File: test_misc.py

package info (click to toggle)
python-cogent 1.9-14
  • links: PTS, VCS
  • area: main
  • in suites: buster
  • size: 19,752 kB
  • sloc: python: 137,485; makefile: 149; sh: 64
file content (1669 lines) | stat: -rw-r--r-- 70,009 bytes parent folder | download
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
966
967
968
969
970
971
972
973
974
975
976
977
978
979
980
981
982
983
984
985
986
987
988
989
990
991
992
993
994
995
996
997
998
999
1000
1001
1002
1003
1004
1005
1006
1007
1008
1009
1010
1011
1012
1013
1014
1015
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032
1033
1034
1035
1036
1037
1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055
1056
1057
1058
1059
1060
1061
1062
1063
1064
1065
1066
1067
1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081
1082
1083
1084
1085
1086
1087
1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
1109
1110
1111
1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
1126
1127
1128
1129
1130
1131
1132
1133
1134
1135
1136
1137
1138
1139
1140
1141
1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
1152
1153
1154
1155
1156
1157
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
1169
1170
1171
1172
1173
1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
1187
1188
1189
1190
1191
1192
1193
1194
1195
1196
1197
1198
1199
1200
1201
1202
1203
1204
1205
1206
1207
1208
1209
1210
1211
1212
1213
1214
1215
1216
1217
1218
1219
1220
1221
1222
1223
1224
1225
1226
1227
1228
1229
1230
1231
1232
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
1243
1244
1245
1246
1247
1248
1249
1250
1251
1252
1253
1254
1255
1256
1257
1258
1259
1260
1261
1262
1263
1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
1274
1275
1276
1277
1278
1279
1280
1281
1282
1283
1284
1285
1286
1287
1288
1289
1290
1291
1292
1293
1294
1295
1296
1297
1298
1299
1300
1301
1302
1303
1304
1305
1306
1307
1308
1309
1310
1311
1312
1313
1314
1315
1316
1317
1318
1319
1320
1321
1322
1323
1324
1325
1326
1327
1328
1329
1330
1331
1332
1333
1334
1335
1336
1337
1338
1339
1340
1341
1342
1343
1344
1345
1346
1347
1348
1349
1350
1351
1352
1353
1354
1355
1356
1357
1358
1359
1360
1361
1362
1363
1364
1365
1366
1367
1368
1369
1370
1371
1372
1373
1374
1375
1376
1377
1378
1379
1380
1381
1382
1383
1384
1385
1386
1387
1388
1389
1390
1391
1392
1393
1394
1395
1396
1397
1398
1399
1400
1401
1402
1403
1404
1405
1406
1407
1408
1409
1410
1411
1412
1413
1414
1415
1416
1417
1418
1419
1420
1421
1422
1423
1424
1425
1426
1427
1428
1429
1430
1431
1432
1433
1434
1435
1436
1437
1438
1439
1440
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
1451
1452
1453
1454
1455
1456
1457
1458
1459
1460
1461
1462
1463
1464
1465
1466
1467
1468
1469
1470
1471
1472
1473
1474
1475
1476
1477
1478
1479
1480
1481
1482
1483
1484
1485
1486
1487
1488
1489
1490
1491
1492
1493
1494
1495
1496
1497
1498
1499
1500
1501
1502
1503
1504
1505
1506
1507
1508
1509
1510
1511
1512
1513
1514
1515
1516
1517
1518
1519
1520
1521
1522
1523
1524
1525
1526
1527
1528
1529
1530
1531
1532
1533
1534
1535
1536
1537
1538
1539
1540
1541
1542
1543
1544
1545
1546
1547
1548
1549
1550
1551
1552
1553
1554
1555
1556
1557
1558
1559
1560
1561
1562
1563
1564
1565
1566
1567
1568
1569
1570
1571
1572
1573
1574
1575
1576
1577
1578
1579
1580
1581
1582
1583
1584
1585
1586
1587
1588
1589
1590
1591
1592
1593
1594
1595
1596
1597
1598
1599
1600
1601
1602
1603
1604
1605
1606
1607
1608
1609
1610
1611
1612
1613
1614
1615
1616
1617
1618
1619
1620
1621
1622
1623
1624
1625
1626
1627
1628
1629
1630
1631
1632
1633
1634
1635
1636
1637
1638
1639
1640
1641
1642
1643
1644
1645
1646
1647
1648
1649
1650
1651
1652
1653
1654
1655
1656
1657
1658
1659
1660
1661
1662
1663
1664
1665
1666
1667
1668
1669
#!/usr/bin/env python

"""Unit tests for utility functions and classes.
"""
from copy import copy, deepcopy
from os import remove, rmdir
from os.path import exists
from cogent.app.util import get_tmp_filename
from cogent.util.unit_test import TestCase, main
from cogent.util.misc import (iterable, max_index, min_index,
    flatten, is_iterable, is_char, is_char_or_noniterable,
    is_str_or_noniterable, not_list_tuple, list_flatten,
    recursive_flatten, unflatten, unzip, select, sort_order, find_all,
    find_many, unreserve,
    extract_delimited, caps_from_underscores,
    add_lowercase, InverseDict, InverseDictMulti, DictFromPos, DictFromFirst,
    DictFromLast, DistanceFromMatrix, PairsFromGroups,
    ClassChecker, Delegator, FunctionWrapper,
    ConstraintError, ConstrainedContainer,
    ConstrainedString, ConstrainedList, ConstrainedDict,
    MappedString, MappedList, MappedDict,
    generateCombinations, makeNonnegInt,
    NonnegIntError, reverse_complement, not_none, get_items_except,
    NestedSplitter, curry, app_path, remove_files, get_random_directory_name,
    revComp, parse_command_line_parameters, safe_md5, 
    create_dir, handle_error_codes, identity, if_, deep_list, deep_tuple,
    combinate,gzip_dump,gzip_load,recursive_flatten_old,getNewId,toString,
    timeLimitReached, get_independent_coords, get_merged_by_value_coords,
    get_merged_overlapping_coords, get_run_start_indices)
from numpy import array
from time import clock, sleep

__author__ = "Rob Knight"
__copyright__ = "Copyright 2007-2016, The Cogent Project"
__credits__ = ["Rob Knight", "Amanda Birmingham", "Sandra Smit",
                    "Zongzhi Liu", "Peter Maxwell", "Daniel McDonald"]
__license__ = "GPL"
__version__ = "1.9"
__maintainer__ = "Rob Knight"
__email__ = "rob@spot.colorado.edu"
__status__ = "Production"

class UtilsTests(TestCase):
    """Tests of individual functions in utils"""
    
    def setUp(self):
        """ """
        self.files_to_remove = []
        self.dirs_to_remove = []
        
    def tearDown(self):
        """ """
        map(remove,self.files_to_remove)
        map(rmdir,self.dirs_to_remove)

    def test_identity(self):
        """should return same object"""
        foo = [1,'a',lambda x: x]
        exp = id(foo)
        self.assertEqual(id(identity(foo)), exp)

    def test_if_(self):
        """implementation of c-like tertiary operator"""
        exp = 'yay'
        obs = if_(True, 'yay', 'nay')
        self.assertEqual(obs, exp)
        exp = 'nay'
        obs = if_(False, 'yay', 'nay')
        self.assertEqual(obs, exp)

    def test_deep_list(self):
        """should convert nested tuple to nested list"""
        input = ((1,(2,3)),(4,5),(6,7))
        exp = [[1,[2,3]],[4,5],[6,7]]
        obs = deep_list(input)
        self.assertEqual(obs, exp)

    def test_deep_tuple(self):
        """Should convert a nested list to a nested tuple"""
        exp = ((1,(2,3)),(4,5),(6,7))
        input = [[1,[2,3]],[4,5],[6,7]]
        obs = deep_tuple(input)
        self.assertEqual(obs, exp)

    def test_combinate(self):
        """Should return combinations"""
        input = [1,2,3,4]
        n = 2
        exp = [[1,2],[1,3],[1,4],[2,3],[2,4],[3,4]]
        obs = list(combinate(input, n))
        self.assertEqual(obs, exp)

    def test_recursive_flatten_old(self):
        """Should flatten nested lists"""
        input = [[[1,2],[3,[4,5]],[6,7]],8]
        exp = [1,2,3,4,5,6,7,8]
        obs = recursive_flatten_old(input)
        self.assertEqual(obs, exp)
        
    def test_getNewId(self):
        """should return a random 12 digit id"""
        rand_f = lambda x: 1
        obs = getNewId(rand_f=rand_f)
        exp = '111111111111'
        self.assertEqual(obs,exp)

    def test_toString(self):
        """should stringify an object"""
        class foo(object):
            def __init__(self):
                self.bar = 5
        exp = 'bar: 5'
        obs = toString(foo())
        self.assertEqual(obs, exp)

