1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538
|
'''GFF3 format (:mod:`skbio.io.format.gff3`)
=========================================
.. currentmodule:: skbio.io.format.gff3
GFF3 (Generic Feature Format version 3) is a standard file format for
describing features for biological sequences. It contains lines of
text, each consisting of 9 tab-delimited columns [1]_.
Format Support
--------------
**Has Sniffer: Yes**
+------+------+---------------------------------------------------------------+
|Reader|Writer| Object Class |
+======+======+===============================================================+
|Yes |Yes |:mod:`skbio.sequence.Sequence` |
+------+------+---------------------------------------------------------------+
|Yes |Yes |:mod:`skbio.sequence.DNA` |
+------+------+---------------------------------------------------------------+
|Yes |Yes |:mod:`skbio.metadata.IntervalMetadata` |
+------+------+---------------------------------------------------------------+
|Yes |Yes |generator of tuple (seq_id of str type, |
| | |:mod:`skbio.metadata.IntervalMetadata`) |
+------+------+---------------------------------------------------------------+
Format Specification
--------------------
**State: Experimental as of 0.5.1.**
The first line of the file is a comment that identifies the format and
version. This is followed by a series of data lines. Each data line
corresponds to an annotation and consists of 9 columns: SEQID, SOURCE,
TYPE, START, END, SCORE, STRAND, PHASE, and ATTR.
Column 9 (ATTR) is list of feature attributes in the format
"tag=value". Multiple "tag=value" pairs are delimited by
semicolons. Multiple values of the same tag are separated with the
comma ",". The following tags have predefined meanings: ID, Name,
Alias, Parent, Target, Gap, Derives_from, Note, Dbxref, Ontology_term,
and Is_circular.
The meaning and format of these columns and attributes are explained
detail in the format specification [1]_. And they are read in as the
vocabulary defined in GenBank parser (:mod:`skbio.io.format.genbank`).
Format Parameters
-----------------
Reader-specific Parameters
^^^^^^^^^^^^^^^^^^^^^^^^^^
``IntervalMetadata`` GFF3 reader requires 1 parameter: ``seq_id``.
It reads the annotation with the specified
sequence ID from the GFF3 file into an ``IntervalMetadata`` object.
``DNA`` and ``Sequence`` GFF3 readers require ``seq_num`` of int as
parameter. It specifies which GFF3 record to read from a GFF3 file
with annotations of multiple sequences in it.
Writer-specific Parameters
^^^^^^^^^^^^^^^^^^^^^^^^^^
``skip_subregion`` is a boolean parameter used by all the GFF3 writers. It
specifies whether you would like to write each non-contiguous
sub-region for a feature annotation. For example, if there is
interval feature for a gene with two exons in an ``IntervalMetadata``
object, it will write one line into the GFF3 file when ``skip_subregion`` is
``True`` and will write 3 lines (one for the gene and one for each
exon, respectively) when ``skip_subregion`` is ``False``. Default is ``True``.
In addition, ``IntervalMetadata`` GFF3 writer needs a parameter of
``seq_id``. It specify the sequence ID (column 1 in GFF3 file) that
the annotation belong to.
Examples
--------
Let's create a file stream with following data in GFF3 format:
>>> from skbio import Sequence, DNA
>>> gff_str = """
... ##gff-version 3
... seq_1\\t.\\tgene\\t10\\t90\\t.\\t+\\t0\\tID=gen1
... seq_1\\t.\\texon\\t10\\t30\\t.\\t+\\t.\\tParent=gen1
... seq_1\\t.\\texon\\t50\\t90\\t.\\t+\\t.\\tParent=gen1
... seq_2\\t.\\tgene\\t80\\t96\\t.\\t-\\t.\\tID=gen2
... ##FASTA
... >seq_1
... ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
... ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
... >seq_2
... ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
... ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
... """
>>> import io
>>> from skbio.metadata import IntervalMetadata
>>> from skbio.io import read
>>> gff = io.StringIO(gff_str)
We can read it into ``IntervalMetadata``. Each line will be read into
an interval feature in ``IntervalMetadata`` object:
>>> im = read(gff, format='gff3', into=IntervalMetadata,
... seq_id='seq_1')
>>> im # doctest: +SKIP
3 interval features
-------------------
Interval(interval_metadata=<4604421736>, bounds=[(9, 90)], \
fuzzy=[(False, False)], metadata={'type': 'gene', \
'phase': 0, 'strand': '+', 'source': '.', 'score': '.', 'ID': 'gen1'})
Interval(interval_metadata=<4604421736>, bounds=[(9, 30)], \
fuzzy=[(False, False)], metadata={'strand': '+', 'source': '.', \
'type': 'exon', 'Parent': 'gen1', 'score': '.'})
Interval(interval_metadata=<4604421736>, bounds=[(49, 90)], \
