1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492
|
from collections import deque
import pytest
from cogent3 import make_seq
from cogent3.align.pycompare import (
Kmer,
MatchedSeqPaths,
SeqKmers,
_calc_seed_size,
_extend_from_position,
_extend_left,
find_matched_paths,
segment,
)
def _brute_force(
seq1,
seq2,
window,
threshold,
):
"""an exhaustive comparison of all windows between the two sequences"""
mp = MatchedSeqPaths()
for s1 in range(len(seq1) - window + 1):
subseq1 = seq1[s1 : s1 + window]
for s2 in range(len(seq2) - window + 1):
subseq2 = seq2[s2 : s2 + window]
total = sum(b1 == b2 for b1, b2 in zip(subseq1, subseq2))
if total >= threshold:
mp[s2 - s1].append((segment(s1, s1 + window), segment(s2, s2 + window)))
for y_intercept in mp.paths:
if len(mp.paths[y_intercept]) == 1:
continue
merged = [mp.paths[y_intercept][0]]
for x2, y2 in mp.paths[y_intercept][1:]:
x1, y1 = merged[-1]
if x1.overlap(x2):
merged[-1] = (x1 | x2, y1 | y2)
else:
merged.append((x2, y2))
mp.paths[y_intercept] = merged
return mp
@pytest.fixture
def smallseq():
return "ACCGGTT"
def test_find_matched_k_eq_1():
s1 = make_seq("TGATGTAAGGTAGTT", name="1")
s2 = make_seq("CTGGAAGGGT", name="2")
expect = _brute_force(s1, s2, window=5, threshold=3)
sk = SeqKmers(s1, k=1, canonical=set("ACGT"))
got = find_matched_paths(seq_kmers=sk, seq1=s1, seq2=s2, window=5, threshold=3)
assert got.paths == expect.paths
def test_calc_seed_size():
"""default seed size should not be larger than than threshold"""
for i in range(2, 30):
x = _calc_seed_size(30, i)
assert x <= i
def test_calc_seed_size_singleton_window():
x = _calc_seed_size(1, 1)
assert x == 1
def test_segment():
c = segment(2, 4)
s, e = c
assert (s, e) == (2, 4)
c2 = segment(4, 6)
assert not c.overlap(c2) and not c2.overlap(c)
assert c.overlap(c)
c3 = segment(1, 3)
c4 = segment(3, 4)
c5 = segment(3, 5)
for other in (c3, c4, c5):
assert c.overlap(other)
c = segment(0, 2) - segment(4, 6)
assert c == segment(2, 4)
c = segment(4, 6) - segment(0, 2)
assert c == segment(2, 4)
assert c3 - c4 == segment(0, 0)
false = segment(0, 0)
assert not false
def test_segment_or():
c2 = segment(3, 7)
c3 = segment(4, 5)
got = c2 | c3
assert got == segment(3, 7)
def test_segment_merge():
c1 = segment(1, 3)
c2 = segment(3, 7)
with pytest.raises(AssertionError):
c1.merge(c2, strict=True)
got = c1.merge(c2, strict=False)
assert got == segment(1, 7)
def test_segment_nonzero():
c = segment(1, 3)
assert c
c = segment(0, 0)
assert not c
def test_segment_adjacent():
c1 = segment(1, 3)
c2 = segment(3, 7)
c3 = segment(4, 5)
assert c1.adjacent(c2) and c2.adjacent(c1)
assert not c1.adjacent(c3) and not c3.adjacent(c1)
assert not c2.adjacent(c3) and not c3.adjacent(c2)
def test_segment_rc():
"""should correctly transform for reverse complemented sequence"""
seq = make_seq("AACCCTTTTT", moltype="dna")
c = segment(2, 5)
assert seq[c.start : c.end] == "CCC"
r = c.for_rc(len(seq))
assert seq.rc()[r.start : r.end] == "GGG"
def test_get_segments():
seq1 = "ACCGCTT"
seq2 = "TTCCGCTTA"
r = _extend_from_position(seq1, 1, seq2, 2, 2, 2, "ACGT")
assert seq1[r[0].start : r[0].end] == seq2[r[1].start : r[1].end]
def test_kmer_one(smallseq):
seq = make_seq(smallseq, name="seq1")
