1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246
|
#!/usr/bin/env python
import unittest
from cogent3 import DNA, make_aligned_seqs
from cogent3.core.annotation import Feature, _Feature
from cogent3.core.location import Map, Span, as_map
from cogent3.core.sequence import DnaSequence, RnaSequence
__author__ = "Gavin Huttley"
__copyright__ = "Copyright 2007-2022, The Cogent Project"
__credits__ = ["Gavin Huttley"]
__license__ = "BSD-3"
__version__ = "2023.2.12a1"
__maintainer__ = "Gavin Huttley"
__email__ = "gavin.huttley@anu.edu.au"
__status__ = "Production"
def makeSampleSequence(with_gaps=False):
raw_seq = "AACCCAAAATTTTTTGGGGGGGGGGCCCC"
cds = (15, 25)
utr = (12, 15)
if with_gaps:
raw_seq = raw_seq[:5] + "-----" + raw_seq[10:-2] + "--"
seq = DNA.make_seq(raw_seq)
seq.add_annotation(Feature, "CDS", "CDS", [cds])
seq.add_annotation(Feature, "5'UTR", "5' UTR", [utr])
return seq
def makeSampleAlignment():
seq1 = makeSampleSequence()
seq2 = makeSampleSequence(with_gaps=True)
seqs = {"FAKE01": seq1, "FAKE02": seq2}
aln = make_aligned_seqs(data=seqs, array_align=False)
aln.add_annotation(Feature, "misc_feature", "misc", [(12, 25)])
aln.add_annotation(Feature, "CDS", "blue", [(15, 25)])
aln.add_annotation(Feature, "5'UTR", "red", [(2, 4)])
aln.add_annotation(Feature, "LTR", "fake", [(2, 15)])
return aln
class TestAnnotations(unittest.TestCase):
def setUp(self):
self.seq = makeSampleSequence()
self.aln = makeSampleAlignment()
def test_inherit_feature(self):
"""should be able to subclass and extend _Feature"""
class NewFeat(_Feature):
def __init__(self, *args, **kwargs):
super(NewFeat, self).__init__(*args, **kwargs)
def newMethod(self):
if len(self.map.spans) > 1:
as_one = self.as_one_span() # should create new instance of NewFeat
return as_one.newMethod()
return True
seq = DNA.make_seq("ACGTACGTACGT")
f = seq.add_annotation(
NewFeat, as_map([(1, 3), (5, 7)], len(seq)), type="gene", name="abcd"
)
self.assertEqual(type(f.as_one_span()), NewFeat)
self.assertEqual(type(f.get_shadow()), NewFeat)
f2 = seq.add_annotation(
NewFeat, as_map([(3, 5)], len(seq)), type="gene", name="def"
)
self.assertEqual(
type(seq.get_region_covering_all([f, f2], feature_class=NewFeat)), NewFeat
)
# now use the new method
f.newMethod()
def test_slice_seq_with_annotations(self):
newseq = self.seq[:5] + self.seq[10:]
for annot_type in ["CDS", "5'UTR"]:
orig = str(list(self.seq.get_by_annotation(annot_type))[0])
new = str(list(newseq.get_by_annotation(annot_type))[0])
assert orig == new, (annot_type, orig, new)
def test_aln_annotations(self):
"""test that annotations to alignment and its' sequences"""
aln_expecteds = {
"misc_feature": {"FAKE01": "TTTGGGGGGGGGG", "FAKE02": "TTTGGGGGGGGGG"},
"CDS": {"FAKE01": "GGGGGGGGGG", "FAKE02": "GGGGGGGGGG"},
"5'UTR": {"FAKE01": "CC", "FAKE02": "CC"},
"LTR": {"FAKE01": "CCCAAAATTTTTT", "FAKE02": "CCC-----TTTTT"},
}
seq_expecteds = {
"CDS": {"FAKE01": "GGGGGGGGGG", "FAKE02": "GGGGGGGGGG"},
"5'UTR": {"FAKE01": "TTT", "FAKE02": "TTT"},
}
for annot_type in ["misc_feature", "CDS", "5'UTR", "LTR"]:
observed = list(self.aln.get_by_annotation(annot_type))[0].to_dict()
expected = aln_expecteds[annot_type]
assert observed == expected, (annot_type, expected, observed)
if annot_type in ["misc_feature", "LTR"]:
continue # because seqs haven't been annotated with it
for name in self.aln.names:
observed = list(
self.aln.named_seqs[name].data.get_by_annotation(annot_type)
)[0]
observed = str(observed)
expected = seq_expecteds[annot_type][name]
assert str(observed) == expected, (annot_type, name, expected, observed)
def test_slice_aln_with_annotations(self):
"""test that annotations of sequences and alignments survive alignment
slicing."""