    # this test and the code it tests is architecture dependent. that is not
    # good.
    #def test_timeLimitReached(self):
    #    """should return true if timelimit has been reached, else return false"""
    #    start = clock()
    #    timelimit = .0002
    #    exp = False
    #    sleep(1)
    #    obs = timeLimitReached(start, timelimit)
    #    self.assertEqual(obs, exp)
    #    sleep(1)
    #    exp = True
    #    obs = timeLimitReached(start, timelimit)
    #    self.assertEqual(obs, exp)


    def test_safe_md5(self):
        """Make sure we have the expected md5"""
        exp = 'd3b07384d113edec49eaa6238ad5ff00'

        tmp_fp = get_tmp_filename(prefix='test_safe_md5', suffix='txt')
        self.files_to_remove.append(tmp_fp)
        tmp_f = open(tmp_fp, 'w')
        tmp_f.write('foo\n')
        tmp_f.close()

        obs = safe_md5(open(tmp_fp, 'U'))
        self.assertEqual(obs.hexdigest(),exp)

    def test_iterable(self):
        """iterable(x) should return x or [x], always an iterable result"""
        self.assertEqual(iterable('x'), 'x')
        self.assertEqual(iterable(''), '')
        self.assertEqual(iterable(3), [3])
        self.assertEqual(iterable(None), [None])
        self.assertEqual(iterable({'a':1}), {'a':1})
        self.assertEqual(iterable(['a','b','c']), ['a', 'b', 'c'])

    def test_max_index(self):
        """max_index should return index of largest item, last if tie"""
        self.assertEqual(max_index('abcde'), 4)
        self.assertEqual(max_index('ebcda'), 0)
        self.assertRaises(ValueError, max_index, '')
        self.assertEqual(max_index('ebcde'), 4)
        self.assertEqual(max_index([0, 0, 1, 0]), 2)

    def test_min_index(self):
        """min_index should return index of smallest item, first if tie"""
        self.assertEqual(min_index('abcde'), 0)
        self.assertEqual(min_index('ebcda'), 4)
        self.assertRaises(ValueError, min_index, '')
        self.assertEqual(min_index('ebcde'), 1)
        self.assertEqual(min_index([0,0,1,0]), 0)

    def test_flatten_no_change(self):
        """flatten should not change non-nested sequences (except to list)"""
        self.assertEqual(flatten('abcdef'), list('abcdef')) #test identities
        self.assertEqual(flatten([]), []) #test empty sequence
        self.assertEqual(flatten(''), []) #test empty string

    def test_flatten(self):
        """flatten should remove one level of nesting from nested sequences"""
        self.assertEqual(flatten(['aa', 'bb', 'cc']), list('aabbcc'))
        self.assertEqual(flatten([1,[2,3], [[4, [5]]]]), [1, 2, 3, [4,[5]]])

    def test_is_iterable(self):
        """is_iterable should return True for iterables"""
        #test str
        self.assertEqual(is_iterable('aa'), True)
        #test list
        self.assertEqual(is_iterable([3,'aa']), True)
        #test Number, expect False
        self.assertEqual(is_iterable(3), False)
    
    def test_is_char(self):
        """is_char(obj) should return True when obj is a char"""
        self.assertEqual(is_char('a'), True)
        self.assertEqual(is_char('ab'), False)
        self.assertEqual(is_char(''), True)
        self.assertEqual(is_char([3]), False)
        self.assertEqual(is_char(3), False)

    def test_is_char_or_noniterable(self):
        """is_char_or_noniterable should return True or False"""
        self.assertEqual(is_char_or_noniterable('a'), True)
        self.assertEqual(is_char_or_noniterable('ab'), False)
        self.assertEqual(is_char_or_noniterable(3), True)
        self.assertEqual(is_char_or_noniterable([3]), False)

    def test_is_str_or_noniterable(self):
        """is_str_or_noniterable should return True or False"""
        self.assertEqual(is_str_or_noniterable('a'), True)
        self.assertEqual(is_str_or_noniterable('ab'), True)
        self.assertEqual(is_str_or_noniterable(3), True)
        self.assertEqual(is_str_or_noniterable([3]), False)

    def test_recursive_flatten(self):
        """recursive_flatten should remove all nesting from nested sequences"""
        self.assertEqual(recursive_flatten([1,[2,3], [[4, [5]]]]), [1,2,3,4,5])

        #test default behavior on str unpacking
        self.assertEqual(recursive_flatten(
            ['aa',[8,'cc','dd'], ['ee',['ff','gg']]]),
            ['a', 'a', 8, 'c', 'c', 'd', 'd', 'e', 'e', 'f', 'f', 'g', 'g'])

        #test str untouched flattening using is_leaf=is_str_or_noniterable
        self.assertEqual(recursive_flatten(
            ['aa',[8,'cc','dd'], ['ee',['ff','gg']]],
            is_leaf=is_str_or_noniterable),
            ['aa',8,'cc','dd','ee','ff','gg'])
            
    def test_create_dir(self):
        """create_dir creates dir and fails meaningful."""

        tmp_dir_path = get_random_directory_name()
        tmp_dir_path2 = get_random_directory_name(suppress_mkdir=True)
        tmp_dir_path3 = get_random_directory_name(suppress_mkdir=True)

        self.dirs_to_remove.append(tmp_dir_path)
        self.dirs_to_remove.append(tmp_dir_path2)
        self.dirs_to_remove.append(tmp_dir_path3)

        # create on existing dir raises OSError if fail_on_exist=True
        self.assertRaises(OSError, create_dir, tmp_dir_path,
                          fail_on_exist=True)
        self.assertEquals(create_dir(tmp_dir_path,
                                     fail_on_exist=True,
                                     handle_errors_externally=True), 1)

        # return should be 1 if dir exist and fail_on_exist=False 
        self.assertEqual(create_dir(tmp_dir_path, fail_on_exist=False), 1)

        # if dir not there make it and return always 0
        self.assertEqual(create_dir(tmp_dir_path2), 0)
        self.assertEqual(create_dir(tmp_dir_path3, fail_on_exist=True), 0)

    def test_handle_error_codes(self):
        """handle_error_codes raises the right error."""

        self.assertRaises(OSError, handle_error_codes, "test", False,1)
        self.assertEqual(handle_error_codes("test", True, 1), 1)
        self.assertEqual(handle_error_codes("test", False, 0), 0)
        self.assertEqual(handle_error_codes("test"), 0)

    def test_not_list_tuple(self):
        """not_list_tuple(obj) should return False when obj is list or tuple"""
        self.assertEqual(not_list_tuple([8,3]), False)
        self.assertEqual(not_list_tuple((8,3)), False)
        self.assertEqual(not_list_tuple('34'), True)

    def test_list_flatten(self):
        """list_flatten should remove all nesting, str is untouched """
        self.assertEqual(list_flatten(
            ['aa',[8,'cc','dd'], ['ee',['ff','gg']]], ),
            ['aa',8,'cc','dd','ee','ff','gg'])

    def test_recursive_flatten_max_depth(self):
        """recursive_flatten should not remover more than max_depth levels"""
        self.assertEqual(recursive_flatten([1,[2,3], [[4, [5]]]]), [1,2,3,4,5])
        self.assertEqual(recursive_flatten([1,[2,3], [[4, [5]]]], 0), \
            [1,[2,3], [[4, [5]]]])
        self.assertEqual(recursive_flatten([1,[2,3], [[4, [5]]]], 1), \
            [1,2,3, [4, [5]]])
        self.assertEqual(recursive_flatten([1,[2,3], [[4, [5]]]], 2), \
            [1,2,3,4, [5]])
        self.assertEqual(recursive_flatten([1,[2,3], [[4, [5]]]], 3), \
            [1,2,3,4,5])
        self.assertEqual(recursive_flatten([1,[2,3], [[4, [5]]]], 5000), \
            [1,2,3,4,5])

    def test_unflatten(self):
       """unflatten should turn a 1D sequence into a 2D list"""
       self.assertEqual(unflatten("abcdef", 1), list("abcdef"))
       self.assertEqual(unflatten("abcdef", 1, True), list("abcdef"))
       self.assertEqual(unflatten("abcdef", 2), ['ab','cd','ef'])
       self.assertEqual(unflatten("abcdef", 3), ['abc','def'])
       self.assertEqual(unflatten("abcdef", 4), ['abcd'])
       #should be able to preserve extra items
       self.assertEqual(unflatten("abcdef", 4, True), ['abcd', 'ef'])
       self.assertEqual(unflatten("abcdef", 10), [])
       self.assertEqual(unflatten("abcdef", 10, True), ['abcdef'])
       #should succeed on empty sequnce
       self.assertEqual(unflatten('',10), [])

    def test_unflatten_bad_row_width(self):
        "unflatten should raise ValueError with row_width < 1"""
        self.assertRaises(ValueError, unflatten, "abcd", 0)
        self.assertRaises(ValueError, unflatten, "abcd", -1)

    def test_unzip(self):
        """unzip(items) should be the inverse of zip(*items)"""
        chars = [list('abcde'), list('ghijk')]
        numbers = [[1,2,3,4,5], [0,0,0,0,0]]
        strings = [["abcde", "fghij", "klmno"], ['xxxxx'] * 3]
        empty = [[]]

        lists = [chars, numbers, strings]
        zipped = [zip(*i) for i in lists]
        unzipped = [unzip(i) for i in zipped]

        for u, l in zip(unzipped, lists):
            self.assertEqual(u, l)

    def test_select_sequence(self):
        """select should work on a sequence with a list of indices"""
        chars = 'abcdefghij'
        strings = list(chars)

        tests = {   (0,):['a'],
                    (-1,):['j'],
                    (0, 2, 4): ['a', 'c', 'e'],
                    (9,8,7,6,5,4,3,2,1,0):list('jihgfedcba'),
                    (-8, 8): ['c', 'i'],
                    ():[],
                }
        for test, result in tests.items():
            self.assertEqual(select(test, chars), result)
            self.assertEqual(select(test, strings), result)

    def test_select_empty(self):
        """select should raise error if indexing into empty sequence"""
        self.assertRaises(IndexError, select, [1], [])

