1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420
|
.. jupyter-execute::
:hide-code:
import set_working_directory
.. _anno_db:
Annotation Databases
--------------------
This guide shows you how to use ``cogent3``'s annotation databases, which are in-memory SQLite databases, to store, query and manipulate the :ref:`howto-features` (also known as annotations) of one or more biological sequences.
What are the different types of ``AnnotationDb``?
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
There are three types of databases that are available: ``BasicAnnotationDb``, ``GffAnnotationDb``, and ``GenbankAnnotationDb``. A ``BasicAnnotationDb`` provides a "user" table where custom features can be added. The latter two, as hinted in their names, are distinguished by the type of data file used to generate them. Both ``GffAnnotationDb`` and ``GenbankAnnotationDb`` have a "user" table for custom features, which allows them to be merged with a ``BasicAnnotationDb``. However, they cannot be merged with each other!
How to create a standalone ``BasicAnnotationDb``
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
Achieved by creating an ``BasicAnnotationDb`` instance. This is an empty database to which we can add features.
.. jupyter-execute::
:raises:
from cogent3.core.annotation_db import BasicAnnotationDb
anno_db = BasicAnnotationDb()
anno_db
How to load an standalone ``AnnotationDb`` from a data file
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
Typically, we want to load a collection of features from a genomic annotation file, such as a GFF or Genbank file. For the following examples, we will use data from the bacterium *Mycoplasma genitalium*.
.. note:: See the list of :ref:`data_links` to download the data used in the following examples.
From a GFF file
"""""""""""""""
To load features from a GFF file, we can use the ``load_annotations`` function and provide the path to the GFF file. The function automatically determines the file type based on the file extension, and it returns a ``GffAnnotationDb`` object.
.. jupyter-execute::
:raises:
from cogent3 import load_annotations
gff_db = load_annotations(path="data/mycoplasma-genitalium.gff")
gff_db
From a Genbank file
"""""""""""""""""""
To load features from a Genbank file, we can once again use the ``load_annotations`` function and provide the path to the Genbank file. The function detects the file type based on the file extension, and it returns a ``GenbankAnnotationDb`` object.
.. jupyter-execute::
:raises:
from cogent3 import load_annotations
gb_db = load_annotations(path="data/mycoplasma-genitalium.gb")
gb_db
How to generate a summary of an ``AnnotationDb``
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
To generate a summary of an ``AnnotationDb``, we can access the ``describe`` attribute of the database. This attribute returns a ``cogent3.util.table.Table`` instance that shows the number of records for each seqid, the count for each biotype, and the number of rows in each table (in this example there is a "gff" table with 1,169 rows and an empty "user" table).
.. jupyter-execute::
:raises:
summary = gff_db.describe
summary
How to add custom features to an ``AnnotationDb``
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
This is achieved via the ``add_features`` method and for all three types of ``AnnotationDb`` it will be added to the "user" table. The method requires information about the feature, such as its biotype, name, genomic location (spans), and the seqid. The seqid is necessary when linking an ``AnnotationDb`` to a ``Sequence`` object, see :ref:`How to assign an AnnotationDb to a sequence <assign_db_to_seq>` for more information.
We can add a feature to the empty ``BasicAnnotationDb`` we created above. Now the database has one record!
.. jupyter-execute::
:raises:
anno_db.add_feature(
seqid="NC_000908",
biotype="gene",
name="interesting_gene",
spans=[(1, 4)],
strand="+",
)
anno_db.describe
We can also add a feature to our ``GffAnnotationDb`` or ``GenbankAnnotationDb``. Below, the previously empty "user" table now has a row count of one, indicating that our feature has been successfully added to the database.
.. jupyter-execute::
:raises:
gff_db.add_feature(
seqid="seq1",
biotype="gene",
name="interesting_gene",
spans=[(1, 4)],
strand="+",
)
gff_db.describe[-2:, :] # showing just last two rows
How to write an ``AnnotationDb`` to disk for efficient re-loading
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
In the above examples, all databases indicate that ``source=":memory:"``, i.e. they are in-memory databases. We can write any database to disk using the ``write()`` method and providing an outpath.
.. code-block:: python
# write to disk
gb_db.write("data/m-genitalium-database.gbdb")
# do something
# re-load from disk
quick_load_gb_db = GenbankAnnotationDb(source="data/m-genitalium-database.gbdb")
.. note:: The suffix of the outpath (".gbdb" in the above example) can be arbitrarily chosen, however, this behaviour may change in the future to only accept registered suffixes! 👀
How to query an ``AnnotationDb``
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
Note, there are two methods with the same interface available to query an ``AnnotationDb``:
1. ``get_features_matching()``. A generator that yields all features that matched the query. The **minimal information** required to create a ``cogent3`` ``Feature`` object is provided in the returned dictionary. For more information on Features see :ref:`howto-features`.
