises(TypeError, Rule, 1, 1, 1, 1)
        self.assertRaises(TypeError, Rule, 1, 1, 1, 1, 1, 1)
        
    def test_init_bad_length(self):
        """Rule should fail validation if helix extends past downstream start"""
        self.assertRaises(ValueError, Rule, 0, 0, 1, 0, 2)
        self.assertRaises(ValueError, Rule, 0, 0, 10, 10, 12)

    def test_init_bad_negative_params(self):
        """Rule should fail validation if any parameters are negative"""
        self.assertRaises(ValueError, Rule, -1, 0, 1, 0, 1)
        self.assertRaises(ValueError, Rule, 0, -1, 1, 1, 1)
        self.assertRaises(ValueError, Rule, 0, 0, -1, 0, 5)
        self.assertRaises(ValueError, Rule, 0, 0, 0, -1, 1)
        self.assertRaises(ValueError, Rule, 0, 0, 1, 1, -1)

    def test_init_bad_zero_length(self):
        """Rule should fail validation if length is zero"""
        self.assertRaises(ValueError, Rule, 0, 0, 1, 1, 0)

    def test_init_overlap(self):
        """Rule should fail validation if bases must pair with themselves"""
        self.assertRaises(ValueError, Rule, 0, 0, 0, 0, 1)
        self.assertRaises(ValueError, Rule, 0, 10, 0, 15, 4)

    def test_init_wrong_order(self):
        """First sequence must have lower index"""
        self.assertRaises(ValueError, Rule, 1, 0, 0, 5, 3)

    def test_init_ok_length(self):
        """Rule should init OK if helix extends to exactly downstream start"""
        x = Rule(0, 0, 1, 0, 1)
        self.assertEqual(str(x), \
        "Up Seq: 0 Up Pos: 0 Down Seq: 1 Down Pos: 0 Length: 1")
        #check adjacent bases
        x = Rule(0, 0, 0, 1, 1)
        self.assertEqual(str(x), \
        "Up Seq: 0 Up Pos: 0 Down Seq: 0 Down Pos: 1 Length: 1")
        x = Rule(1, 10, 2, 8, 7)
        #check rule that would cause overlap if motifs weren't different 
        self.assertEqual(str(x), \
        "Up Seq: 1 Up Pos: 10 Down Seq: 2 Down Pos: 8 Length: 7")

    def test_str(self):
        """Rule str method should give expected results"""
        x = Rule(1, 10, 2, 8, 7)
        self.assertEqual(str(x), \
        "Up Seq: 1 Up Pos: 10 Down Seq: 2 Down Pos: 8 Length: 7")

class RuleTests_compatibility(TestCase):
    """Tests to see whether the Rule compatibility code works"""

    def setUp(self):
        """Sets up some standard rules"""
        self.x = Rule(1, 5, 2, 10, 3)
        self.x_ok = Rule(1, 8, 2, 14, 4)
        self.x_ok_diff_sequences = Rule(3, 5, 5, 10, 3)
        self.x_bad_first = Rule(1, 0, 3, 10, 10)
        self.x_bad_first_2 = Rule(0, 0, 1, 8, 2)
        self.x_bad_second = Rule(1, 15, 2, 15, 8)
        self.x_bad_second_2 = Rule(1, 14, 2, 8, 4)

    def test_is_compatible_ok(self):
        """Rule.isCompatible should return True if rules don't overlap"""
        self.assertEqual(self.x.isCompatible(self.x_ok), True)  #no return value
        self.assertEqual(self.x.isCompatible(self.x_ok_diff_sequences), True)
        #check that it's transitive
        self.assertEqual(self.x_ok.isCompatible(self.x), True)
        self.assertEqual(self.x_ok_diff_sequences.isCompatible(self.x), True)
        
    def test_is_compatible_bad(self):
        """Rule.isComaptible should return False if rules overlap"""
        tests = [   (self.x, self.x_bad_first),
                    (self.x, self.x_bad_first_2),
                    (self.x, self.x_bad_second),
                    (self.x, self.x_bad_second_2),
                ]
        for first, second in tests:
            self.assertEqual(first.isCompatible(second), False)
            #check that it's transitive
            self.assertEqual(second.isCompatible(first), False)

