1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425
|
import pathlib
from unittest import TestCase, main
from cogent3 import make_aligned_seqs, make_table
from cogent3.app import evo as evo_app
from cogent3.app.data_store_new import DataMember
from cogent3.app.result import (
generic_result,
hypothesis_result,
model_collection_result,
model_result,
tabular_result,
)
from cogent3.util.deserialise import deserialise_object
from cogent3.util.dict_array import DictArray
__author__ = "Gavin Huttley"
__copyright__ = "Copyright 2007-2022, The Cogent Project"
__credits__ = ["Gavin Huttley"]
__license__ = "BSD-3"
__version__ = "2023.2.12a1"
__maintainer__ = "Gavin Huttley"
__email__ = "Gavin.Huttley@anu.edu.au"
__status__ = "Alpha"
class TestGenericResult(TestCase):
def test_deserialised_values(self):
"""correctly deserialises values"""
from cogent3 import DNA
data = {"type": "cogent3.core.moltype.MolType", "moltype": "dna"}
result = generic_result(source="blah.json")
result["key"] = data
result.deserialised_values()
got = result["key"]
self.assertEqual(got, DNA)
# if we have a type value without "cogent3", leaves as is
data = {"type": "core.moltype.MolType", "moltype": "dna"}
result = generic_result(source="blah.json")
result["key"] = data
result.deserialised_values()
got = result["key"]
self.assertEqual(got, data)
# or if no "type" entry, leaves as is
data = {"moltype": "dna"}
result = generic_result(source="blah.json")
result["key"] = data
result.deserialised_values()
got = result["key"]
self.assertEqual(got, data)
def test_repr_str(self):
"""it works"""
data = {"type": "cogent3.core.moltype.MolType", "moltype": "dna"}
result = generic_result(source="blah.json")
result["key"] = data
repr(result)
str(result)
def test_keys(self):
"""it works"""
data = {"type": "cogent3.core.moltype.MolType", "moltype": "dna"}
result = generic_result(source="blah.json")
result["key"] = data
keys = result.keys()
self.assertEqual(keys, ["key"])
def test_invalid_setitem(self):
"""generic_result raise TypeError if trying to set invalid item type for json"""
gr = generic_result("null")
with self.assertRaises(TypeError):
gr["null"] = {0, 23}
def test_infers_source(self):
"""flexible handling of data source"""
# works for string
source = pathlib.Path("path/blah.fasta")
aln = make_aligned_seqs(
{"A": "ACGT"}, info=dict(source=str(source), random_key=1234)
)
gr = generic_result(aln)
self.assertEqual(gr.source, source.name)
# or Path
aln.info.source = source
gr = generic_result(aln)
self.assertEqual(str(gr.source), source.name)
# or DataMember
aln.info.source = DataMember(data_store=None, unique_id=source.name)
gr = generic_result(aln)
self.assertEqual(str(gr.source), source.name)
aln.info = {}
with self.assertRaises(ValueError):
generic_result(aln)
class TestModelResult(TestCase):
def test_repr(self):
"""does not fail"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
show_progress=False,
opt_args=dict(max_evaluations=1, limit_action="ignore"),
)
result = mod(aln)
self.assertIsInstance(repr(result), str)
# no values set
self.assertIsInstance(repr(model_result(source="blah")), str)
def test_model_result_alignment(self):
"""returns alignment from lf"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
show_progress=False,
opt_args=dict(max_evaluations=5, limit_action="ignore"),
)
result = mod(aln)
got = result.alignment
self.assertEqual(got.to_dict(), _data)
def test_model_name_lf_name(self):
"""model_result.name is set as lf.name"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
name="blah",
show_progress=False,
opt_args=dict(max_evaluations=5, limit_action="ignore"),
)
result = mod(aln)
self.assertEqual(result.name, result.lf.name)
def test_model_result_alignment_split_pos_model(self):
"""returns alignment from lf with split codon positions"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
split_codons=True,
show_progress=False,
opt_args=dict(max_evaluations=5, limit_action="ignore"),
)
result = mod(aln)
for i in range(1, 4):
got = result.alignment[i]
expect = aln[i - 1 :: 3]
self.assertEqual(got.to_dict(), expect.to_dict())
def test_model_result_repr_split_pos_model(self):
"""repr works for model_result of split codon positions"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
split_codons=True,
show_progress=False,
opt_args=dict(max_evaluations=55, limit_action="ignore"),
)
result = mod(aln)
repr(result)
def test_model_result_tree_split_pos_model(self):
"""returns tree from lf with split codon positions"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
split_codons=True,
show_progress=False,
opt_args=dict(max_evaluations=55, limit_action="ignore"),
)
result = mod(aln)
self.assertTrue(len(result.tree), 3)
# check the trees are different by summing lengths
lengths = {t.total_length() for _, t in result.tree.items()}
self.assertTrue(len(lengths) > 1)
def test_model_result_simulate_alignment(self):
"""returns tree from lf with split codon positions"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
mod = evo_app.model(
"F81",
split_codons=True,
show_progress=False,
opt_args=dict(max_evaluations=55, limit_action="ignore"),
)
result = mod(aln)
got = result.simulate_alignment()
self.assertEqual(len(aln), len(got))
self.assertNotEqual(aln.to_dict(), got.to_dict())
def test_model_result_tree_discrete_time(self):
"""returns paralinear lengths"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
