1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241
|
#!/usr/bin/env python
# test_sffinfo.py
import os
import shutil
import tempfile
from cogent.util.unit_test import TestCase, main
from cogent.app.util import ApplicationError
from cogent.app.sffinfo import (
ManyValuedParameter, Sffinfo, sffinfo_from_file)
__author__ = "Kyle Bittinger"
__copyright__ = "Copyright 2007-2016, The Cogent Project"
__credits__ = ["Kyle Bittinger"]
__license__ = "GPL"
__version__ = "1.9"
__maintainer__ = "Kyle Bittinger"
__email__ = "kylebittinger@gmail.com"
__status__ = "Prototype"
class ManyValuedParameterTests(TestCase):
def test_init(self):
"""__init__() should set appropriate class variables."""
p = ManyValuedParameter(None, None)
self.assertEqual(p.Name, None)
self.assertEqual(p.Value, None)
self.assertEqual(p.Delimiter, None)
self.assertEqual(p.Quote, None)
p = ManyValuedParameter('-', 'a', Values=['abc'])
self.assertEqual(p.Value, ['abc'])
def test_append(self):
"""append() should append values to Value class attribute."""
p = ManyValuedParameter(None, None)
p.append('abc')
p.append(3)
self.assertEqual(p.Value, ['abc', 3])
def test_on(self):
"""on() should alias append()."""
p = ManyValuedParameter(None, None)
p.on('abc')
p.on(3)
self.assertEqual(p.Value, ['abc', 3])
def test_str(self):
"""__str__() should produce quoted, delimited string of parameter values."""
p = ManyValuedParameter(None, None)
p.append('abc')
p.append(3)
self.assertEqual(str(p), 'abc3')
p = ManyValuedParameter(None, None, Quote='"', ValueDelimiter=',')
p.append('abc')
p.append(3)
self.assertEqual(str(p), '"abc","3"')
class SffinfoTests(TestCase):
def setUp(self):
test_dir = os.path.dirname(os.path.dirname(os.path.abspath(__file__)))
self.sff_fp = os.path.join(test_dir, 'data', 'test.sff')
def test_base_command(self):
"""BaseCommand should include non-positional parameters."""
s = Sffinfo()
expected = 'cd "%s/"; sffinfo' % os.getcwd()
self.assertEqual(s.BaseCommand, expected)
s.Parameters['-a'].on()
expected = 'cd "%s/"; sffinfo -a' % os.getcwd()
self.assertEqual(s.BaseCommand, expected)
# accession number parameters should not be included in base command
s.Parameters['-a'].off()
s.Parameters['accno'].on('12345ABC')
expected = 'cd "%s/"; sffinfo' % os.getcwd()
self.assertEqual(s.BaseCommand, expected)
def test_changing_working_dir(self):
"""WorkingDir should be created and included in BaseCommand."""
# Directory is not created, only filename is returned
working_dir = tempfile.mktemp()
self.assertRaises(OSError, os.rmdir, working_dir)
a = Sffinfo(WorkingDir=working_dir)
expected = 'cd "%s/"; sffinfo' % working_dir
self.assertEqual(a.BaseCommand, expected)
# Removing the directory is proof that it was created. If the
# directory is not there, an OSError will be raised.
os.rmdir(working_dir)
def test_input_handler(self):
"""Sffinfo should decorate input handler output with accession numbers"""
my_accno = '12345ABC'
a = Sffinfo()
a.Parameters['accno'].on(my_accno)
self.assertEqual(a.InputHandler, '_input_handler_decorator')
observed = getattr(a, a.InputHandler)(self.sff_fp)
expected = '"%s" %s' % (self.sff_fp, my_accno)
self.assertEqual(observed, expected)
def test_call(self):
"""Simple sffinfo call should produce expected output."""
a = Sffinfo()
app_results = a(self.sff_fp)
observed = app_results['StdOut'].read()
self.assertEqual(observed, sffinfo_output)
def test_call_with_accno(self):
"""Sffinfo accession number parameters should filter output."""
# Valid accession number
a = Sffinfo()
a.Parameters['accno'].on('FA6P1OK01CGMHQ')
app_results = a(self.sff_fp)
observed = app_results['StdOut'].read()
self.assertEqual(observed, sffinfo_output)
# Invalid accession number
a = Sffinfo()
a.Parameters['accno'].on('AAAAAAAAAAAAAA')
app_results = a(self.sff_fp)
observed = app_results['StdOut'].read()
self.assertEqual(observed, empty_sffinfo_output)
def test_call_with_flags(self):
"""Sffinfo flags should alter output as expected."""