    def test_select_mapping(self):
        """select should return the values corresponding to a list of keys"""
        values = {'a':5, 'b':2, 'c':4, 'd':6, 'e':7}
        self.assertEqual(select('abc', values), [5,2,4])
        self.assertEqual(select(['e','e','e'], values), [7,7,7])
        self.assertEqual(select(('e', 'b', 'a'), values), [7, 2, 5])
        #check that it raises KeyError on anything out of range
        self.assertRaises(KeyError, select, 'abx', values)

    def test_sort_order(self):
        """sort_order should return the ordered indices of items"""
        self.assertEqual(sort_order('abc'), [0, 1, 2])
        self.assertEqual(sort_order('cba'), [2,1,0])
        self.assertEqual(sort_order('bca'), [2,0,1])

    def test_sort_order_cmpfunc(self):
        """sort_order should use cmpfunc if passed"""
        self.assertEqual(sort_order([4, 8, 10], lambda x,y:cmp(y,x)), [2, 1, 0])

    def test_sort_order_empty(self):
        """sort_order should return empty list on empty sequence"""
        self.assertEqual(sort_order([]), [])

    def test_find_all(self):
        """find_all should return list of all occurrences"""
        self.assertEqual(find_all('abc', 'd'), [])
        self.assertEqual(find_all('abc', 'a'), [0])
        self.assertEqual(find_all('abcabca', 'a'), [0,3,6])
        self.assertEqual(find_all('abcabca', 'c'), [2,5])
        self.assertEqual(find_all('abcabca', '3'), [])
        self.assertEqual(find_all('abcabca', 'bc'), [1,4])
        self.assertRaises(TypeError, find_all,'abcabca', 3)

    def test_find_many(self):
        """find_many should return list of all occurrences of all items"""
        #should be same as find_all for single chars
        self.assertEqual(find_many('abc', 'd'), [])
        self.assertEqual(find_many('abc', 'a'), [0])
        self.assertEqual(find_many('abcabca', 'a'), [0,3,6])
        self.assertEqual(find_many('abcabca', 'c'), [2,5])
        self.assertEqual(find_many('abcabca', '3'), [])
        #should sort together the items from the two lists
        self.assertEqual(find_many('abcabca', 'bc'), [1,2,4,5])
        #note difference between 2-char string and 1-string list
        self.assertEqual(find_many('abcabca', ['bc']), [1,4])
        self.assertRaises(TypeError, find_many,'abcabca', [3])
 

    def test_unreserve(self):
        """unreserve should trim trailing underscore if present."""
        for i in (None, [], ['x'], 'xyz', '', 'a', '__abc'):
            self.assertEqual(unreserve(i), i)
        self.assertEqual(unreserve('_'), '')
        self.assertEqual(unreserve('class_'), 'class')

    def test_extract_delimited_bad_delimiters(self):
        """extract_delimited should raise error if delimiters identical"""
        self.assertRaises(TypeError, extract_delimited, '|acb|acx', '|','|')

    def test_extract_delimited_missing_right(self):
        """extract_delimited should raise error if right delimiter missing"""
        self.assertRaises(ValueError, extract_delimited, 'ac[acgsd', '[', ']')

    def test_extract_delimited_normal(self):
        """extract_delimited should return correct field if present, or None"""
        self.assertEqual(extract_delimited('[]', '[', ']'), '')
        self.assertEqual(extract_delimited('asdsad', '[', ']'), None)
        self.assertEqual(extract_delimited('ac[abc]ac', '[', ']'), 'abc')
        self.assertEqual(extract_delimited('[xyz]asd', '[', ']'), 'xyz')
        self.assertEqual(extract_delimited('acg[xyz]', '[', ']'), 'xyz')
        self.assertEqual(extract_delimited('abcdef', 'a', 'e'), 'bcd')

    def test_extract_delimited_indexed(self):
        """extract_delimited should return correct field with starting index"""
        self.assertEqual(extract_delimited('[abc][def]', '[',']', 0), 'abc')
        self.assertEqual(extract_delimited('[abc][def]','[',']',1), 'def')
        self.assertEqual(extract_delimited('[abc][def]', '[',']',5), 'def')

    def test_caps_from_underscores(self):
        """caps_from_underscores should become CapsFromUnderscores"""
        cfu = caps_from_underscores
        #should still convert strings without underscores
        self.assertEqual(cfu('ABCDE  abcde!$'), 'Abcde  Abcde!$')
        self.assertEqual(cfu('abc_def'), 'AbcDef')
        #should read through multiple underscores
        self.assertEqual(cfu('_caps__from_underscores___'), 
            'CapsFromUnderscores')

    def test_add_lowercase(self):
        """add_lowercase should add lowercase version of each key w/ same val"""
        d = {'a':1, 'b':'test', 'A':5, 'C':123, 'D':[], 'AbC':'XyZ', \
            None:'3', '$':'abc', 145:'5'}
        add_lowercase(d)
        assert d['d'] is d['D']
        d['D'].append(3)
        self.assertEqual(d['D'], [3])
        self.assertEqual(d['d'], [3])
        self.assertNotEqual(d['a'], d['A'])
        self.assertEqual(d, {'a':1, 'b':'test', 'A':5, 'C':123, 'c':123, \
            'D':[3], 'd':[3], 'AbC':'XyZ', 'abc':'xyz', None:'3', '$':'abc', \
            145:'5'})

        #should work with strings
        d = 'ABC'
        self.assertEqual(add_lowercase(d), 'ABCabc')
        #should work with tuples
        d = tuple('ABC')
        self.assertEqual(add_lowercase(d), tuple('ABCabc'))
        #should work with lists
        d = list('ABC')
        self.assertEqual(add_lowercase(d), list('ABCabc'))
        #should work with sets
        d = set('ABC')
        self.assertEqual(add_lowercase(d), set('ABCabc'))
        #...even frozensets
        d = frozenset('ABC')
        self.assertEqual(add_lowercase(d), frozenset('ABCabc'))

    def test_add_lowercase_tuple(self):
        """add_lowercase should deal with tuples correctly"""
        d = {('A','B'):'C', ('D','e'):'F', ('b','c'):'H'}
        add_lowercase(d)
        self.assertEqual(d, {
            ('A','B'):'C',
            ('a','b'):'c',
            ('D','e'):'F',
            ('d','e'):'f',
            ('b','c'):'H',
            })

    def test_InverseDict(self):
        """InverseDict should invert dict's keys and values"""
        self.assertEqual(InverseDict({}), {})
        self.assertEqual(InverseDict({'3':4}), {4:'3'})
        self.assertEqual(InverseDict({'a':'x','b':1,'c':None,'d':('a','b')}), \
            {'x':'a',1:'b',None:'c',('a','b'):'d'})
        self.assertRaises(TypeError, InverseDict, {'a':['a','b','c']})
        d = InverseDict({'a':3, 'b':3, 'c':3})
        self.assertEqual(len(d), 1)
        assert 3 in d
        assert d[3] in 'abc'
        
    def test_InverseDictMulti(self):
        """InverseDictMulti should invert keys and values, keeping all keys"""
        self.assertEqual(InverseDictMulti({}), {})
        self.assertEqual(InverseDictMulti({'3':4}), {4:['3']})
        self.assertEqual(InverseDictMulti(\
            {'a':'x','b':1,'c':None,'d':('a','b')}), \
            {'x':['a'],1:['b'],None:['c'],('a','b'):['d']})
        self.assertRaises(TypeError, InverseDictMulti, {'a':['a','b','c']})
        d = InverseDictMulti({'a':3, 'b':3, 'c':3, 'd':'3', 'e':'3'})
        self.assertEqual(len(d), 2)
        assert 3 in d
        d3_items = d[3][:]
        self.assertEqual(len(d3_items), 3)
        d3_items.sort()
        self.assertEqual(''.join(d3_items), 'abc')
        assert '3' in d
        d3_items = d['3'][:]
        self.assertEqual(len(d3_items), 2)
        d3_items.sort()
        self.assertEqual(''.join(d3_items), 'de') 

    def test_DictFromPos(self):
        """DictFromPos should return correct lists of positions"""
        d = DictFromPos
        self.assertEqual(d(''), {})
        self.assertEqual(d('a'), {'a':[0]})
        self.assertEqual(d(['a','a','a']), {'a':[0,1,2]})
        self.assertEqual(d('abacdeeee'), {'a':[0,2],'b':[1],'c':[3],'d':[4], \
            'e':[5,6,7,8]})
        self.assertEqual(d(('abc',None, 'xyz', None, 3)), {'abc':[0],None:[1,3],
            'xyz':[2], 3:[4]})

    def test_DictFromFirst(self):
        """DictFromFirst should return correct first positions"""
        d = DictFromFirst
        self.assertEqual(d(''), {})
        self.assertEqual(d('a'), {'a':0})
        self.assertEqual(d(['a','a','a']), {'a':0})
        self.assertEqual(d('abacdeeee'), {'a':0,'b':1,'c':3,'d':4,'e':5})
        self.assertEqual(d(('abc',None, 'xyz', None, 3)), {'abc':0,None:1,
            'xyz':2, 3:4})

    def test_DictFromLast(self):
        """DictFromLast should return correct last positions"""
        d = DictFromLast
        self.assertEqual(d(''), {})
        self.assertEqual(d('a'), {'a':0})
        self.assertEqual(d(['a','a','a']), {'a':2})
        self.assertEqual(d('abacdeeee'), {'a':2,'b':1,'c':3,'d':4,'e':8})
        self.assertEqual(d(('abc',None, 'xyz', None, 3)), {'abc':0,None:3,
            'xyz':2, 3:4})