model1 = evo_app.model(
"BH", opt_args=dict(max_evaluations=25, limit_action="ignore")
)
result = model1(aln)
got = result.tree
self.assertEqual(
got.children[0].params["length"], got.children[0].params["paralinear"]
)
def test_model_result_setitem(self):
"""TypeError if value a likelihood function, or a dict with correct type"""
v = dict(type="arbitrary")
r = model_result(name="one", source="two")
with self.assertRaises(TypeError):
r["name"] = v
with self.assertRaises(TypeError):
r["name"] = 4
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
with self.assertRaises(TypeError):
r["name"] = aln
def test_repr_str(self):
"""it works even when no values"""
mr = model_result(source="blah")
self.assertIsInstance(repr(mr), str)
def test_model_result_invalid_setitem(self):
"""model_result raise TypeError if trying to set incorrect item type"""
mr = model_result(source="blah")
with self.assertRaises(TypeError):
mr["null"] = 23
class TestModelCollectionResult(TestCase):
_model_results = {}
def setUp(self):
"""constructs _model_results if they don't already exist"""
if self._model_results:
return
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
model1 = evo_app.model(
"F81", opt_args=dict(max_evaluations=25, limit_action="ignore")
)
model2 = evo_app.model(
"HKY85", opt_args=dict(max_evaluations=25, limit_action="ignore")
)
model3 = evo_app.model(
"GTR", opt_args=dict(max_evaluations=25, limit_action="ignore")
)
mr1 = model1(aln)
mr2 = model2(aln)
mr3 = model3(aln)
self._model_results[mr1.name] = mr1
self._model_results[mr2.name] = mr2
self._model_results[mr3.name] = mr3
def test_get_best_model(self):
"""should correctly identify the best model"""
coll = model_collection_result(source="blah")
coll.update(self._model_results)
got = coll.get_best_model()
# we ensure a model_result instance is returned from the possible set
self.assertIn(got, self._model_results.values())
def test_select_model(self):
"""correctly select models"""
# we ensure a series of model_result instances is returned
coll = model_collection_result(source="blah")
coll.update(self._model_results)
got = coll.select_models()
self.assertTrue(len(got) > 0)
possible = list(self._model_results.values())
for m in got:
self.assertIn(m, possible)
def test_model_collection_result_repr(self):
"""constructed result can do the different repr"""
result = model_collection_result(source="blah")
coll = model_collection_result(source="blah")
coll.update(self._model_results)
got = result.__repr__()
self.assertIsInstance(got, str)
got = result._repr_html_()
self.assertIsInstance(got, str)
def test_json_roundtrip(self):
"""roundtrip from json correct"""
coll = model_collection_result(name="blah", source="blah2")
coll.update(self._model_results)
self.assertEqual(coll.name, "blah")
self.assertEqual(coll.source, "blah2")
orig = coll.__repr__()
got = deserialise_object(coll.to_json())
self.assertEqual(got.__repr__(), orig)
self.assertIsInstance(got, model_collection_result)
self.assertEqual(got.name, coll.name)
self.assertEqual(got.source, coll.source)
# select_models() should not fail
got = deserialise_object(coll.to_json())
m = got.select_models()
self.assertIsInstance(m[0], model_result)
def test_to_hypothesis(self):
"""creates a hypothesis_result from two model results"""
mr = model_collection_result(source="blah")
mr.update(self._model_results)
hyp = mr.get_hypothesis_result("F81", "HKY85")
self.assertIsInstance(hyp, hypothesis_result)
self.assertEqual(hyp.null.name, "F81")
def test_repr_str(self):
"""it works even when no values"""
mr = model_collection_result(source="blah")
self.assertIsInstance(repr(mr), str)
def test_model_collection_result_invalid_setitem(self):
"""model_collection_result raise TypeError if trying to set incorrect item type"""
mcr = model_collection_result(source="blah")
with self.assertRaises(TypeError):
mcr["null"] = 23
class TestHypothesisResult(TestCase):
def test_repr_str(self):
"""it works even when no values"""
hr = hypothesis_result(name_of_null="null", source="blah")
self.assertIsInstance(repr(hr), str)
def test_pvalue(self):
"""hypothesis test p-value property"""
_data = {
"Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
"Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
"Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
}
aln = make_aligned_seqs(data=_data, moltype="dna")
model1 = evo_app.model(
"F81", opt_args=dict(max_evaluations=25, limit_action="ignore")
)
model2 = evo_app.model(
"HKY85", opt_args=dict(max_evaluations=25, limit_action="ignore")
)
hyp = evo_app.hypothesis(model1, model2)
result = hyp(aln)
self.assertTrue(0 <= result.pvalue <= 1)
def test_invalid_setitem(self):
"""hypothesis_result raise TypeError if trying to set incorrect item type"""
hr = hypothesis_result(name_of_null="null", source="blah")
with self.assertRaises(TypeError):
hr["null"] = {0, 23}
class TestTabularResult(TestCase):
def test_valid_setitem(self):
"""tabular_result works when set correct item type"""
tr = tabular_result("null")
tr["result"] = make_table(data={"A": [0, 1]})
darr = DictArray({"A": [0, 1]})
tr["result2"] = darr
js = tr.to_json()
self.assertIsInstance(js, str)
def test_invalid_setitem(self):
"""tabular_result raise TypeError if trying to set incorrect item type"""
tr = tabular_result("null")
with self.assertRaises(TypeError):
tr["null"] = {0, 23}
if __name__ == "__main__":
main()
|