    def test_fits_in_sequence(self):
        """Rule.fitsInSequence should return True if sequence long enough"""
        sequences = map('x'.__mul__, range(21))     #0 to 20 copies of 'x'
        rules = [self.x, self.x_ok, self.x_ok_diff_sequences, self.x_bad_first,
                 self.x_bad_first_2, self.x_bad_second, self.x_bad_second_2]
        #test a bunch of values for all the rules we have handy
        for s in sequences:
            for r in rules:
                if r.UpstreamPosition + r.Length > len(s):
                    self.assertEqual(r.fitsInSequence(s), False)
                else:
                    self.assertEqual(r.fitsInSequence(s), True)
        #test a couple of specific boundary cases
        #length-1 helix
        r = Rule(0, 0, 1, 0, 1)
        self.assertEqual(r.fitsInSequence(''), False)
        self.assertEqual(r.fitsInSequence('x'), True)
        self.assertEqual(r.fitsInSequence('xx'), True)
        #length-2 helix starting one base from the start
        r = Rule(1, 1, 2, 2, 2)
        self.assertEqual(r.fitsInSequence(''), False)
        self.assertEqual(r.fitsInSequence('x'), False)
        self.assertEqual(r.fitsInSequence('xx'), False)
        self.assertEqual(r.fitsInSequence('xxx'), True)
        self.assertEqual(r.fitsInSequence('xxxx'), True)

class ModuleTests(TestCase):
    """Tests of the Module class, which holds sequences and structures."""
    def test_init_bad(self):
        """Module init should fail if seq/struct missing, or mismatched lengths"""
        #test incorrect param number
        self.assertRaises(TypeError, Module, 'abc')
        self.assertRaises(TypeError, Module, 'abc', 'def', 'ghi')
        #test incorrect lengths
        self.assertRaises(ValueError, Module, 'abc', 'abcd')
        self.assertRaises(ValueError, Module, 'abcd', 'acb')

    def test_init_good(self):
        """Module init should work if seq and struct same length"""
        m = Module('U', '.')
        self.assertEqual(m.Sequence, 'U')
        self.assertEqual(m.Structure, '.')
        m.Sequence = ''
        m.Structure = ''
        self.assertEqual(m.Sequence, '')
        self.assertEqual(m.Structure, '')
        m.Sequence = 'CCUAGG'
        m.Structure = '((..))'
        self.assertEqual(m.Sequence, 'CCUAGG')
        self.assertEqual(m.Structure, '((..))')
        m.Structure = ''
        self.assertRaises(ValueError, m.__len__)

    def test_len(self):
        """Module len should work if seq and struct same length"""
        m = Module('CUAG', '....')
        self.assertEqual(len(m), 4)
        m = Module('', '')
        self.assertEqual(len(m), 0)
        m.Sequence = 'AUCGAUCGA'
        self.assertRaises(ValueError, m.__len__)
   
    def test_str(self):
       """Module str should contain sequence and structure"""
       m = Module('CUAG', '....')
       self.assertEqual(str(m), 'Sequence:  CUAG\nStructure: ....')
       m = Module('', '')
       self.assertEqual(str(m), 'Sequence:  \nStructure: ')
   
    def test_matches(self):
        """Module matches should return correct result for seq/struct match"""
        empty = Module('', '')
        short_p = Module('AC', '((')
        short_u = Module('UU', '..')
        short_up = Module('UU', '((')
        long_all = Module('GGGACGGUUGGUUGGUU', ')))((..((....((((') #struct+seq
        long_seq = Module('GGGACGGUUGGUU', ')))))))))))))') #seq but not struct
        long_struct = Module('GGGGGGGGGGGGG', ')))((..((....') #struct, not seq
        long_none = Module('GGGGGGGGGGGGG', ')))))))))))))') #not struct or seq

        #test overall matching
        for matcher in [empty, short_p, short_u, short_up]:
            self.assertEqual(matcher.matches(long_all), True)
            for longer in [long_seq, long_struct, long_none]:
                if matcher is empty:
                    self.assertEqual(matcher.matches(longer), True)
                else:
                    self.assertEqual(matcher.matches(longer), False)
        #test specific positions
        positions = {3:short_p, 11:short_u, 7:short_up, 15:short_up}
        for module in [short_p, short_u, short_up]:
            for i in range(len(long_all)):
                result = module.matches(long_all, i)
                if positions.get(i, None) is module:
                    self.assertEqual(result, True)
                else:
                    self.assertEqual(result, False)