# -a flag
a = Sffinfo()
a.Parameters['-a'].on()
app_results = a(self.sff_fp)
observed = app_results['StdOut'].read()
self.assertEqual(observed, 'FA6P1OK01CGMHQ\n')
# -s flag
a = Sffinfo()
a.Parameters['-s'].on()
app_results = a(self.sff_fp)
observed = app_results['StdOut'].read()
expected = (
'>FA6P1OK01CGMHQ length=48 xy=0892_1356 region=1 '
'run=R_2008_05_28_17_11_38_\n'
'ATCTGAGCTGGGTCATAGCTGCCTCCGTAGGAGGTGCCTCCCTACGGC\n'
)
self.assertEqual(observed, expected)
# -q flag
a = Sffinfo()
a.Parameters['-q'].on()
app_results = a(self.sff_fp)
observed = app_results['StdOut'].read()
expected = (
'>FA6P1OK01CGMHQ length=48 xy=0892_1356 region=1 '
'run=R_2008_05_28_17_11_38_\n'
'32 32 32 32 32 32 32 25 25 21 21 21 28 32 32 31 30 30 32 32 32 '
'33 31 25 18 18 20 18 32 30 28 23 22 22 24 28 18 19 18 16 16 16 '
'17 18 13 17 27 21\n')
self.assertEqual(observed, expected)
# -f flag
a = Sffinfo()
a.Parameters['-f'].on()
app_results = a(self.sff_fp)
observed = app_results['StdOut'].read()
expected = (
'>FA6P1OK01CGMHQ xy=0892_1356 region=1 run=R_2008_05_28_17_11_38_\n'
'A,1.02 C,0.00 G,0.00 T,0.99 A,0.00 C,1.00 G,0.00 T,1.00 A,0.00 C,0.00\n'
'G,1.00 T,0.00 A,1.10 C,0.00 G,1.08 T,0.00 A,0.00 C,1.46 G,0.00 T,0.88\n'
'A,0.18 C,0.00 G,2.69 T,1.01 A,0.08 C,0.96 G,0.00 T,0.02 A,0.92 C,0.08\n'
'G,0.00 T,0.98 A,0.68 C,0.00 G,0.89 T,0.00 A,0.00 C,1.15 G,0.00 T,1.13\n'
'A,0.00 C,0.02 G,1.12 T,0.05 A,0.15 C,1.84 G,0.00 T,1.10 A,0.00 C,2.47\n'
'G,0.96 T,0.86 A,1.06 C,0.00 G,1.96 T,0.12 A,0.93 C,0.13 G,1.65 T,1.06\n'
'A,0.06 C,0.00 G,0.99 T,0.00 A,0.00 C,1.87 G,0.44 T,1.08 A,0.00 C,3.25\n'
'G,0.09 T,0.97 A,0.50 C,1.00 G,1.72 T,0.07 A,0.00 C,0.92 \n')
self.assertEqual(observed, expected)
class SffinfoFunctionTests(TestCase):
def test_sffinfo_from_file(self):
"""sffinfo_from_file should return file object with sffinfo output."""
test_dir = os.path.dirname(os.path.dirname(os.path.abspath(__file__)))
sff_fp = os.path.join(test_dir, 'data', 'test.sff')
observed = sffinfo_from_file(sff_fp).read()
self.assertEqual(observed, sffinfo_output)
sffinfo_output = '''Common Header:
Magic Number: 0x2E736666
Version: 0001
Index Offset: 1504
Index Length: 706
# of Reads: 1
Header Length: 440
Key Length: 4
# of Flows: 400
Flowgram Code: 1
Flow Chars: TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG
Key Sequence: TCAG
>FA6P1OK01CGMHQ
Run Prefix: R_2008_05_28_17_11_38_
Region #: 1
XY Location: 0892_1356
Run Name: R_2008_05_28_17_11_38_FLX02070135_adminrig_KnightLauber
Analysis Name: /data/2008_05_28/R_2008_05_28_17_11_38_FLX02070135_adminrig_KnightLauber/D_2008_05_28_21_13_06_FLX02070135_KnightLauber_FullAnalysisAmplicons
Full Path: /data/2008_05_28/R_2008_05_28_17_11_38_FLX02070135_adminrig_KnightLauber/D_2008_05_28_21_13_06_FLX02070135_KnightLauber_FullAnalysisAmplicons/../D_2008_05_29_13_52_01_FLX02070135_Knight_Lauber_jones_SignalProcessingAmplicons
Read Header Len: 32
Name Length: 14
# of Bases: 77
Clip Qual Left: 5
Clip Qual Right: 52