kmers = {Kmer(e, seq.name, i) for i, e in enumerate(seq.iter_kmers(k=2))}
assert kmers == {smallseq[i : i + 2] for i in range(len(smallseq) - 1)}
# with k==1, there's duplicates
kmers = {}
for i, kmer in enumerate(seq.iter_kmers(k=1)):
if kmer in kmers:
kmers[kmer].add_location(seq.name, i)
else:
kmer = Kmer(kmer, seq.name, i)
kmers[kmer] = kmer
assert len(kmers) == 4
assert kmers["A"].indices[seq.name] == [0]
assert kmers["C"].indices[seq.name] == [1, 2]
assert kmers["G"].indices[seq.name] == [3, 4]
assert kmers["T"].indices[seq.name] == [5, 6]
# add a kmer from a different seq
kmers["A"].add_location("seq2", 23)
assert kmers["A"].indices["seq2"] == [23]
with pytest.raises(NotImplementedError):
kmers["A"].add_location("seq3", 23)
def test_seqkmers_1seq(smallseq):
seq1 = make_seq(smallseq, name="seq1", moltype="dna")
sk = SeqKmers(seq1, 1, canonical=set(seq1.moltype))
assert sk.num_seqs == 1
# iter k-mers skips single occurrence in seq1
for kmer in sk.iter_matching_kmers():
assert kmer.kmer != "A"
@pytest.mark.parametrize("k,expect", [(1, 3), (2, 5), (7, 0)])
def test_seqkmers_1seq_degenerate(k, expect):
# k-mers with degenerate characters are not stored
seq1 = make_seq("NCCGGTT", name="seq1", moltype="dna")
sk = SeqKmers(seq1, k, canonical=set(seq1.moltype))
assert len(sk.kmers) == expect
assert "N" not in sk.kmers
for kmer in sk.kmers:
assert "N" not in kmer.kmer
def test_seqkmers_2seqs(smallseq):
seq1 = make_seq(smallseq, name="seq1", moltype="dna")
seq2 = make_seq(smallseq[1:], name="seq2", moltype="dna")
sk = SeqKmers(seq1, 2, canonical=set(seq1.moltype))
sk.add_seq(seq2)
# the k-mer indices for "AC" should not have an entry for seq2, but should
# have an entry for all others that is -1 the entry for seq1
for kmer in sk.kmers:
if kmer == "AC":
assert seq2.name not in kmer.indices
else:
assert kmer.indices[seq1.name] == [e + 1 for e in kmer.indices[seq2.name]]
def test_seqkmers_1seq_iter_matched_indices():
from itertools import product
seq1 = make_seq("", name="seq1", moltype="dna")
sk = SeqKmers(seq1, 2, canonical=set("ACGT"))
kmer = Kmer("AA", "seq1", 0)
kmer.add_location("seq1", 1)
sk.kmers[kmer] = kmer
kmer = Kmer("CC", "seq1", 2)
kmer.add_location("seq1", 4)
sk.kmers[kmer] = kmer
got = list(sk.iter_matched_indices())
expect = list(product([0, 1], [0, 1])) + list(product([2, 4], [2, 4]))
assert got == expect
def test_seqkmers_2seq_iter_matched_indices():
from itertools import product
seq1 = make_seq("", name="seq1", moltype="dna")
sk = SeqKmers(seq1, 2, canonical=set("ACGT"))
sk.num_seqs += 1
sk.other_name = "seq2"
kmer = Kmer("AA", "seq1", 0)
kmer.add_location("seq1", 1)
kmer.add_location("seq2", 2)
kmer.add_location("seq2", 4)
sk.kmers[kmer] = kmer
got = list(sk.iter_matched_indices())
expect = list(product([0, 1], [2, 4]))
assert got == expect
def test_seqkmers_2seqs_dropseq(smallseq):
seq1 = make_seq(smallseq, name="seq1", moltype="dna")
seq2 = make_seq(smallseq[1:], name="seq2", moltype="dna")
sk = SeqKmers(seq1, 2, canonical=set(seq1.moltype))
sk.add_seq(seq2)
assert sk.ref_name == seq1.name
assert sk.other_name == seq2.name
assert sk.num_seqs == 2
sk.drop_seq(seq2.name)
assert sk.ref_name == seq1.name
assert sk.other_name is None
assert sk.num_seqs == 1