class MotifTests(TestCase):
    """Tests of the Motif object, which has a set of Modules and Rules."""
    def setUp(self):
        """Defines a few standard motifs"""
        self.ile_mod_0 = Module('NNNCUACNNNNN', '(((((..(((((')
        self.ile_mod_1 = Module('NNNNNUAUUGGGGNNN', ')))))......)))))')
        self.ile_rule_0 = Rule(0, 0, 1, 15, 3)
        self.ile_rule_1 = Rule(0, 7, 1, 4, 5)
        self.ile = Motif([self.ile_mod_0, self.ile_mod_1], \
            [self.ile_rule_0, self.ile_rule_1])
        self.hh_mod_0 = Module('NNNNUNNNNN', '(((((.((((')
        self.hh_mod_1 = Module('NNNNCUGANGAGNNN', ')))).......((((')
        self.hh_mod_2 = Module('NNNCGAAANNNN', '))))...)))))')
        self.hh_rule_0 = Rule(0, 0, 2, 11, 5)
        self.hh_rule_1 = Rule(0, 6, 1, 3, 4)
        self.hh_rule_2 = Rule(1, 11, 2, 3, 4)
        self.hh = Motif([self.hh_mod_0, self.hh_mod_1, self.hh_mod_2], \
                        [self.hh_rule_0, self.hh_rule_1, self.hh_rule_2])
        self.simple_0 = Module('CCCCC', '(((..')
        self.simple_1 = Module('GGGGG', '..)))')
        self.simple_r = Rule(0, 0, 1, 4, 3)
        self.simple = Motif([self.simple_0, self.simple_1], [self.simple_r])

    def test_init_bad_rule_lengths(self):
        """Motif init should fail if rules don't match module lengths"""
        bad_rule = Rule(0, 0, 1, 8, 6)
        self.assertRaises(ValueError, Motif, [self.simple_0, self.simple_1], \
            [bad_rule])

    def test_init_conflicting_rules(self):
        """Motif init should fail if rules overlap"""
        interferer = Rule(0, 2, 2, 20, 4)
        self.assertRaises(ValueError, Motif, [self.ile_mod_0, self.ile_mod_1, \
            self.ile_mod_0], [self.ile_rule_0, interferer]) 
    
    def test_matches_simple(self):
        """Test of simple match should work correctly"""
        index =                    '01234567890123456789012345678901'
        seq =                      'AAACCCCCUUUGGGGGAAACCCCCUUUGGGGG'
        struct =   ViennaStructure('((..((..))....))...(((.......)))')   
        struct_2 = ViennaStructure('((((((..((())))))))).....(((.)))')
                                    #substring right, not pair

        self.assertEqual(self.simple.matches(seq, struct, [19, 27]), True)
        self.assertEqual(self.simple.matches(seq, struct_2, [19,27]), False)

        for first_pos in range(len(seq) - len(self.simple_0) + 1):
            for second_pos in range(len(seq) - len(self.simple_1) + 1):
                #should match struct only at one location
                match=self.simple.matches(seq, struct, [first_pos, second_pos])
                if (first_pos == 19) and (second_pos == 27):
                    self.assertEqual(match, True)
                else:
                    self.assertEqual(match, False)
                #should never match in struct_2
                self.assertEqual(self.simple.matches(seq, struct_2, \
                    [first_pos, second_pos]), False)

        #check that it doesn't fail if there are _two_ matches
        index =  '01234567890123456789'
        seq =    'CCCCCGGGGGCCCCCGGGGG'
        struct = '(((....)))(((....)))'
        struct = ViennaStructure(struct)
        self.assertEqual(self.simple.matches(seq, struct, [0, 5]), True)
        self.assertEqual(self.simple.matches(seq, struct, [10,15]), True)
        #not allowed to cross-pair
        self.assertEqual(self.simple.matches(seq, struct, [0, 15]), False)

    def test_matches_ile(self):
        """Test of isoleucine match should work correctly"""
        index =    '012345678901234567890123456789012345'
        seq_good = 'AAACCCCUACUUUUUCCCAAAAAUAUUGGGGGGGAA'
        seq_bad =  'AAACCCCUACUUUUUCCCAAAAAUAUUGGGCGGGAA'
        st_good =  '...(((((..(((((...)))))......)))))..'
        st_bad =   '((((((((..(((((...)))))...))))))))..'