    def test_DistanceFromMatrix(self):
        """DistanceFromMatrix should return correct elements"""
        m = {'a':{'3':4, 6:1}, 'b':{'3':5,'6':2}}
        d = DistanceFromMatrix(m)
        self.assertEqual(d('a','3'), 4)
        self.assertEqual(d('a',6), 1)
        self.assertEqual(d('b','3'), 5)
        self.assertEqual(d('b','6'), 2)
        self.assertRaises(KeyError, d, 'c', 1)
        self.assertRaises(KeyError, d, 'b', 3)

    def test_PairsFromGroups(self):
        """PairsFromGroups should return dict with correct pairs"""
        empty = []
        self.assertEqual(PairsFromGroups(empty), {})
        one = ['abc']
        self.assertEqual(PairsFromGroups(one), dict.fromkeys([ \
            ('a','a'), ('a','b'), ('a','c'), \
            ('b','a'), ('b','b'), ('b','c'), \
            ('c','a'), ('c','b'), ('c','c'), \
            ]))

        two = ['xy', 'abc']
        self.assertEqual(PairsFromGroups(two), dict.fromkeys([ \
            ('a','a'), ('a','b'), ('a','c'), \
            ('b','a'), ('b','b'), ('b','c'), \
            ('c','a'), ('c','b'), ('c','c'), \
            ('x','x'), ('x','y'), ('y','x'), ('y','y'), \
            ]))
        #if there's overlap, note that the groups should _not_ be expanded
        #(e.g. in the following case, 'x' is _not_ similar to 'c', even though
        #both 'x' and 'c' are similar to 'a'.
        overlap = ['ax', 'abc']
        self.assertEqual(PairsFromGroups(overlap), dict.fromkeys([ \
            ('a','a'), ('a','b'), ('a','c'), \
            ('b','a'), ('b','b'), ('b','c'), \
            ('c','a'), ('c','b'), ('c','c'), \
            ('x','x'), ('x','a'), ('a','x'), \
            ]))
            
    def test_remove_files(self):
        """Remove files functions as expected """
        # create list of temp file paths
        test_filepaths = \
         [get_tmp_filename(prefix='remove_files_test') for i in range(5)]
        
        # try to remove them with remove_files and verify that an IOError is 
        # raises
        self.assertRaises(OSError,remove_files,test_filepaths)
        # now get no error when error_on_missing=False
        remove_files(test_filepaths,error_on_missing=False)
        
        # touch one of the filepaths so it exists
        open(test_filepaths[2],'w').close()
        # check that an error is raised on trying to remove the files...
        self.assertRaises(OSError,remove_files,test_filepaths)
        # ... but that the existing file was still removed
        self.assertFalse(exists(test_filepaths[2]))
        
        # touch one of the filepaths so it exists
        open(test_filepaths[2],'w').close()
        # no error is raised on trying to remove the files 
        # (although 4 don't exist)...
        remove_files(test_filepaths,error_on_missing=False)
        # ... and the existing file was removed
        self.assertFalse(exists(test_filepaths[2]))
        
    def test_get_random_directory_name(self):
        """get_random_directory_name functions as expected """
        # repeated calls yield different directory names
        dirs = []
        for i in range(100):
            d = get_random_directory_name(suppress_mkdir=True)
            self.assertTrue(d not in dirs)
            dirs.append(d)
            
        actual = get_random_directory_name(suppress_mkdir=True)
        self.assertFalse(exists(actual),'Random dir exists: %s' % actual)
        self.assertTrue(actual.startswith('/'),\
         'Random dir is not a full path: %s' % actual)
        
        # prefix, suffix and output_dir are used as expected
        actual = get_random_directory_name(suppress_mkdir=True,prefix='blah',\
            output_dir='/tmp/',suffix='stuff')
        self.assertTrue(actual.startswith('/tmp/blah2'),\
         'Random dir does not begin with output_dir + prefix '+\
         '+ 2 (where 2 indicates the millenium in the timestamp): %s' % actual)
        self.assertTrue(actual.endswith('stuff'),\
         'Random dir does not end with suffix: %s' % actual)
        
        # changing rand_length functions as expected
        actual1 = get_random_directory_name(suppress_mkdir=True)
        actual2 = get_random_directory_name(suppress_mkdir=True,\
            rand_length=10)
        actual3 = get_random_directory_name(suppress_mkdir=True,\
            rand_length=0)
        self.assertTrue(len(actual1) > len(actual2) > len(actual3),\
         "rand_length does not affect directory name lengths "+\
         "as expected:\n%s\n%s\n%s" % (actual1,actual2,actual3))
         
        # changing the timestamp pattern functions as expected
        actual1 = get_random_directory_name(suppress_mkdir=True)
        actual2 = get_random_directory_name(suppress_mkdir=True,\
            timestamp_pattern='%Y')
        self.assertNotEqual(actual1,actual2)
        self.assertTrue(len(actual1)>len(actual2),\
            'Changing timestamp_pattern does not affect directory name')
        # empty string as timestamp works
        actual3 = get_random_directory_name(suppress_mkdir=True,\
            timestamp_pattern='')
        self.assertTrue(len(actual2) > len(actual3))
         
        # creating the directory works as expected 
        actual = get_random_directory_name(output_dir='/tmp/',\
         prefix='get_random_directory_test')
        self.assertTrue(exists(actual))
        rmdir(actual)
    
    def test_independent_spans(self):
        """get_independent_coords returns truly non-overlapping (decorated) spans"""
        # single span is returned
        data = [(0, 20, 'a')]
        got = get_independent_coords(data)
        self.assertEqual(got, data)
        
        # multiple non-overlapping
        data = [(20, 30, 'a'), (35, 40, 'b'), (65, 75, 'c')]
        got = get_independent_coords(data)
        self.assertEqual(got, data)
        
        # over-lapping first/second returns first occurrence by default
        data = [(20, 30, 'a'), (25, 40, 'b'), (65, 75, 'c')]
        got = get_independent_coords(data)
        self.assertEqual(got, [(20, 30, 'a'), (65, 75, 'c')])
        # but randomly the first or second if random_tie_breaker is chosen
        got = get_independent_coords(data, random_tie_breaker=True)
        self.assertTrue(got in ([(20, 30, 'a'), (65, 75, 'c')],
                        [(25, 40, 'b'), (65, 75, 'c')]))
        
        # over-lapping second/last returns first occurrence by default
        data = [(20, 30, 'a'), (30, 60, 'b'), (50, 75, 'c')]
        got = get_independent_coords(data)
        self.assertEqual(got, [(20, 30, 'a'), (30, 60, 'b')])
        # but randomly the first or second if random_tie_breaker is chosen
        got = get_independent_coords(data, random_tie_breaker=True)
        self.assertTrue(got in ([(20, 30, 'a'), (50, 75, 'c')],
                                [(20, 30, 'a'), (30, 60, 'b')]))
        
        # over-lapping middle returns first occurrence by default
        data = [(20, 24, 'a'), (25, 40, 'b'), (30, 35, 'c'), (65, 75, 'd')]
        got = get_independent_coords(data)
        self.assertEqual(got, [(20, 24, 'a'), (25, 40, 'b'), (65, 75, 'd')])
        
        # but randomly the first or second if random_tie_breaker is chosen
        got = get_independent_coords(data, random_tie_breaker=True)
        self.assertTrue(got in ([(20, 24, 'a'), (25, 40, 'b'), (65, 75, 'd')],
                                [(20, 24, 'a'), (30, 35, 'c'), (65, 75, 'd')]))
    
    def test_get_merged_spans(self):
        """tests merger of overlapping spans"""
        sample = [[0, 10], [12, 15], [13, 16], [18, 25], [19, 20]]
        result = get_merged_overlapping_coords(sample)
        expect = [[0, 10], [12, 16], [18, 25]]
        self.assertEqual(result, expect)
        sample = [[0, 10], [5, 9], [12, 16], [18, 20], [19, 25]]
        result = get_merged_overlapping_coords(sample)
        expect = [[0, 10], [12, 16], [18, 25]]
        self.assertEqual(result, expect)
    
    def test_get_run_start_indices(self):
        """return indices corresponding to start of a run of identical values"""
        #       0  1  2  3  4  5  6  7
        data = [1, 2, 3, 3, 3, 4, 4, 5]
        expect = [[0, 1], [1, 2], [2, 3], [5, 4], [7, 5]]
        got = get_run_start_indices(data)
        self.assertEqual(list(got), expect)
        
        # raise an exception if try and provide a converter and num digits
        def wrap_gen(): # need to wrap generator so we can actually test this
            gen = get_run_start_indices(data, digits=1,
                converter_func=lambda x: x)
            def call():
                for v in gen:
                    pass
            return call
        
        self.assertRaises(AssertionError, wrap_gen())
    
    def test_merged_by_value_spans(self):
        """correctly merge adjacent spans with the same value"""
        # initial values same
        data = [[20, 21, 0], [21, 22, 0], [22, 23, 1], [23, 24, 0]]
        self.assertEqual(get_merged_by_value_coords(data),
                [[20, 22, 0], [22, 23, 1], [23, 24, 0]])
        
        # middle values same
        data = [[20, 21, 0], [21, 22, 1], [22, 23, 1], [23, 24, 0]]
        self.assertEqual(get_merged_by_value_coords(data),
                [[20, 21, 0], [21, 23, 1], [23, 24, 0]])
        
        # last values same
        data = [[20, 21, 0], [21, 22, 1], [22, 23, 0], [23, 24, 0]]
        self.assertEqual(get_merged_by_value_coords(data),
                [[20, 21, 0], [21, 22, 1], [22, 24, 0]])
        