def test_dropseq_default(smallseq):
seq1 = make_seq(smallseq, name="seq1", moltype="dna")
seq2 = make_seq(smallseq[1:], name="seq2", moltype="dna")
sk = SeqKmers(seq1, 2, canonical=set(seq1.moltype))
sk.add_seq(seq2)
sk.drop_seq()
assert sk.other_name is None
def test_one_seq_dropseq(smallseq):
seq1 = make_seq(smallseq, name="seq1", moltype="dna")
sk = SeqKmers(seq1, 2, canonical=set(seq1.moltype))
assert sk.other_name is None
assert sk.num_seqs == 1
sk.drop_seq()
assert sk.other_name is None
assert sk.num_seqs == 1
def test_seqkmers_iter_matching_kmers(smallseq):
seq1 = make_seq(smallseq, name="seq1", moltype="dna")
seq2 = make_seq(smallseq[1:], name="seq2", moltype="dna")
sk = SeqKmers(seq1, 2, canonical=set(seq1.moltype))
sk.add_seq(seq2)
for kmer in sk.iter_matching_kmers():
assert kmer != "AC"
assert len(kmer.indices) == 2
def test_matchedpaths():
mp = MatchedSeqPaths()
mp.append(segment(1, 3), segment(2, 5))
assert mp.last_on_path(1, 1) == (segment(0, 0), segment(0, 0))
assert mp.last_on_path(1, 2) == mp[1][0]
mp.append(segment(10, 30), segment(11, 31))
assert mp.last_on_path(1, 2) == mp[1][-1]
assert mp.last_on_path(1, 2) != mp[1][0]
@pytest.fixture
def aseq1():
return make_seq("ATACGT", name="seq1", moltype="dna")
@pytest.fixture
def aseq2():
return make_seq("AGTTTACGTTTGACGTAA", name="seq2", moltype="dna")
def test_bruteforce(aseq1, aseq2):
got = _brute_force(aseq1, aseq2, 3, 3)
expect = MatchedSeqPaths()
expect[3].append((segment(1, 6), segment(4, 9)))
expect[10].append((segment(2, 6), segment(12, 16)))
assert got.paths == expect.paths
def test_find_matched_paths_2seq(aseq1, aseq2):
expect = _brute_force(aseq1, aseq2, 3, 3)
sk = SeqKmers(aseq1, k=3, canonical=set("ACGT"))
got = find_matched_paths(
seq_kmers=sk,
seq1=aseq1,
seq2=aseq2,
window=3,
threshold=3,
)
assert got.paths == expect.paths
def test_matched_paths_rc():
"""adjusting y-coordinate for reverse complement"""
path = MatchedSeqPaths()
path[4].append((segment(start=6, end=14), segment(start=10, end=18)))
xrc, yrc = path.get_coords(rc=True, length=24)
# slope must be negative
assert xrc[0] < xrc[1] and yrc[0] > yrc[1]
def test_matched_paths_min_gap():
"""correctly handle merging segments via gap position"""
path = MatchedSeqPaths()
path[4].extend(
[
(segment(start=6, end=8), segment(start=10, end=12)),
(segment(start=10, end=12), segment(start=14, end=16)),
]
)
got = path._get_segments(min_gap=1)
assert got == path.paths
got2 = path._get_segments(min_gap=2)
assert got2 != path.paths
got3 = path._get_segments(min_gap=3)
assert got3 == got2
assert got2[4] == [(segment(6, 12), segment(10, 16))]
# everything is hooked up
trace = path.plotly_trace(min_gap=3)
assert trace["x"] == [6, 12]
assert trace["y"] == [10, 16]
@pytest.mark.parametrize("moltype", ["text", "rna", "bytes", "protein"])
def test_find_matched_paths_moltype(aseq1, aseq2, moltype):
s1 = aseq1.to_moltype(moltype)
s2 = aseq2.to_moltype(moltype)
expect = _brute_force(s1, s2, 3, 3)
sk = SeqKmers(aseq1, k=3, canonical="ACGT")
got = find_matched_paths(
seq_kmers=sk,
seq1=s1,
seq2=s2,
window=3,
threshold=3,
)
assert got.paths == expect.paths
def test_find_matched_with_rc():
s = make_seq("CACACCACTGCAGTCGGATAGACC", moltype="dna", name="s1")
r = s.rc()
r.name = "rc1"