2. ``get_records_matching()``. A generator that yields all features that matched the query. The **complete record** for each matching feature is provided in the returned dictionary.
Put simply, a "feature" is a subset of a "record".
Querying via Feature Name
"""""""""""""""""""""""""
To query a database for a feature by its name, provide the name of the feature as an argument to either ``get_features_matching()`` or ``get_records_matching()``. Since an ``AnnotationDb`` can contain records for more than one sequence, it is best practice to also include the seqid of the sequence of interest.
For example, querying the ``GenbankAnnotationDb`` for the 16s rRNA gene:
.. jupyter-execute::
:raises:
mg_16s = list(
gb_db.get_features_matching(
name="MG_RS00775", biotype="gene", seqid="NC_000908"
)
)
mg_16s
Querying via Feature Biotype
""""""""""""""""""""""""""""
Similarly, ``get_features_matching()`` and ``get_records_matching()`` can be used to query the database for all features that match a given biotype.
For example, querying the ``GffAnnotationDb`` for all pseudogenes:
.. jupyter-execute::
:raises:
pseudogenes = list(gff_db.get_features_matching(biotype="pseudogene"))
pseudogenes[:2] # showing just the first two
Querying via region of interest
"""""""""""""""""""""""""""""""
We can provide ``start`` and ``end`` arguments to ``get_features_matching()`` and ``get_records_matching()`` and all features within the coordinates will be returned.
For example, the adhesin protein of *M. genitalium* is organised in an operon between positions 220600 to 229079, so we can query for genes in that region to return all operon genes:
.. jupyter-execute::
:raises:
operon_cds = list(
gff_db.get_features_matching(start=220600, end=229067, biotype="CDS")
)
operon_cds
Querying via the extended attributes field
""""""""""""""""""""""""""""""""""""""""""
A particularly useful functionality of a ``GffAnnotationDb`` is the ability to search the extended attributes field. This allows querying for records that have matches to a specific string provided to the ``attributes`` argument within their extended attributes field.
For example, we can query for all CDS related to replication:
.. jupyter-execute::
:raises:
replication_records = list(
gff_db.get_records_matching(attributes="replication", biotype="CDS")
)
replication_records[0] # showing just the first match
.. note:: Extended attribute querying only works for GFF databases!
How to interrogate an ``AnnotationDb``
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
An ``AnnotationDb`` can be interrogated to explore the properties of a sequence without needing the sequence information.
How many unique genes are in a given genome?
""""""""""""""""""""""""""""""""""""""""""""
*Mycoplasma genitalium* has the smallest bacterial genome, so the number of genes in the loaded database represents the approximate minimal set of genes required for bacterial life! We can see the total number of genes by using the ``num_matches()`` method and specifying the condition we want to be matched is that the biotype is "gene".
.. jupyter-execute::
:raises:
gb_db.num_matches(biotype="gene")
The count is 563, however, this may include genes with more than one copy. To determine the number of distinct genes we can use the ``count_distinct()`` method and specify ``biotype="gene"`` and ``name=True`` to indicate we are interested in genes with distinct names.
.. jupyter-execute::
:raises:
total_genes = gb_db.count_distinct(biotype="gene", name=True)
single_copy = total_genes[total_genes.columns["count"] == 1, :]
len(single_copy)
The count of unique genes is 561. This means that almost every gene is present only once in the genome, very little redundancy here!
Just for fun, let's try this with the GFF database... (downloaded from the exact same source)
.. jupyter-execute::
:raises:
total_genes = gff_db.num_matches(biotype="gene")
print("total genes: ", total_genes)
genes = gff_db.count_distinct(biotype="gene", name=True)
single_copy = genes[genes.columns["count"] == 1, :]
print("single copy genes: ", len(single_copy))
What? 🤯
How to find the "children" of a Feature
"""""""""""""""""""""""""""""""""""""""
To find the "children" of a feature, we can use the ``get_feature_children()`` method. A "child" refers to a feature that is nested within or contained by another "parent" feature. For example, a child feature could be an exon contained within a gene or a CDS contained within a transcript.
This method returns a generator that yields all the child features of the specified feature.
For example, let's find the children of "gene-MG_RS00035":
.. jupyter-execute::
:raises:
children = list(gff_db.get_feature_children(name="gene-MG_RS00035"))
children
How to find the "parent" of a Feature
"""""""""""""""""""""""""""""""""""""
To find the "parent" of a feature, we can use the ``get_feature_parent()`` method, which achieves the inverse of the above method.
For example, we can use the "child" we returned above ``"cds-WP_009885556.1"``, to find the original parent gene!