fuzzy=[(False, False)], metadata={'strand': '+', 'source': '.', \
'type': 'exon', 'Parent': 'gen1', 'score': '.'})
We can write the ``IntervalMetadata`` object back to GFF3 file:
>>> with io.StringIO() as fh: # doctest: +NORMALIZE_WHITESPACE
... print(im.write(fh, format='gff3', seq_id='seq_1').getvalue())
##gff-version 3
seq_1 . gene 10 90 . + 0 ID=gen1
seq_1 . exon 10 30 . + . Parent=gen1
seq_1 . exon 50 90 . + . Parent=gen1
<BLANKLINE>
If the GFF3 file does not have the sequence ID, it will return an empty object:
>>> gff = io.StringIO(gff_str)
>>> im = read(gff, format='gff3', into=IntervalMetadata,
... seq_id='foo')
>>> im
0 interval features
-------------------
We can also read the GFF3 file into a generator:
>>> gff = io.StringIO(gff_str)
>>> gen = read(gff, format='gff3')
>>> for im in gen: # doctest: +SKIP
... print(im[0]) # the seq id
... print(im[1]) # the interval metadata on this seq
seq_1
3 interval features
-------------------
Interval(interval_metadata=<4603377592>, bounds=[(9, 90)], \
fuzzy=[(False, False)], metadata={'type': 'gene', 'ID': 'gen1', \
'source': '.', 'score': '.', 'strand': '+', 'phase': 0})
Interval(interval_metadata=<4603377592>, bounds=[(9, 30)], \
fuzzy=[(False, False)], metadata={'strand': '+', 'type': 'exon', \
'Parent': 'gen1', 'source': '.', 'score': '.'})
Interval(interval_metadata=<4603377592>, bounds=[(49, 90)], \
fuzzy=[(False, False)], metadata={'strand': '+', 'type': 'exon', \
'Parent': 'gen1', 'source': '.', 'score': '.'})
seq_2
1 interval feature
------------------
Interval(interval_metadata=<4603378712>, bounds=[(79, 96)], \
fuzzy=[(False, False)], metadata={'strand': '-', 'type': 'gene', \
'ID': 'gen2', 'source': '.', 'score': '.'})
For the GFF3 file with sequences, we can read it into ``Sequence`` or ``DNA``:
>>> gff = io.StringIO(gff_str)
>>> seq = read(gff, format='gff3', into=Sequence, seq_num=1)
>>> seq
Sequence
--------------------------------------------------------------------
Metadata:
'description': ''
'id': 'seq_1'
Interval metadata:
3 interval features
Stats:
length: 100
--------------------------------------------------------------------
0 ATGCATGCAT GCATGCATGC ATGCATGCAT GCATGCATGC ATGCATGCAT GCATGCATGC
60 ATGCATGCAT GCATGCATGC ATGCATGCAT GCATGCATGC
>>> gff = io.StringIO(gff_str)
>>> seq = read(gff, format='gff3', into=DNA, seq_num=2)
>>> seq
DNA
--------------------------------------------------------------------
Metadata:
'description': ''
'id': 'seq_2'
Interval metadata:
1 interval feature
Stats:
length: 120
has gaps: False
has degenerates: False
has definites: True
GC-content: 50.00%
--------------------------------------------------------------------
0 ATGCATGCAT GCATGCATGC ATGCATGCAT GCATGCATGC ATGCATGCAT GCATGCATGC
60 ATGCATGCAT GCATGCATGC ATGCATGCAT GCATGCATGC ATGCATGCAT GCATGCATGC
References
----------
.. [1] https://github.com/The-Sequence-Ontology/\
Specifications/blob/master/gff3.md
'''
# ----------------------------------------------------------------------------
# Copyright (c) 2013--, scikit-bio development team.
#
# Distributed under the terms of the Modified BSD License.
#
# The full license is in the file COPYING.txt, distributed with this software.
# ----------------------------------------------------------------------------
import re
from collections import Iterable
from skbio.sequence import DNA, Sequence
from skbio.io import create_format, GFF3FormatError
from skbio.metadata import IntervalMetadata
from skbio.io.format._base import (
_line_generator, _too_many_blanks, _get_nth_sequence)
from skbio.io.format.fasta import _fasta_to_generator
from skbio.io.format._sequence_feature_vocabulary import (
_vocabulary_change, _vocabulary_skip)
from skbio.io import write
gff3 = create_format('gff3')
@gff3.sniffer()
def _gff3_sniffer(fh):
# check the 1st real line is a valid ID line
if _too_many_blanks(fh, 5):
return False, {}
try:
line = next(_line_generator(fh, skip_blanks=True, strip=False))
except StopIteration:
return False, {}
if re.match(r'##gff-version\s+3', line):
return True, {}
else:
return False, {}
@gff3.reader(None)
def _gff3_to_generator(fh):
'''Parse the GFF3 into the existing IntervalMetadata
Parameters
----------
fh : file
file handler
Yields
------
tuple
str of seq id, IntervalMetadata
'''
id_lengths = {}
for data_type, sid, data in _yield_record(fh):
if data_type == 'length':
# get length from sequence-region pragma.
# the pragma lines are always before the real annotation lines.
id_lengths[sid] = data
elif data_type == 'data':
length = id_lengths.get(sid)
yield sid, _parse_record(data, length)
@gff3.writer(None)
def _generator_to_gff3(obj, fh, skip_subregion=True):
'''Write list of IntervalMetadata into file.
