1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153
|
#!/usr/bin/env python
"""Unit tests for GFF and related parsers.
"""
import os
from io import StringIO
from pathlib import Path
from unittest import TestCase, main
from cogent3.parse.gff import *
__author__ = "Matthew Wakefield"
__copyright__ = "Copyright 2007-2022, The Cogent Project"
__credits__ = ["Matthew Wakefield"]
__license__ = "BSD-3"
__version__ = "2023.2.12a1"
__maintainer__ = "Matthew Wakefield"
__email__ = "wakefield@wehi.edu.au"
__status__ = "Production"
headers = [
"""##gff-version 2
##source-version <source> <version text>
##date <date>
##Type <type> [<seqname>]
##DNA <seqname>
##acggctcggattggcgctggatgatagatcagacgac
##...
##end-DNA
""",
"""##gff-version 2
""",
"",
]
# '<seqname>\t<source>\t<feature>\t<start>\t<end>\t<score>\t<strand>\t<frame>\t[attribute]\n'
data_lines = [
(
'seq1\tBLASTX\tsimilarity\t101\t235\t87.1\t+\t0\tTarget "HBA_HUMAN" 11 55 ; E_value 0.0003\n',
(
"seq1",
"BLASTX",
"similarity",
100,
235,
"87.1",
"+",
"0",
'Target "HBA_HUMAN" 11 55 ; E_value 0.0003',
None,
),
),
(
'dJ102G20\tGD_mRNA\tcoding_exon\t7105\t7201\t.\t-\t2\tSequence "dJ102G20.C1.1"\n',
(
"dJ102G20",
"GD_mRNA",
"coding_exon",
7201,
7104,
".",
"-",
"2",
'Sequence "dJ102G20.C1.1"',
None,
),
),
(
"dJ102G20\tGD_mRNA\tcoding_exon\t7105\t7201\t.\t-\t2\t\n",
("dJ102G20", "GD_mRNA", "coding_exon", 7201, 7104, ".", "-", "2", "", None),
),
(
'12345\tSource with spaces\tfeature with spaces\t-100\t3600000000\t1e-5\t-\t.\tSequence "BROADO5" ; Note "This is a \\t tab containing \\n multi line comment"\n',
(
"12345",
"Source with spaces",
"feature with spaces",
3600000000,
101,
"1e-5",
"-",
".",
'Sequence "BROADO5" ; Note "This is a \\t tab containing \\n multi line comment"',
None,
),
),
]
class GffTest(TestCase):
"""Setup data for all the GFF parsers."""
def testGffParserData(self):
"""Test gff_parser with valid data lines"""
for (line, canned_result) in data_lines:
result = next(gff_parser(StringIO(line)))
canned_result = list(canned_result)
self.assertEqual(result.pop("Attributes")["Info"], canned_result.pop(8))
self.assertEqual(set(result.values()), set(canned_result))
def test_gff_parser_headers(self):
"""Test gff_parser with valid data headers"""
data = "".join([x[0] for x in data_lines])
for header in headers:
result = list(gff_parser(StringIO(header + data)))
lines = [(x[0], list(x[1])) for x in data_lines]
self.assertEqual(
[l.pop("Attributes")["Info"] for l in result],
[x[1].pop(8) for x in lines],
)
self.assertEqual(
[set(l.values()) for l in result], [set(x[1]) for x in lines]
)
def test_parse_attributes_gff2(self):
"""Test the parse_attributes_gff2 method"""
self.assertEqual(
[
parse_attributes_gff2(x[1][8], (x[1][3], x[1][4]))["ID"]
for x in data_lines
],
["HBA_HUMAN", "dJ102G20.C1.1", "", "BROADO5"],
)
def test_gff2_parser_string(self):
"""Test the gff_parser works with a string filepath"""
filepath = os.path.join("data/gff2_test.gff")
for i, result in enumerate(gff_parser(filepath)):
line = list(data_lines[i][1])
self.assertEqual(result.pop("Attributes")["Info"], line.pop(8))
self.assertEqual(set(result.values()), set(line))
def test_gff2_parser_path(self):
"""Test the gff_parser works with a pathlib.Path filepath"""
filepath = Path("data/gff2_test.gff")
for i, result in enumerate(gff_parser(filepath)):
line = list(data_lines[i][1])
self.assertEqual(result.pop("Attributes")["Info"], line.pop(8))
self.assertEqual(set(result.values()), set(line))
def test_gff3_parser(self):
"""Test the gff_parser works on a gff3 file"""
gff3_path = os.path.join("data/c_elegans_WS199_shortened_gff.gff3")
for i, result in enumerate(gff_parser(gff3_path)):
self.assertEqual(len(result), 10)
# 15 total lines, but 2 comments
self.assertEqual(i + 1, 15 - 2)
if __name__ == "__main__":
main()
|