        # all unique values
        data = [[20, 21, 0], [21, 22, 1], [22, 23, 2], [23, 24, 0]]
        self.assertEqual(get_merged_by_value_coords(data),
                [[20, 21, 0], [21, 22, 1], [22, 23, 2], [23, 24, 0]])
        
        # all values same
        data = [[20, 21, 0], [21, 22, 0], [22, 23, 0], [23, 24, 0]]
        self.assertEqual(get_merged_by_value_coords(data),
                [[20, 24, 0]])
        
        # all unique values to 2nd decimal
        data = [[20, 21, 0.11], [21, 22, 0.12], [22, 23, 0.13], [23, 24, 0.14]]
        self.assertEqual(get_merged_by_value_coords(data),
                [[20, 21, 0.11], [21, 22, 0.12], [22, 23, 0.13], [23, 24, 0.14]])
        
        # all values same at 1st decimal
        data = [[20, 21, 0.11], [21, 22, 0.12], [22, 23, 0.13], [23, 24, 0.14]]
        self.assertEqual(get_merged_by_value_coords(data, digits=1),
                [[20, 24, 0.1]])
        


class _my_dict(dict):
    """Used for testing subclass behavior of ClassChecker"""
    pass

class ClassCheckerTests(TestCase):
    """Unit tests for the ClassChecker class."""

    def setUp(self):
        """define a few standard checkers"""
        self.strcheck = ClassChecker(str)
        self.intcheck = ClassChecker(int, long)
        self.numcheck = ClassChecker(float, int, long)
        self.emptycheck = ClassChecker()
        self.dictcheck = ClassChecker(dict)
        self.mydictcheck = ClassChecker(_my_dict)
        
    def test_init_good(self):
        """ClassChecker should init OK when initialized with classes"""
        self.assertEqual(self.strcheck.Classes, [str])
        self.assertEqual(self.numcheck.Classes, [float, int, long])
        self.assertEqual(self.emptycheck.Classes, [])

    def test_init_bad(self):
        """ClassChecker should raise TypeError if initialized with non-class"""
        self.assertRaises(TypeError, ClassChecker, 'x')
        self.assertRaises(TypeError, ClassChecker, str, None)

    def test_contains(self):
        """ClassChecker should return True only if given instance of class"""
        self.assertEqual(self.strcheck.__contains__('3'), True)
        self.assertEqual(self.strcheck.__contains__('ahsdahisad'), True)
        self.assertEqual(self.strcheck.__contains__(3), False)
        self.assertEqual(self.strcheck.__contains__({3:'c'}), False)

        self.assertEqual(self.intcheck.__contains__('ahsdahisad'), False)
        self.assertEqual(self.intcheck.__contains__('3'), False)
        self.assertEqual(self.intcheck.__contains__(3.0), False)
        self.assertEqual(self.intcheck.__contains__(3), True)
        self.assertEqual(self.intcheck.__contains__(4**60), True)
        self.assertEqual(self.intcheck.__contains__(4**60 * -1), True)

        d = _my_dict()
        self.assertEqual(self.dictcheck.__contains__(d), True)
        self.assertEqual(self.dictcheck.__contains__({'d':1}), True)
        self.assertEqual(self.mydictcheck.__contains__(d), True)
        self.assertEqual(self.mydictcheck.__contains__({'d':1}), False)

        self.assertEqual(self.emptycheck.__contains__('d'), False)

        self.assertEqual(self.numcheck.__contains__(3), True)
        self.assertEqual(self.numcheck.__contains__(3.0), True)
        self.assertEqual(self.numcheck.__contains__(-3), True)
        self.assertEqual(self.numcheck.__contains__(-3.0), True)
        self.assertEqual(self.numcheck.__contains__(3e-300), True)
        self.assertEqual(self.numcheck.__contains__(0), True)
        self.assertEqual(self.numcheck.__contains__(4**1000), True)
        self.assertEqual(self.numcheck.__contains__('4**1000'), False)

    def test_str(self):
        """ClassChecker str should be the same as str(self.Classes)"""
        for c in [self.strcheck, self.intcheck, self.numcheck, self.emptycheck,
            self.dictcheck, self.mydictcheck]:
            self.assertEqual(str(c), str(c.Classes))

    def test_copy(self):
        """copy.copy should work correctly on ClassChecker"""
        c = copy(self.strcheck)
        assert c is not self.strcheck
        assert '3' in c
        assert 3 not in c
        assert c.Classes is self.strcheck.Classes

    def test_deepcopy(self):
        """copy.deepcopy should work correctly on ClassChecker"""
        c = deepcopy(self.strcheck)
        assert c is not self.strcheck
        assert '3' in c
        assert 3 not in c
        assert c.Classes is not self.strcheck.Classes

class modifiable_string(str):
    """Mutable class to allow arbitrary attributes to be set"""
    pass

class _list_and_string(list, Delegator):
    """Trivial class to demonstrate Delegator.
    """
    def __init__(self, items, string):
        Delegator.__init__(self, string)
        self.NormalAttribute = 'default'
        self._x = None
        self._constant = 'c'
        for i in items:
            self.append(i)

    def _get_rand_property(self):
        return self._x

    def _set_rand_property(self, value):
        self._x = value
    prop = property(_get_rand_property, _set_rand_property)

    def _get_constant_property(self):
        return self._constant
    constant = property(_get_constant_property)

class DelegatorTests(TestCase):
    """Verify that Delegator works with attributes and properties."""

    def test_init(self):
        """Delegator should init OK when data supplied"""
        ls = _list_and_string([1,2,3], 'abc')
        self.assertRaises(TypeError, _list_and_string, [123])
        
    def test_getattr(self):
        """Delegator should find attributes in correct places"""
        ls = _list_and_string([1,2,3], 'abcd')
        #behavior as list
        self.assertEqual(len(ls), 3)
        self.assertEqual(ls[0], 1)
        ls.reverse()
        self.assertEqual(ls, [3,2,1])
        #behavior as string
        self.assertEqual(ls.upper(), 'ABCD')
        self.assertEqual(len(ls.upper()), 4)
        self.assertEqual(ls.replace('a', 'x'), 'xbcd')
        #behavior of normal attributes
        self.assertEqual(ls.NormalAttribute, 'default')
        #behavior of properties
        self.assertEqual(ls.prop, None)
        self.assertEqual(ls.constant, 'c')
        #shouldn't be allowed to get unknown properties
        self.assertRaises(AttributeError, getattr, ls, 'xyz')
        #if the unknown property can be set in the forwarder, do it there
        flex = modifiable_string('abcd')
        ls_flex = _list_and_string([1,2,3], flex)
        ls_flex.blah = 'zxc'
        self.assertEqual(ls_flex.blah, 'zxc')
        self.assertEqual(flex.blah, 'zxc')
        #should get AttributeError if changing a read-only property
        self.assertRaises(AttributeError, setattr, ls, 'constant', 'xyz')
        
    
    def test_setattr(self):
        """Delegator should set attributes in correct places"""
        ls = _list_and_string([1,2,3], 'abcd')
        #ability to create a new attribute
        ls.xyz = 3
        self.assertEqual(ls.xyz, 3)
        #modify a normal attribute
        ls.NormalAttribute = 'changed'
        self.assertEqual(ls.NormalAttribute, 'changed')
        #modify a read/write property
        ls.prop = 'xyz'
        self.assertEqual(ls.prop, 'xyz')

    def test_copy(self):
        """copy.copy should work correctly on Delegator"""
        l = ['a']
        d = Delegator(l)
        c = copy(d)
        assert c is not d
        assert c._handler is d._handler

    def test_deepcopy(self):
        """copy.deepcopy should work correctly on Delegator"""
        l = ['a']
        d = Delegator(l)
        c = deepcopy(d)
        assert c is not d
        assert c._handler is not d._handler
        assert c._handler == d._handler

        

class FunctionWrapperTests(TestCase):
    """Tests of the FunctionWrapper class"""
    def test_init(self):
        """FunctionWrapper should initialize with any callable"""
        f = FunctionWrapper(str)
        g = FunctionWrapper(id)
        h = FunctionWrapper(iterable)
        x = 3
        self.assertEqual(f(x), '3')
        self.assertEqual(g(x), id(x))
        self.assertEqual(h(x), [3])

    def test_copy(self):
        """copy should work for FunctionWrapper objects"""
        f = FunctionWrapper(str)
        c = copy(f)
        assert c is not f
        assert c.Function is f.Function

    #NOTE: deepcopy does not work for FunctionWrapper objects because you
    #can't copy a function.