k = _calc_seed_size(4, 4)
expect = _brute_force(s, r, 4, 4)
sk = SeqKmers(s, k=k, canonical="ACGT")
# note there's a bug here, it creates a y_intercept at -11
got = find_matched_paths(seq_kmers=sk, seq1=s, seq2=r, window=4, threshold=4)
assert got.paths == expect.paths
x, y = got.paths[4][0]
yrc = y.for_rc(len(s))
# the rev complemented y-coord == x
assert x == yrc
def test_find_matched_with_small_seed():
s1 = make_seq("CACACCACTGCAGTCGGATAGACC", moltype="dna", name="s1")
s2 = make_seq("GGTCTATCCGACTGCAGTGGTGTG", moltype="dna", name="s2")
k = 2
expect = _brute_force(s1, s2, 4, 4)
sk = SeqKmers(s1, k=k, canonical="ACGT")
got = find_matched_paths(seq_kmers=sk, seq1=s1, seq2=s2, window=4, threshold=4)
assert got.paths == expect.paths
@pytest.mark.parametrize("w,t", [(4, 4), (3, 3)])
def test_find_matched_1seq(w, t):
s = make_seq("CACACCACTGCAGTCGGATAGACC", moltype="dna", name="s1")
expect = _brute_force(s, s, w, t)
sk = SeqKmers(s, k=w, canonical=set("ACGT"))
got = find_matched_paths(seq_kmers=sk, seq1=s, window=w, threshold=t)
assert got.paths == expect.paths
def test_plotly_trace(aseq1, aseq2):
sk = SeqKmers(aseq1, k=3, canonical=set("ACGT"))
got = find_matched_paths(
seq_kmers=sk,
seq1=aseq1,
seq2=aseq2,
window=3,
threshold=3,
)
trace = got.plotly_trace()
assert isinstance(trace, dict)
assert trace["type"] == "scatter"
assert len(trace["x"]) == len(trace["y"]) and len(trace["x"]) > 0
def _construct_matches(s1, s2, window):
return [a == b for a, b in zip(s1, s2)][:window]
@pytest.mark.parametrize("a,b", [(3, 5), (3, 0), (0, 4), (0, 0)])
def test_extend_left_no_shifts(a, b):
window, threshold = 4, 3
# preceeding base is mismatch, so starts should be unchanged
# | * mismatch within window
s1 = "TTACGCAGCA"
s2 = "TTTCCCGTAGCA"
# |
matches = deque(_construct_matches(s1[a:], s2[b:], window), maxlen=4)
total = sum(matches)
expect = deque(tuple(matches), maxlen=4)
# if either seq index is 0, just returns original values
start1, start2, m = _extend_left(matches, s1, a, s2, b, 3, threshold, total)
assert start1 == a and start2 == b and m == expect
_input_data = [("TTACGTTGCA", 1), ("ATCCGTCGCA", 2), ("TCCCGTCGCA", 3)]
@pytest.mark.parametrize("s1,diff", _input_data)
def test_extend_left_shifted(s1, diff):
window, threshold = 4, 3
# ****
s2 = "TTTCCCGTCGCA"
a, b = 3, 5
matches = deque(_construct_matches(s1[a:], s2[b:], window), maxlen=4)
start1, start2, matches = _extend_left(
matches, s1, a, s2, b, 3, threshold, sum(matches)
)
assert start1 == a - diff
assert start2 == b - diff
assert (
list(matches)
== [a == b for a, b in zip(s1[a - diff :], s2[b - diff :])][:window]
)
@pytest.mark.parametrize("left_limit", [3, 4, 5, 6])
def test_extend_left_truncated(left_limit):
# cannot be beyond the start of a sequence
window, threshold = 4, 3
# preceeding base is mismatch, start shifted left by 1 due to
# | * mismatch end of window
s1 = "TTACGTTGCA"
s2 = "TTTCCCGTCGCA"
# |
a, b = 3, 5
matches = deque(_construct_matches(s1[a:], s2[b:], window), maxlen=4)
start1, start2, matches = _extend_left(
matches,
s1,
a,
s2,
b,
left_limit,
threshold,
sum(matches),
)
assert start1 == a - 1
assert start2 == b - 1
assert list(matches) == [a == b for a, b in zip(s1[a - 1 :], s2[b - 1 :])][:window]
|