        st_good = ViennaStructure(st_good)
        st_bad = ViennaStructure(st_bad)

        for first_pos in range(len(seq_good) - len(self.ile_mod_0) + 1):
            for second_pos in range(len(seq_good) - len(self.ile_mod_1) + 1):
                #seq_good and struct_good should match at one location
                match=self.ile.matches(seq_good,st_good,[first_pos,second_pos])
                if (first_pos == 3) and (second_pos == 18):
                    self.assertEqual(match, True)
                else:
                    self.assertEqual(match, False)
                self.assertEqual(self.ile.matches(seq_good, st_bad, \
                    [first_pos, second_pos]), False)
                self.assertEqual(self.ile.matches(seq_bad, st_good, \
                    [first_pos, second_pos]), False)
                self.assertEqual(self.ile.matches(seq_bad, st_bad, \
                    [first_pos, second_pos]), False)

    def test_matches_hh(self):
        """Test of hammerhead match should work correctly"""
        index =    '0123456789012345678901234567890123456'
        seq_good = 'CCCCUAGGGGCCCCCUGAAGAGAAAUUUCGAAAGGGG'
        seq_bad ='CCCCCAGGGGCCCCCUGAAGAGAAAUUUCGAAGGGGG'
        structure ='(((((.(((()))).......(((())))...)))))'
        struct = ViennaStructure(structure)
        self.assertEqual(self.hh.matches(seq_good, struct, [0, 10, 25]), True)
        self.assertEqual(self.hh.matches(seq_bad, struct, [0, 10, 25]), False)

    def test_structureMatches_hh(self):
        """Test of hammerhead structureMatch should work correctly"""
        index =    '0123456789012345678901234567890123456'
        seq_good = 'CCCCUAGGGGCCCCCUGAAGAGAAAUUUCGAAAGGGG'
        seq_bad ='CCCCCAGGGGCCCCCUGAAGAGAAAUUUCGAAGGGGG'
        structure ='(((((.(((()))).......(((())))...)))))'
        struct = ViennaStructure(structure)
        self.assertEqual(self.hh.structureMatches(struct, [0, 10, 25]), True)
        self.assertEqual(self.hh.structureMatches(struct, [0, 10, 25]), True)

class SequenceEmbedderTests(TestCase):
    """Tests of the SequenceEmbedder class."""
    def setUp(self):
        """Define a few standard models and motifs"""
        ile_mod_0 = Module('NNNCUACNNNNN', '(((((..(((((')
        ile_mod_1 = Module('NNNNNUAUUGGGGNNN', ')))))......)))))')
        ile_rule_0 = Rule(0, 0, 1, 15, 5)
        ile_rule_1 = Rule(0, 7, 1, 4, 5)
        ile_motif = Motif([ile_mod_0, ile_mod_1], \
            [ile_rule_0, ile_rule_1])

        helices = [PairedRegion('NNN'), PairedRegion('NNNNN')]
        constants = [ConstantRegion('CUAC'), ConstantRegion('UAUUGGGG')]
        order = "H0 C0 H1 - H1 C1 H0"
        ile_model = SequenceModel(order=order, constants=constants, \
            helices=helices, composition=BaseFrequency('UCAG'))

        self.ile_embedder = SequenceEmbedder(length=50, num_to_do=10, \
            motif=ile_motif, model=ile_model, composition=BaseFrequency('UCAG'))

        short_ile_mod_0 = Module('NCUACNN', '(((..((')
        short_ile_mod_1 = Module('NNUAUUGGGGN', '))......)))')
        short_ile_rule_0 = Rule(0, 0, 1, 10, 3)
        short_ile_rule_1 = Rule(0, 5, 1, 1, 2)
        short_ile_motif = Motif([short_ile_mod_0, short_ile_mod_1], \
            [short_ile_rule_0, short_ile_rule_1])

        short_helices = [PairedRegion('N'), PairedRegion('NN')]
        short_constants = [ConstantRegion('CUAC'), ConstantRegion('UAUUGGGG')]
        short_order = "H0 C0 H1 - H1 C1 H0"
        short_ile_model = SequenceModel(order=short_order, \
            constants=short_constants, \
            helices=short_helices, composition=BaseFrequency('UCAG'))

        self.short_ile_embedder = SequenceEmbedder(length=50, num_to_do=10, \
            motif=short_ile_motif, model=short_ile_model, \
            composition=BaseFrequency('UCAG'))