class _simple_container(object):
    """example of a container to constrain"""
    def __init__(self, data):
        self._data = list(data)
    def __getitem__(self, item):
        return self._data.__getitem__(item)

class _constrained_simple_container(_simple_container, ConstrainedContainer):
    """constrained version of _simple_container"""
    def __init__(self, data):
        _simple_container.__init__(self, data)
        ConstrainedContainer.__init__(self, None)

class ConstrainedContainerTests(TestCase):
    """Tests of the generic ConstrainedContainer interface."""
    def setUp(self):
        """Make a couple of standard containers"""
        self.alphabet = _constrained_simple_container('abc')
        self.numbers = _constrained_simple_container([1,2,3])
        self.alphacontainer = 'abcdef'
        self.numbercontainer = ClassChecker(int)
        
    def test_matchesConstraint(self):
        """ConstrainedContainer matchesConstraint should return true if items ok"""
        self.assertEqual(self.alphabet.matchesConstraint(self.alphacontainer), \
            True)
        self.assertEqual(self.alphabet.matchesConstraint(self.numbercontainer),\
            False)
        self.assertEqual(self.numbers.matchesConstraint(self.alphacontainer), \
            False)
        self.assertEqual(self.numbers.matchesConstraint(self.numbercontainer),\
            True)

    def test_otherIsValid(self):
        """ConstrainedContainer should use constraint for checking other"""
        self.assertEqual(self.alphabet.otherIsValid('12d8jc'), True)
        self.alphabet.Constraint = self.alphacontainer
        self.assertEqual(self.alphabet.otherIsValid('12d8jc'), False)
        self.alphabet.Constraint = list('abcdefghijkl12345678')
        self.assertEqual(self.alphabet.otherIsValid('12d8jc'), True)
        self.assertEqual(self.alphabet.otherIsValid('z'), False)

    def test_itemIsValid(self):
        """ConstrainedContainer should use constraint for checking item"""
        self.assertEqual(self.alphabet.itemIsValid(3), True)
        self.alphabet.Constraint = self.alphacontainer
        self.assertEqual(self.alphabet.itemIsValid(3), False)
        self.assertEqual(self.alphabet.itemIsValid('a'), True)

    def test_sequenceIsValid(self):
        """ConstrainedContainer should use constraint for checking sequence"""
        self.assertEqual(self.alphabet.sequenceIsValid('12d8jc'), True)
        self.alphabet.Constraint = self.alphacontainer
        self.assertEqual(self.alphabet.sequenceIsValid('12d8jc'), False)
        self.alphabet.Constraint = list('abcdefghijkl12345678')
        self.assertEqual(self.alphabet.sequenceIsValid('12d8jc'), True)
        self.assertEqual(self.alphabet.sequenceIsValid('z'), False)

    def test_Constraint(self):
        """ConstrainedContainer should only allow valid constraints to be set"""
        try:
            self.alphabet.Constraint = self.numbers
        except ConstraintError:
            pass
        else:
            raise AssertionError, \
            "Failed to raise ConstraintError with invalid constraint."
        self.alphabet.Constraint = 'abcdefghi'
        self.alphabet.Constraint = ['a','b', 'c', 1, 2, 3]
        self.numbers.Constraint = range(20)
        self.numbers.Constraint = xrange(20)
        self.numbers.Constraint = [5,1,3,7,2]
        self.numbers.Constraint = {1:'a',2:'b',3:'c'}
        self.assertRaises(ConstraintError, setattr, self.numbers, \
            'Constraint', '1')
            
class ConstrainedStringTests(TestCase):
    """Tests that ConstrainedString can only contain allowed items."""
    
    def test_init_good_data(self):
        """ConstrainedString should init OK if string matches constraint"""
        self.assertEqual(ConstrainedString('abc', 'abcd'), 'abc')
        self.assertEqual(ConstrainedString('', 'abcd'), '')
        items = [1,2,3.2234, (['a'], ['b'],), 'xyz']
        #should accept anything str() does if no constraint is passed
        self.assertEqual(ConstrainedString(items), str(items))
        self.assertEqual(ConstrainedString(items, None), str(items))
        self.assertEqual(ConstrainedString('12345'), str(12345))
        self.assertEqual(ConstrainedString(12345, '1234567890'), str(12345))
        #check that list is formatted correctly and chars are all there
        test_list = [1,2,3,4,5]
        self.assertEqual(ConstrainedString(test_list, '][, 12345'), str(test_list))

    def test_init_bad_data(self):
        """ConstrainedString should fail init if unknown chars in string"""
        self.assertRaises(ConstraintError, ConstrainedString, 1234, '123')
        self.assertRaises(ConstraintError, ConstrainedString, '1234', '123')
        self.assertRaises(ConstraintError, ConstrainedString, [1,2,3], '123')

    def test_add_prevents_bad_data(self):
        """ConstrainedString should allow addition only of compliant string"""
        a = ConstrainedString('123', '12345')
        b = ConstrainedString('444', '4')
        c = ConstrainedString('45', '12345')
        d = ConstrainedString('x')
        self.assertEqual(a + b, '123444')
        self.assertEqual(a + c, '12345')
        self.assertRaises(ConstraintError, b.__add__, c)
        self.assertRaises(ConstraintError, c.__add__, d)
        #should be OK if constraint removed
        b.Constraint = None
        self.assertEqual(b + c, '44445')
        self.assertEqual(b + d, '444x')
        #should fail if we add the constraint back
        b.Constraint = '4x'
        self.assertEqual(b + d, '444x')
        self.assertRaises(ConstraintError, b.__add__, c)
        #check that added strings retain constraint
        self.assertRaises(ConstraintError, (a+b).__add__, d)
   
    def test_mul(self):
        """ConstrainedString mul amd rmul should retain constraint"""
        a = ConstrainedString('123', '12345')
        b = 3*a
        c = b*2
        self.assertEqual(b, '123123123')
        self.assertEqual(c, '123123123123123123')
        self.assertRaises(ConstraintError, b.__add__, 'x')
        self.assertRaises(ConstraintError, c.__add__, 'x')
   
    def test_getslice(self):
        """ConstrainedString getslice should remember constraint"""
        a = ConstrainedString('123333', '12345')
        b = a[2:4]
        self.assertEqual(b, '33')
        self.assertEqual(b.Constraint, '12345')

    def test_getitem(self):
        """ConstrainedString getitem should handle slice objects"""
        a = ConstrainedString('7890543', '1234567890')
        self.assertEqual(a[0], '7')
        self.assertEqual(a[1], '8')
        self.assertEqual(a[-1], '3')
        self.assertRaises(AttributeError, getattr, a[1], 'Alphabet')
        self.assertEqual(a[1:6:2], '804')
        self.assertEqual(a[1:6:2].Constraint, '1234567890')

    def test_init_masks(self):
        """ConstrainedString should init OK with masks"""
        def mask(x):
            return str(int(x) + 3)
        a = ConstrainedString('12333', '45678', mask)
        self.assertEqual(a, '45666')
        assert 'x' not in a
        self.assertRaises(TypeError, a.__contains__, 1)

class MappedStringTests(TestCase):
    """MappedString should behave like ConstrainedString, but should map items."""
    def test_init_masks(self):
        """MappedString should init OK with masks"""
        def mask(x):
            return str(int(x) + 3)
        a = MappedString('12333', '45678', mask)
        self.assertEqual(a, '45666')
        assert 1 in a
        assert 'x' not in a

    

class ConstrainedListTests(TestCase):
    """Tests that bad data can't sneak into ConstrainedLists."""
    def test_init_good_data(self):
        """ConstrainedList should init OK if list matches constraint"""
        self.assertEqual(ConstrainedList('abc', 'abcd'), list('abc'))
        self.assertEqual(ConstrainedList('', 'abcd'), list(''))
        items = [1,2,3.2234, (['a'], ['b'],), list('xyz')]
        #should accept anything str() does if no constraint is passed
        self.assertEqual(ConstrainedList(items), items)
        self.assertEqual(ConstrainedList(items, None), items)
        self.assertEqual(ConstrainedList('12345'), list('12345'))
        #check that list is formatted correctly and chars are all there
        test_list = list('12345')
        self.assertEqual(ConstrainedList(test_list, '12345'), test_list)

    def test_init_bad_data(self):
        """ConstrainedList should fail init with items not in constraint"""
        self.assertRaises(ConstraintError, ConstrainedList, '1234', '123')
        self.assertRaises(ConstraintError,ConstrainedList,[1,2,3],['1','2','3'])

    def test_add_prevents_bad_data(self):
        """ConstrainedList should allow addition only of compliant data"""
        a = ConstrainedList('123', '12345')
        b = ConstrainedList('444', '4')
        c = ConstrainedList('45', '12345')
        d = ConstrainedList('x')
        self.assertEqual(a + b, list('123444'))
        self.assertEqual(a + c, list('12345'))
        self.assertRaises(ConstraintError, b.__add__, c)
        self.assertRaises(ConstraintError, c.__add__, d)
        #should be OK if constraint removed
        b.Constraint = None
        self.assertEqual(b + c, list('44445'))
        self.assertEqual(b + d, list('444x'))
        #should fail if we add the constraint back
        b.Constraint = {'4':1, 5:2}
        self.assertRaises(ConstraintError, b.__add__, c)
                
    
    def test_iadd_prevents_bad_data(self):
        """ConstrainedList should allow in-place addition only of compliant data"""
        a = ConstrainedList('12', '123')
        a += '2'
        self.assertEqual(a, list('122'))
        self.assertEqual(a.Constraint, '123')
        self.assertRaises(ConstraintError, a.__iadd__, '4')
    
    def test_imul(self):
        """ConstrainedList imul should preserve constraint"""
        a = ConstrainedList('12', '123')
        a *= 3
        self.assertEqual(a, list('121212'))
        self.assertEqual(a.Constraint, '123')

    def test_mul(self):
        """ConstrainedList mul should preserve constraint"""
        a = ConstrainedList('12', '123')
        b = a * 3
        self.assertEqual(b, list('121212'))
        self.assertEqual(b.Constraint, '123')

    def test_rmul(self):
        """ConstrainedList rmul should preserve constraint"""
        a = ConstrainedList('12', '123')
        b = 3 * a
        self.assertEqual(b, list('121212'))
        self.assertEqual(b.Constraint, '123')

    def test_setitem(self):
        """ConstrainedList setitem should work only if item in constraint"""
        a = ConstrainedList('12', '123')
        a[0] = '3'
        self.assertEqual(a, list('32'))
        self.assertRaises(ConstraintError, a.__setitem__, 0, 3)
        a = ConstrainedList('1'*20, '123')
        self.assertRaises(ConstraintError, a.__setitem__, slice(0,1,1), [3])
        self.assertRaises(ConstraintError, a.__setitem__, slice(0,1,1), ['111'])
        a[2:9:2] = '3333'
        self.assertEqual(a, list('11313131311111111111'))