.. jupyter-execute::
:raises:
parents = list(gff_db.get_feature_parent(name="cds-WP_009885556.1"))
parents
How to combine two ``AnnotationDb`` instances
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
Checking the compatibility of two ``AnnotationDb`` instances
""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""
Combining data requires compatibility of the databases, this can be checked via the ``compatible()`` method. Below we check whether a ``GffAnnotationDb`` is compatible with a ``BasicAnnotationDb``.
.. jupyter-execute::
:raises:
gff_db.compatible(anno_db)
The method evaluates to ``True``, indicating that the data of the two databases can be merged.
What about merging a ``GffAnnotationDb`` and ``GenbankAnnotationDb``?
.. jupyter-execute::
:raises:
gff_db.compatible(gb_db)
The method evaluates to ``False``. Merging a ``GffAnnotationDb`` and ``GenbankAnnotationDb`` is not possible.
Taking the union of two ``AnnotationDb`` instances
""""""""""""""""""""""""""""""""""""""""""""""""""
The ``union()`` method will return a **new instance** with merged records.
.. jupyter-execute::
:raises:
union_db = gb_db.union(anno_db)
union_db.describe[-2:, :]
In the new merged database, there is now content in both the "user" and "gff" table.
Updating an ``AnnotationDb`` with the record from another database
""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""
The ``update()`` method will update records of a given database with another and return the **same instance** of the database.
.. jupyter-execute::
:raises:
gff_db.update(anno_db)
gff_db.describe[-2:, :]
Initialise a ``AnnotationDb`` with another database
"""""""""""""""""""""""""""""""""""""""""""""""""""
You can assign a compatible database to the ``db`` argument in the ``AnnotationDb`` constructor. If it's the same class, its db will be bound to self and directly modified.
.. jupyter-execute::
:raises:
from cogent3.core.annotation_db import GenbankAnnotationDb
new_gb_db = GenbankAnnotationDb(source="m-genitalium-database.gbdb", db=anno_db)
new_gb_db
How to get a subset of an ``AnnotationDb``
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
If you want a subset of a db, use the same arguments as you would for ``db.get_records_matching()``.
.. jupyter-execute::
:raises:
from cogent3 import load_annotations
gff_db = load_annotations(path="data/mycoplasma-genitalium.gff")
just_cds = gff_db.subset(biotype="CDS")
just_cds.describe
.. note:: The result is an in-memory database by default. To have this written to disk, assign a path to the source argument, e.g. ``gff_db.subset(source="som/path/subset.gff3db", biotype="CDS")``.
.. _assign_db_to_seq:
How to assign an ``AnnotationDb`` to a sequence
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
For more extensive documentation about annotating alignments and sequences see :ref:`howto-features`.
Directly assign an ``AnnotationDb`` to a Sequence
"""""""""""""""""""""""""""""""""""""""""""""""""
Assign the AnnotationDb to the ``annotation_db`` attribute of a Sequence
.. jupyter-execute::
:raises:
from cogent3 import make_seq
seq1 = make_seq(
"AAGAAGAAGACCCCCAAAAAAAAAATTTTTTTTTTAAAAAGGGAACCCT",
name="NC_000908",
moltype="dna",
)
seq1.annotation_db = anno_db
seq1.annotation_db
Loading an ``AnnotationDb`` and ``Sequence`` using the ``load_seq()`` function
"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""
For a single sequence Genbank file
++++++++++++++++++++++++++++++++++
Loading a sequence from a Genbank file will automatically create a database instance containing all features present in the file. This database instance will be bound to the ``Sequence`` instance via the ``.annotation_db`` attribute, accessing this attribute displays a representation of the bound annotations.
.. jupyter-execute::
:raises:
from cogent3 import load_seq
gb_seq = load_seq("data/mycoplasma-genitalium.gb")
gb_seq.annotation_db
For a single sequence FASTA file and an associated GFF annotation file
++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
Data can be loaded by providing the path to the gff file to the ``annotation_path`` argument of ``load_seq()``.
.. jupyter-execute::
:raises:
gff_seq = load_seq(
"data/mycoplasma-genitalium.fa",
annotation_path="data/mycoplasma-genitalium.gff",
)
gff_seq.annotation_db
.. note:: This assumes an exact match of the sequence name between files!
In the above example, the sequence name in the fasta file does not match any records in the gff3 file (it is ``"NC_000908.2 Mycoplasmoides genitalium G37, complete sequence"`` in the former, and ``"NC_000908.2"`` in the latter). However, if you are confident that they are related, then you can use the ``label_to_name`` argument of ``load_seq()`` to change the sequence name as follows:
.. jupyter-execute::
:raises:
seq = load_seq(
"data/mycoplasma-genitalium.fa",
annotation_path="data/mycoplasma-genitalium.gff",
label_to_name=lambda x: x.split()[0],
)
seq.annotation_db
.. jupyter-execute::
:hide-code:
import pathlib
# clean up files
path = pathlib.Path("m-genitalium-database.gbdb")
path.unlink()
|