    def test_composition_change(self):
        """Changes in composition should propagate."""
        rr = str(self.ile_embedder.RandomRegion.Current)
        #for base in 'UCAG':
        #    assert base in rr
        #the above two lines should generally be true but fail stochastically
        self.ile_embedder.Composition = BaseFrequency('CG')
        self.assertEqual(self.ile_embedder.Model.Composition, \
            BaseFrequency('CG'))
        self.assertEqual(self.ile_embedder.RandomRegion.Composition, \
            BaseFrequency('CG'))
        self.ile_embedder.RandomRegion.refresh()
        self.assertEqual(len(self.ile_embedder.RandomRegion), 22)
        rr = str(self.ile_embedder.RandomRegion.Current)
        assert ('C' in rr or 'G' in rr)
        assert 'A' not in rr
        assert 'U' not in rr

    def test_choose_locations_too_short(self):
        """SequenceEmbedder _choose_locations should fail if too little space"""
        self.ile_embedder.Length = 28   #no positions left over
        self.assertRaises(ValueError, self.ile_embedder._choose_locations)
        self.ile_embedder.Length = 29   #one position left over
        self.assertRaises(ValueError, self.ile_embedder._choose_locations)

    def test_choose_locations_exact(self):
        """SequenceEmbedder _choose_locations should pick all locations"""
        self.ile_embedder.Length = 30   #two positions left: must both be filled
        for i in range(10):
            first, second = self.ile_embedder._choose_locations()
            self.assertEqual(first, 0)
            self.assertEqual(second, 1)
            
    def test_choose_locations_even(self):
        """SequenceEmbedder _choose_locations should pick locations evenly"""
        self.ile_embedder.Length = 31   #three positions left
        counts = {}
        for i in range(1000):
            key = tuple(self.ile_embedder._choose_locations())
            assert key[0] != key[1]
            curr = counts.get(key, 0)
            counts[key] = curr + 1
        expected = [333, 333, 333]
        observed = [counts[(0,1)], counts[(0,2)], counts[(1,2)]]
        self.assertSimilarFreqs(observed, expected)
        #make sure nothing else snuck in there
        self.assertEqual(counts[(0,1)]+counts[(0,2)]+counts[(1,2)], 1000)

    def test_choose_locations_with_replacement(self):
        """SequenceEmbedder _choose_locations can sample with replacement"""
        self.ile_embedder.Length = 28   #exact fit
        self.ile_embedder.WithReplacement = True
        for i in range(10):
            first, second = self.ile_embedder._choose_locations()
            self.assertEqual(first, 0)
            self.assertEqual(second, 0)

        self.ile_embedder.Length = 29 #one left over: can be 0,0 0,1 1,1
        counts = {}
        for i in range(1000):
            key = tuple(self.ile_embedder._choose_locations())
            curr = counts.get(key, 0)
            counts[key] = curr + 1
        expected = [250, 500, 250]
        observed = [counts[(0,0)], counts[(0,1)], counts[(1,1)]]
        self.assertSimilarFreqs(observed, expected)
        #make sure nothing else snuck in there
        self.assertEqual(counts[(0,0)]+counts[(0,1)]+counts[(1,1)], 1000)
  
    def test_insert_modules(self):
        """SequenceEmbedder _insert_modules should make correct sequence"""
        ile = self.ile_embedder
        ile.Length = 50
        ile.RandomRegion.Current[:] = ['A'] * 22
        modules = list(ile.Model)
        ile.Positions = [0, 0]  #try inserting at first position
        self.assertEqual(str(ile), modules[0] + modules[1] + 'A'*22)

        ile.Positions = [3, 20]
        self.assertEqual(str(ile), 'A'*3+modules[0]+'A'*17+modules[1]+'A'*2)

    def test_refresh(self):
        """SequenceEmbedder refresh should change module sequences"""
        modules_before = list(self.ile_embedder.Model)
        random_before = str(self.ile_embedder.RandomRegion.Current)
        self.ile_embedder.refresh()
        random_after = str(self.ile_embedder.RandomRegion.Current)
        self.assertNotEqual(random_before, random_after)
        modules_after = list(self.ile_embedder.Model)
        for before, after in zip(modules_before, modules_after):
            self.assertNotEqual(before, after)
        #check that it works twice
        self.ile_embedder.refresh()
        random_third = str(self.ile_embedder.RandomRegion.Current)
        modules_third = list(self.ile_embedder.Model)
        self.assertNotEqual(random_third, random_before)
        self.assertNotEqual(random_third, random_after)
        for first, second, third in \
            zip(modules_before, modules_after, modules_third):
            self.assertNotEqual(first, third)
            self.assertNotEqual(second, third)