    def test_append(self):
        """ConstrainedList append should work only if item in constraint"""
        a = ConstrainedList('12', '123')
        a.append('3')
        self.assertEqual(a, list('123'))
        self.assertRaises(ConstraintError, a.append, 3)

    def test_extend(self):
        """ConstrainedList extend should work only if all items in constraint"""
        a = ConstrainedList('12', '123')
        a.extend('321')
        self.assertEqual(a, list('12321'))
        self.assertRaises(ConstraintError, a.extend, ['1','2', 3])

    def test_insert(self):
        """ConstrainedList insert should work only if item in constraint"""
        a = ConstrainedList('12', '123')
        a.insert(0, '2')
        self.assertEqual(a, list('212'))
        self.assertRaises(ConstraintError, a.insert, 0, [2])

    def test_getslice(self):
        """ConstrainedList getslice should remember constraint"""
        a = ConstrainedList('123333', '12345')
        b = a[2:4]
        self.assertEqual(b, list('33'))
        self.assertEqual(b.Constraint, '12345')

    def test_setslice(self):
        """ConstrainedList setslice should fail if slice has invalid chars"""
        a = ConstrainedList('123333', '12345')
        a[2:4] = ['2','2']
        self.assertEqual(a, list('122233'))
        self.assertRaises(ConstraintError, a.__setslice__, 2,4, [2,2])
        a[:] = []
        self.assertEqual(a, [])
        self.assertEqual(a.Constraint, '12345')

    def test_setitem_masks(self):
        """ConstrainedList setitem with masks should transform input"""
        a = ConstrainedList('12333', range(5), lambda x: int(x) + 1)
        self.assertEqual(a, [2,3,4,4,4])
        self.assertRaises(ConstraintError, a.append, 4)
        b = a[1:3]
        assert b.Mask is a.Mask
        assert '1' not in a
        assert '2' not in a
        assert 2 in a
        assert 'x' not in a

class MappedListTests(TestCase):
    """MappedList should behave like ConstrainedList, but map items."""
    def test_setitem_masks(self):
        """MappedList setitem with masks should transform input"""
        a = MappedList('12333', range(5), lambda x: int(x) + 1)
        self.assertEqual(a, [2,3,4,4,4])
        self.assertRaises(ConstraintError, a.append, 4)
        b = a[1:3]
        assert b.Mask is a.Mask
        assert '1' in a
        assert 'x' not in a

class ConstrainedDictTests(TestCase):
    """Tests that bad data can't sneak into ConstrainedDicts."""
    def test_init_good_data(self):
        """ConstrainedDict should init OK if list matches constraint"""
        self.assertEqual(ConstrainedDict(dict.fromkeys('abc'), 'abcd'), \
            dict.fromkeys('abc'))
        self.assertEqual(ConstrainedDict('', 'abcd'), dict(''))
        items = [1,2,3.2234, tuple('xyz')]
        #should accept anything dict() does if no constraint is passed
        self.assertEqual(ConstrainedDict(dict.fromkeys(items)), \
            dict.fromkeys(items))
        self.assertEqual(ConstrainedDict(dict.fromkeys(items), None), \
            dict.fromkeys(items))
        self.assertEqual(ConstrainedDict([(x,1) for x in '12345']), \
            dict.fromkeys('12345', 1))
        #check that list is formatted correctly and chars are all there
        test_dict = dict.fromkeys('12345')
        self.assertEqual(ConstrainedDict(test_dict, '12345'), test_dict)

    def test_init_sequence(self):
        """ConstrainedDict should init from sequence, unlike normal dict"""
        self.assertEqual(ConstrainedDict('abcda'), {'a':2,'b':1,'c':1,'d':1})

    def test_init_bad_data(self):
        """ConstrainedDict should fail init with items not in constraint"""
        self.assertRaises(ConstraintError, ConstrainedDict, \
            dict.fromkeys('1234'), '123')
        self.assertRaises(ConstraintError,ConstrainedDict, \
        dict.fromkeys([1,2,3]),['1','2','3'])
   
    def test_setitem(self):
        """ConstrainedDict setitem should work only if key in constraint"""
        a = ConstrainedDict(dict.fromkeys('12'), '123')
        a['1'] = '3'
        self.assertEqual(a, {'1':'3','2':None})
        self.assertRaises(ConstraintError, a.__setitem__, 1, '3')

    def test_copy(self):
        """ConstrainedDict copy should retain constraint"""
        a = ConstrainedDict(dict.fromkeys('12'), '123')
        b = a.copy()
        self.assertEqual(a.Constraint, b.Constraint)
        self.assertRaises(ConstraintError, a.__setitem__, 1, '3')
        self.assertRaises(ConstraintError, b.__setitem__, 1, '3')

    def test_fromkeys(self):
        """ConstrainedDict instance fromkeys should retain constraint"""
        a = ConstrainedDict(dict.fromkeys('12'), '123')
        b = a.fromkeys('23')
        self.assertEqual(a.Constraint, b.Constraint)
        self.assertRaises(ConstraintError, a.__setitem__, 1, '3')
        self.assertRaises(ConstraintError, b.__setitem__, 1, '3')
        b['2'] = 5
        self.assertEqual(b, {'2':5, '3':None})

    def test_setdefault(self):
        """ConstrainedDict setdefault shouldn't allow bad keys"""
        a = ConstrainedDict({'1':None, '2': 'xyz'}, '123')
        self.assertEqual(a.setdefault('2', None), 'xyz')
        self.assertEqual(a.setdefault('1', None), None)
        self.assertRaises(ConstraintError, a.setdefault, 'x', 3)
        a.setdefault('3', 12345)
        self.assertEqual(a, {'1':None, '2':'xyz', '3': 12345})

    def test_update(self):
        """ConstrainedDict should allow update only of compliant data"""
        a = ConstrainedDict(dict.fromkeys('123'), '12345')
        b = ConstrainedDict(dict.fromkeys('444'), '4')
        c = ConstrainedDict(dict.fromkeys('45'), '12345')
        d = ConstrainedDict([['x','y']])
        a.update(b)
        self.assertEqual(a, dict.fromkeys('1234'))
        a.update(c)
        self.assertEqual(a, dict.fromkeys('12345'))
        self.assertRaises(ConstraintError, b.update, c)
        self.assertRaises(ConstraintError, c.update, d)
        #should be OK if constraint removed
        b.Constraint = None
        b.update(c)
        self.assertEqual(b, dict.fromkeys('45'))
        b.update(d)
        self.assertEqual(b, {'4':None, '5':None, 'x':'y'})
        #should fail if we add the constraint back
        b.Constraint = {'4':1, 5:2, '5':1, 'x':1}
        self.assertRaises(ConstraintError, b.update, {4:1})
        b.update({5:1})
        self.assertEqual(b, {'4':None, '5':None, 'x':'y', 5:1})
   
    def test_setitem_masks(self):
        """ConstrainedDict setitem should work only if key in constraint"""
        key_mask = str
        val_mask = lambda x: int(x) + 3
        d = ConstrainedDict({1:4, 2:6}, '123', key_mask, val_mask)
        d[1] = '456'
        self.assertEqual(d, {'1':459,'2':9,})
        d['1'] = 234
        self.assertEqual(d, {'1':237,'2':9,})
        self.assertRaises(ConstraintError, d.__setitem__, 4, '3')
        e = d.copy()
        assert e.Mask is d.Mask
        assert '1' in d
        assert not 1 in d

class MappedDictTests(TestCase):
    """MappedDict should work like ConstrainedDict, but map keys."""
    
    def test_setitem_masks(self):
        """MappedDict setitem should work only if key in constraint"""
        key_mask = str
        val_mask = lambda x: int(x) + 3
        d = MappedDict({1:4, 2:6}, '123', key_mask, val_mask)
        d[1] = '456'
        self.assertEqual(d, {'1':459,'2':9,})
        d['1'] = 234
        self.assertEqual(d, {'1':237,'2':9,})
        self.assertRaises(ConstraintError, d.__setitem__, 4, '3')
        e = d.copy()
        assert e.Mask is d.Mask
        assert '1' in d
        assert 1 in d
        assert 1 not in d.keys()
        assert 'x' not in d.keys()

    def test_getitem(self):
        """MappedDict getitem should automatically map key."""
        key_mask = str
        d = MappedDict({}, '123', key_mask)
        self.assertEqual(d, {})
        d['1'] = 5
        self.assertEqual(d, {'1':5})
        self.assertEqual(d[1], 5)

    def test_get(self):
        """MappedDict get should automatically map key."""
        key_mask = str
        d = MappedDict({}, '123', key_mask)
        self.assertEqual(d, {})
        d['1'] = 5
        self.assertEqual(d, {'1':5})
        self.assertEqual(d.get(1, 'x'), 5)
        self.assertEqual(d.get(5, 'x'), 'x')

    def test_has_key(self):
        """MappedDict has_key should automatically map key."""
        key_mask = str
        d = MappedDict({}, '123', key_mask)
        self.assertEqual(d, {})
        d['1'] = 5
        assert d.has_key('1')
        assert d.has_key(1)
        assert not d.has_key('5')

        


class generateCombinationsTests(TestCase):
    """Tests for public generateCombinations function."""
    
    def test_generateCombinations(self):
        """function should return all combinations of given length"""
        