Clip Adap Left: 0
Clip Adap Right: 0
Flowgram: 1.04 0.00 1.01 0.00 0.00 0.96 0.00 1.02 0.00 1.02 0.00 0.00 0.99 0.00 1.00 0.00 1.00 0.00 0.00 1.00 0.00 1.10 0.00 1.08 0.00 0.00 1.46 0.00 0.88 0.18 0.00 2.69 1.01 0.08 0.96 0.00 0.02 0.92 0.08 0.00 0.98 0.68 0.00 0.89 0.00 0.00 1.15 0.00 1.13 0.00 0.02 1.12 0.05 0.15 1.84 0.00 1.10 0.00 2.47 0.96 0.86 1.06 0.00 1.96 0.12 0.93 0.13 1.65 1.06 0.06 0.00 0.99 0.00 0.00 1.87 0.44 1.08 0.00 3.25 0.09 0.97 0.50 1.00 1.72 0.07 0.00 0.92 0.58 0.00 0.00 0.59 0.06 0.11 0.09 0.07 0.06 0.16 0.00 0.24 0.03 0.00 0.12 0.06 0.16 0.00 0.18 0.00 0.00 0.14 0.00 0.15 0.00 0.18 0.00 0.03 0.14 0.03 0.13 0.01 0.19 0.00 0.02 0.33 0.05 0.00 0.16 0.10 0.35 0.01 0.21 0.04 0.09 0.18 0.13 0.19 0.00 0.10 0.51 0.26 0.00 0.23 0.19 0.27 0.01 0.29 0.05 0.14 0.17 0.16 0.18 0.27 0.09 0.26 0.10 0.18 0.23 0.15 0.22 0.13 0.37 0.11 0.11 0.26 0.59 0.14 0.06 0.33 0.34 0.26 0.05 0.27 0.44 0.19 0.10 0.35 0.27 0.15 0.34 0.28 0.45 0.14 0.16 0.34 0.27 0.12 0.07 0.25 0.18 0.12 0.04 0.23 0.16 0.12 0.05 0.20 0.16 0.11 0.03 0.21 0.16 0.10 0.02 0.21 0.16 0.12 0.02 0.20 0.15 0.10 0.02 0.23 0.15 0.11 0.02 0.22 0.14 0.09 0.02 0.20 0.13 0.09 0.01 0.19 0.13 0.08 0.02 0.17 0.12 0.08 0.03 0.17 0.09 0.08 0.01 0.14 0.09 0.07 0.01 0.15 0.09 0.06 0.01 0.13 0.08 0.06 0.00 0.13 0.08 0.05 0.02 0.12 0.07 0.05 0.01 0.11 0.07 0.05 0.00 0.10 0.07 0.05 0.01 0.11 0.08 0.04 0.00 0.10 0.06 0.05 0.01 0.09 0.06 0.04 0.01 0.08 0.07 0.05 0.00 0.08 0.06 0.05 0.00 0.09 0.06 0.04 0.00 0.09 0.06 0.04 0.01 0.08 0.06 0.04 0.00 0.09 0.06 0.03 0.00 0.09 0.06 0.02 0.00 0.09 0.06 0.04 0.00 0.08 0.05 0.03 0.00 0.07 0.05 0.02 0.00 0.08 0.04 0.03 0.00 0.07 0.04 0.03 0.00 0.07 0.05 0.02 0.00 0.07 0.05 0.02 0.00 0.06 0.04 0.02 0.00 0.06 0.03 0.03 0.00 0.08 0.02 0.00 0.00 0.07 0.03 0.01 0.00 0.06 0.03 0.02 0.00 0.05 0.03 0.02 0.00 0.05 0.03 0.01 0.00 0.06 0.02 0.00 0.00 0.05 0.01 0.01 0.00 0.04 0.01 0.01 0.00 0.04 0.01 0.01 0.00 0.05 0.01 0.00 0.00 0.04 0.02 0.01 0.00 0.03 0.02 0.01 0.00 0.03 0.01 0.00 0.00 0.03 0.00 0.00 0.00 0.03 0.00 0.00 0.00 0.02 0.00
Flow Indexes: 1 3 6 8 10 13 15 17 20 22 24 27 29 32 32 32 33 35 38 41 42 44 47 49 52 55 55 57 59 59 60 61 62 64 64 66 68 68 69 72 75 75 77 79 79 79 81 82 83 84 84 87 88 91 102 126 130 138 140 145 153 157 161 164 166 171 175 179 183 187 191 195 199 203 211 215 219
Bases: tcagATCTGAGCTGGGTCATAGCTGCCTCCGTAGGAGGTGCCTCCCTACGGCgcnnnannnnngnnnnnnnnnnnnn
Quality Scores: 32 32 32 32 32 32 32 32 32 32 32 25 25 21 21 21 28 32 32 31 30 30 32 32 32 33 31 25 18 18 20 18 32 30 28 23 22 22 24 28 18 19 18 16 16 16 17 18 13 17 27 21 20 21 0 0 0 17 0 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0 0 0
'''
empty_sffinfo_output = '''Common Header:
Magic Number: 0x2E736666
Version: 0001
Index Offset: 1504
Index Length: 706
# of Reads: 1
Header Length: 440
Key Length: 4
# of Flows: 400
Flowgram Code: 1
Flow Chars: TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG
Key Sequence: TCAG
'''
if __name__ == '__main__':
main()
|