    def test_countMatches(self):
        """Shouldn't find any Ile matches if all the pairs are GU"""
        if not RNAFOLD_PRESENT:
            return
        self.ile_embedder.NumToDo = 100
        self.ile_embedder.Composition = BaseFrequency('GGGGGGGGGU')
        self.ile_embedder.Length = 40
        good_count = self.ile_embedder.countMatches()   
        self.assertEqual(good_count, 0)

    def test_countMatches_pass(self):
        """Should find some matches against a random background"""
        if not RNAFOLD_PRESENT:
            return
        self.ile_embedder.NumToDo = 100
        self.ile_embedder.Composition = BaseFrequency('UCAG')
        self.ile_embedder.Length = 40
        good_count = self.ile_embedder.countMatches()
        self.assertNotEqual(good_count, 0)

    def test_refresh_specific_position(self):
        """Should always find the module in the same position if specified"""
        first_module = Module('AAAAA', '(((((')
        second_module = Module('UUUUU', ')))))')
        rule_1 = Rule(0, 0, 1, 4, 5)
        helix = Motif([first_module, second_module], [rule_1])
        model = SequenceModel(constants=[ConstantRegion('AAAAA'), \
            ConstantRegion('UUUUU')], order='C0 - C1', \
            composition=BaseFrequency('A'))
        embedder = SequenceEmbedder(length=30, num_to_do=100, \
            motif=helix, model=model, composition=BaseFrequency('CG'), \
            positions=[3, 6])

        last = ''
        for i in range(100):
            embedder.refresh()
            curr = str(embedder)
            self.assertEqual(curr[3:8], 'AAAAA')
            self.assertEqual(curr[11:16], 'UUUUU')
            self.assertEqual(curr.count('A'), 5)
            self.assertEqual(curr.count('U'), 5)
            self.assertNotEqual(last, curr)
            last = curr
            
    def test_refresh_primers(self):
        """Module should appear in correct location with primers"""
        first_module = Module('AAAAA', '(((((')
        second_module = Module('UUUUU', ')))))')
        rule_1 = Rule(0, 0, 1, 4, 5)
        helix = Motif([first_module, second_module], [rule_1])
        model = SequenceModel(constants=[ConstantRegion('AAAAA'), \
            ConstantRegion('UUUUU')], order='C0 - C1', \
            composition=BaseFrequency('A'))
        embedder = SequenceEmbedder(length=30, num_to_do=100, \
            motif=helix, model=model, composition=BaseFrequency('CG'), \
            positions=[3, 6], primer_5 = 'UUU', primer_3 = 'AAA')

        last = ''
        for i in range(100):
            embedder.refresh()
            curr = str(embedder)
            self.assertEqual(curr[0:3], 'UUU')
            self.assertEqual(curr[6:11], 'AAAAA')
            self.assertEqual(curr[14:19], 'UUUUU')
            self.assertEqual(curr.count('A'), 8)
            self.assertEqual(curr.count('U'), 8)
            self.assertEqual(curr[-3:], 'AAA')
            self.assertNotEqual(last, curr)
            last = curr
 
    def xxx_test_count_long(self):
        self.ile_embedder.NumToDo = 100000
        self.ile_embedder.Composition = BaseFrequency('UCAG')
        print
        print "Extended helices"
        for length in range(30, 150):
            self.ile_embedder.Length = length
            good_count = self.ile_embedder.countMatches()   
            print "Length: %s Matches: %s/100000" % (length, good_count)
        print

    def xxx_test_count_short(self):
        self.short_ile_embedder.NumToDo = 10000
        self.short_ile_embedder.Composition = BaseFrequency('UCAG')
        print
        print "Minimal motif"
        for length in range(20, 150):
            self.short_ile_embedder.Length = length
            good_count = self.short_ile_embedder.countMatches()   
            print "Length: %s Matches: %s/10000" % (length, good_count)
        print



if __name__ == '__main__':
    main()