        #test all 3-position combinations of a 2-digit alphabet, since I can
        #work that one out by hand ...
        correct_result = [  "AAA", "AAB", "ABA", "ABB", \
                            "BBB", "BBA", "BAB", "BAA"]
                            
        real_result = generateCombinations("AB", 3)
        
        correct_result.sort()
        real_result.sort()
        self.assertEquals(str(real_result), str(correct_result))
    #end test_generateCombinations
    
    def test_generateCombinations_singleAlphabet(self):
        """function should return correct value when alphabet is one char"""
        
        real_result = generateCombinations("A", 4)
        self.assertEquals(str(real_result), str(["AAAA"]))
    #end test_generateCombinations_singleAlphabet
    
    def test_generateCombinations_singleLength(self):
        """function should return correct values if length is 1"""
        
        real_result = generateCombinations("ABC", 1)
        self.assertEquals(str(real_result), str(["A", "B", "C"]))
    #end test_generateCombinations_singleLength
    
    def test_generateCombinations_emptyAlphabet(self):
        """function should return empty list if alphabet arg is [], "" """
        
        real_result = generateCombinations("", 4)
        self.assertEquals(str(real_result), str([]))
        
        real_result = generateCombinations([], 4)
        self.assertEquals(str(real_result), str([]))
    #end test_generateCombinations_emptyAlphabet
    
    def test_generateCombinations_zeroLength(self):
        """function should return empty list if length arg is 0 """
        
        real_result = generateCombinations("ABC", 0)
        self.assertEquals(str(real_result), str([]))
    #end test_generateCombinations_zeroLength
    
    def test_generateCombinations_badArgs(self):
        """function should error if args are not castable to right type."""
    
        self.assertRaises(RuntimeError, generateCombinations, 12, 4)
        self.assertRaises(RuntimeError, generateCombinations, [], None) 
    #end test_generateCombinations_badArgs
#end generateCombinationsTests

class makeNonnegIntTests(TestCase):
    """Tests of the public makeNonnegInt function"""
    
    def test_makeNonnegInt_unchanged(self):
        """Should return an input nonneg int unchanged"""
        
        self.assertEquals(makeNonnegInt(3), 3)
    #end test_makeNonnegInt_unchanged
    
    def test_makeNonnegInt_castable(self):
        """Should return nonneg int version of a castable input"""
        
        self.assertEquals(makeNonnegInt(-4.2), 4)
    #end test_makeNonnegInt_castable
    
    def test_makeNonnegInt_noncastable(self):
        """Should raise a special NonnegIntError if input isn't castable"""
        
        self.assertRaises(NonnegIntError, makeNonnegInt, "blue")
    #end test_makeNonnegInt_noncastable
#end makeNonnegIntTests

class reverse_complementTests(TestCase):
    """Tests of the public reverse_complement function"""
    
    def test_reverse_complement_DNA(self):
        """reverse_complement should correctly return reverse complement of DNA"""
        
        #input and correct output taken from example at 
        #http://bioweb.uwlax.edu/GenWeb/Molecular/Seq_Anal/
        #Reverse_Comp/reverse_comp.html
        user_input = "ATGCAGGGGAAACATGATTCAGGAC"
        correct_output = "GTCCTGAATCATGTTTCCCCTGCAT"
        real_output = reverse_complement(user_input)
        self.assertEquals(real_output, correct_output)
        
        # revComp is a pointer to reverse_complement (for backward 
        # compatibility)
        real_output = revComp(user_input)
        self.assertEquals(real_output, correct_output)
    #end test_reverse_complement_DNA
    
    def test_reverse_complement_RNA(self):
        """reverse_complement should correctly return reverse complement of RNA"""
        
        #input and correct output taken from test_reverse_complement_DNA test,
        #with all Ts changed to Us
        user_input = "AUGCAGGGGAAACAUGAUUCAGGAC"
        correct_output = "GUCCUGAAUCAUGUUUCCCCUGCAU"
        
        #remember to use False toggle to get RNA instead of DNA
        real_output = reverse_complement(user_input, False)
        self.assertEquals(real_output, correct_output)        
    #end test_reverse_complement_RNA
    
    def test_reverse_complement_caseSensitive(self):
        """reverse_complement should convert bases without changing case"""
        
        user_input = "aCGtAcgT"
        correct_output = "AcgTaCGt"
        real_output = reverse_complement(user_input)
        self.assertEquals(real_output, correct_output) 
    #end test_reverse_complement_caseSensitive
    
    def test_reverse_complement_nonNucleicSeq(self):
        """reverse_complement should just reverse any chars but ACGT/U"""
        
        user_input = "BDeF"
        self.assertRaises(ValueError,reverse_complement,user_input)
    #end test_reverse_complement_nonNucleicSeq
    
    def test_reverse_complement_emptySeq(self):
        """reverse_complement should return empty string if given empty sequence"""
        
        #shouldn't matter whether in DNA or RNA mode
        real_output = reverse_complement("")
        self.assertEquals(real_output, "") 
    #end test_reverse_complement_emptySeq
    
    def test_reverse_complement_noSeq(self):
        """reverse_complement should return error if given no sequence argument"""
        
        self.assertRaises(TypeError, reverse_complement)
    #end test_reverse_complement_noSeq
#end reverse_complementTests

    def test_not_none(self):
        """not_none should return True if none of the items is None"""
        assert not_none([1,2,3,4])
        assert not not_none([1,2,3,None])
        self.assertEqual(filter(not_none,[(1,2),(3,None)]),[(1,2)])
    #end test_not_none

    def test_get_items_except(self):
        """get_items_except should return all items of seq not in indices"""
        self.assertEqual(get_items_except('a-b-c-d',[1,3,5]),'abcd')
        self.assertEqual(get_items_except([0,1,2,3,4,5,6],[1,3,5]),[0,2,4,6])
        self.assertEqual(get_items_except((0,1,2,3,4,5,6),[1,3,5]),(0,2,4,6))
        self.assertEqual(get_items_except('a-b-c-d',[1,3,5],tuple),
            ('a','b','c','d'))
    #end test_get_items_except    
    
    def test_NestedSplitter(self):
        """NestedSplitter should make a function which return expected list"""
        #test delimiters, constructor, filter_
        line='ii=0; oo= 9, 6 5;  ; xx=  8;  '
        cmds = [
            "NestedSplitter(';=,')(line)",
            "NestedSplitter([';', '=', ','])(line)",
            "NestedSplitter([(';'), '=', ','], constructor=None)(line)",
            "NestedSplitter([(';'), '=', ','], filter_=None)(line)",
            "NestedSplitter([(';',1), '=', ','])(line)",
            "NestedSplitter([(';',-1), '=', ','])(line)"
        ]
        results=[    
            [['ii', '0'], ['oo', ['9', '6 5']], '', ['xx', '8'], ''],
            [['ii', '0'], ['oo', ['9', '6 5']], '', ['xx', '8'], ''],
            [['ii', '0'], [' oo', [' 9', ' 6 5']], '  ', [' xx', '  8'], '  '],
            [['ii', '0'], ['oo', ['9', '6 5']], ['xx', '8']],
            [['ii', '0'], ['oo', ['9', '6 5;  ; xx'], '8;']],
            [['ii', '0; oo', ['9', '6 5;  ; xx'], '8'], '']
        ]
        for cmd, result in zip(cmds, results):
            self.assertEqual(eval(cmd), result)

        #test uncontinous level of delimiters
        test = 'a; b,c; d,e:f; g:h;' #g:h should get [[g,h]] instead of [g,h]
        self.assertEqual(NestedSplitter(';,:')(test),
                ['a', ['b', 'c'], ['d', ['e', 'f']], [['g', 'h']], ''])

        #test empty
        self.assertEqual(NestedSplitter(';,:')(''), [''])
        self.assertEqual(NestedSplitter(';,:')('  '), [''])
        self.assertEqual(NestedSplitter(';,:', filter_=None)(' ;, :'), [[[]]])

        

    def test_curry(self):
        """curry should generate the function with parameters setted"""
        curry_test = curry(cmp, 5)
        knowns = ((3, 1),
                (9, -1),
                (5, 0))
        for arg2, result in knowns:
            self.assertEqual (curry_test(arg2), result)

    def test_app_path(self):
        """app_path should return correct paths"""
        # self.assertEqual(app_path('ls'), '/usr/bin/ls')
        self.assertEqual(app_path('lsxxyyx'), False)

class CommandLineParserTests(TestCase):
    
    def test_parse_command_line_parameters(self):
        """parse_command_line_parameters returns without error
        
            There is not a lot of detailed testing that can be done here,
            so the basic functionality is tested.
        """
        option_parser, opts, args = parse_command_line_parameters(
          script_description="My script",
          script_usage=[('Print help','%prog -h','')],
          version='1.0',help_on_no_arguments=False,
          command_line_args=[])
        self.assertEqual(len(args),0)
        
        d = {'script_description':"My script",\
             'script_usage':[('Print help','%prog -h','')],\
             'version':'1.0',
             'help_on_no_arguments':False,
             'command_line_args':[]}
        option_parser, opts, args = parse_command_line_parameters(**d)
        self.assertEqual(len(args),0)
        
        # allowing positional arguments functions as expected as does
        # passing a positional argument
        d = {'script_description':"My script",\
             'script_usage':[('Print help','%prog -h','')],\
             'version':'1.0',
             'help_on_no_arguments':False,
             'command_line_args':['hello'],
             'disallow_positional_arguments':False}
        option_parser, opts, args = parse_command_line_parameters(**d)
        self.assertEqual(len(args),1)

#run tests on command-line invocation

if __name__ == '__main__':
    main()