aln_expecteds = {
"misc_feature": {"FAKE01": "TTTGGGGGGGGGG", "FAKE02": "TTTGGGGGGGGGG"},
"CDS": {"FAKE01": "GGGGGGGGGG", "FAKE02": "GGGGGGGGGG"},
"5'UTR": {"FAKE01": "CC", "FAKE02": "CC"},
"LTR": {"FAKE01": "CCCTTTTT", "FAKE02": "CCCTTTTT"},
}
newaln = self.aln[:5] + self.aln[10:]
feature_list = newaln.get_annotations_matching("LTR")
for annot_type in ["LTR", "misc_feature", "CDS", "5'UTR"]:
feature_list = newaln.get_annotations_matching(annot_type)
new = newaln.get_region_covering_all(feature_list).get_slice().to_dict()
expected = aln_expecteds[annot_type]
assert expected == new, (annot_type, expected, new)
if annot_type in ["misc_feature", "LTR"]:
continue # because seqs haven't been annotated with it
for name in self.aln.names:
orig = str(
list(self.aln.get_annotations_from_seq(name, annot_type))[
0
].get_slice()
)
new = str(
list(newaln.get_annotations_from_seq(name, annot_type))[
0
].get_slice()
)
assert orig == new, (name, annot_type, orig, new)
def test_feature_projection(self):
expecteds = {"FAKE01": "CCCAAAATTTTTT", "FAKE02": "CCC-----TTTTT"}
aln_ltr = self.aln.get_annotations_matching("LTR")[0]
for seq_name in ["FAKE01", "FAKE02"]:
expected = expecteds[seq_name]
seq_ltr = self.aln.project_annotation(seq_name, aln_ltr)
if "-" in expected:
self.assertRaises(ValueError, seq_ltr.get_slice)
seq_ltr = seq_ltr.without_lost_spans()
expected = expected.replace("-", "")
self.assertEqual(seq_ltr.get_slice(), expected)
def test_feature_copy_annotations_to(self):
"""test correct copy of annotations"""
orig = DnaSequence("TTTTTTTTTTAAAA", name="Orig")
annot = orig.add_annotation(Feature, "exon", "fred", [(0, 14)])
seq = RnaSequence("UUUUUUUUUUAAAA", name="Test")
got = annot.copy_annotations_to(seq)
self.assertEqual(len(orig.annotations), len(got.annotations))
for src, dest in zip(orig.annotations, got.annotations):
self.assertEqual(src.get_coordinates(), dest.get_coordinates())
self.assertIsInstance(src, dest.__class__)
self.assertIs(dest.parent, seq)
with self.assertRaises(AssertionError):
_ = annot.copy_annotations_to(seq[:-2])
def test_reverse_complement(self):
"""test correct translation of annotations on reverse complement."""
aln_expecteds = {
"misc_feature": {"FAKE01": "TTTGGGGGGGGGG", "FAKE02": "TTTGGGGGGGGGG"},
"CDS": {"FAKE01": "GGGGGGGGGG", "FAKE02": "GGGGGGGGGG"},
"5'UTR": {"FAKE01": "CC", "FAKE02": "CC"},
"LTR": {"FAKE01": "CCCAAAATTTTTT", "FAKE02": "CCC-----TTTTT"},
}
seq_expecteds = {
"CDS": {"FAKE01": "GGGGGGGGGG", "FAKE02": "GGGGGGGGGG"},
"5'UTR": {"FAKE01": "TTT", "FAKE02": "TTT"},
}
rc = self.aln.rc()
# rc'ing an Alignment or Sequence rc's their annotations too. This means
# slicing returns the same sequence as the non-rc'd alignment/seq
for annot_type in ["misc_feature", "CDS", "5'UTR", "LTR"]:
observed = list(self.aln.get_by_annotation(annot_type))[0].to_dict()
expected = aln_expecteds[annot_type]
assert observed == expected, ("+", annot_type, expected, observed)
observed = list(rc.get_by_annotation(annot_type))[0].to_dict()
expected = aln_expecteds[annot_type]
assert observed == expected, ("-", annot_type, expected, observed)
if annot_type in ["misc_feature", "LTR"]:
continue # because seqs haven't been annotated with it
for name in self.aln.names:
observed = list(
self.aln.named_seqs[name].data.get_by_annotation(annot_type)
)[0]
observed = str(observed)
expected = seq_expecteds[annot_type][name]
assert str(observed) == expected, (
"+",
annot_type,
name,
expected,
observed,
)
observed = list(rc.named_seqs[name].data.get_by_annotation(annot_type))[
0
]
observed = str(observed)
expected = seq_expecteds[annot_type][name]
assert str(observed) == expected, (
"-",
annot_type,
name,
expected,
observed,
)
class TestMapSpans(unittest.TestCase):
"""Test attributes of Map & Spans classes critical to annotation
manipulation."""
def test_span(self):
forward = Span(20, 30)
reverse = Span(70, 80, reverse=True)
assert forward.reversed_relative_to(100) == reverse
assert reverse.reversed_relative_to(100) == forward
def test_map(self):
"""reversing a map with multiple spans should preserve span relative
order"""
forward = [Span(20, 30), Span(40, 50)]
fmap = Map(spans=forward, parent_length=100)
fmap_reversed = fmap.nucleic_reversed()
reverse = [Span(70, 80, reverse=True), Span(50, 60, reverse=True)]
rmap = Map(spans=reverse, parent_length=100)
for i in range(2):
self.assertEqual(fmap_reversed.spans[i], rmap.spans[i])
if __name__ == "__main__":
unittest.main()
|