Parameters
----------
obj : Iterable of (seq_id, IntervalMetadata)
fh : file handler
skip_subregion : bool
write a line for each sub-regions of an ``Interval`` if it is ``False``
'''
# write file header
fh.write('##gff-version 3\n')
for seq_id, obj_i in obj:
_serialize_interval_metadata(obj_i, seq_id, fh, skip_subregion)
@gff3.reader(Sequence)
def _gff3_to_sequence(fh, seq_num=1):
return _construct_seq(fh, Sequence, seq_num)
@gff3.writer(Sequence)
def _sequence_to_gff3(obj, fh, skip_subregion=True):
# write file header
fh.write('##gff-version 3\n')
_serialize_seq(obj, fh, skip_subregion)
@gff3.reader(DNA)
def _gff3_to_dna(fh, seq_num=1):
return _construct_seq(fh, DNA, seq_num)
@gff3.writer(DNA)
def _dna_to_gff3(obj, fh, skip_subregion=True):
# write file header
fh.write('##gff-version 3\n')
_serialize_seq(obj, fh, skip_subregion)
@gff3.reader(IntervalMetadata)
def _gff3_to_interval_metadata(fh, seq_id):
'''Read a GFF3 record into the specified interval metadata.
Parameters
----------
fh : file handler
seq_id : str
sequence ID which the interval metadata is associated with
'''
length = None
for data_type, sid, data in _yield_record(fh):
if seq_id == sid:
if data_type == 'length':
# get length from sequence-region pragma
length = data
elif data_type == 'data':
return _parse_record(data, length)
else:
raise GFF3FormatError(
'Unknown section in the input GFF3 file: '
'%r %r %r' % (data_type, sid, data))
# return an empty instead of None
return IntervalMetadata(None)
@gff3.writer(IntervalMetadata)
def _interval_metadata_to_gff3(obj, fh, seq_id, skip_subregion=True):
'''Output ``IntervalMetadata`` object to GFF3 file.
Parameters
----------
obj : IntervalMetadata
fh : file object like
seq_id : str
ID for column 1 in the GFF3 file.
skip_subregion : bool
write a line for each sub-regions of an ``Interval`` if it is ``False``
'''
# write file header
fh.write('##gff-version 3\n')
_serialize_interval_metadata(obj, seq_id, fh, skip_subregion=True)
def _construct_seq(fh, constructor=DNA, seq_num=1):
lines = []
for i, (data_type, seq_id, l) in enumerate(_yield_record(fh), 1):
if data_type == 'data' and seq_num == i:
lines = l
seq = _get_nth_sequence(_fasta_to_generator(fh, constructor=constructor),
seq_num=seq_num)
seq.interval_metadata = _parse_record(lines, len(seq))
return seq
def _yield_record(fh):
'''Yield (seq_id, lines) that belong to the same sequence.'''
lines = []
current = False
for line in _line_generator(fh, skip_blanks=True, strip=True):
if line.startswith('##sequence-region'):
_, seq_id, start, end = line.split()
length = int(end) - int(start) + 1
yield 'length', seq_id, length
if line.startswith('##FASTA'):
# stop once reaching to sequence section
break
if not line.startswith('#'):
try:
seq_id, _ = line.split('\t', 1)
except ValueError:
raise GFF3FormatError(
'Wrong GFF3 format at line: %s' % line)
if current == seq_id:
lines.append(line)
else:
if current is not False:
yield 'data', current, lines
lines = [line]
current = seq_id
if current is False:
# if the input file object is empty, it should return
# an empty generator
return
yield
else:
yield 'data', current, lines
def _parse_record(lines, length):
'''Parse the lines into a IntervalMetadata object.'''
interval_metadata = IntervalMetadata(length)
for line in lines:
columns = line.split('\t')
# there should be 9 columns
if len(columns) != 9:
raise GFF3FormatError(
'do not have 9 columns in this line: "%s"' % line)
# the 1st column is seq ID for every feature. don't store
# this repetitive information
metadata = {'source': columns[1],
'type': columns[2],
'score': columns[5],
'strand': columns[6]}
phase = columns[7]
# phase value can only be int or '.'
try:
metadata['phase'] = int(phase)
except ValueError:
if phase != '.':
raise GFF3FormatError(
'unknown value for phase column: {!r}'.format(phase))
metadata.update(_parse_attr(columns[8]))
start, end = columns[3:5]
bounds = [(int(start)-1, int(end))]
interval_metadata.add(bounds, metadata=metadata)
return interval_metadata
def _parse_attr(s):
'''parse attribute column'''
voca_change = _vocabulary_change('gff3')
md = {}
# in case the line ending with ';', strip it.
s = s.rstrip(';')
for attr in s.split(';'):
k, v = attr.split('=')
if k in voca_change:
k = voca_change[k]
md[k] = v
return md
def _serialize_interval_metadata(interval_metadata, seq_id, fh,
skip_subregion=True):
'''Serialize an IntervalMetadata to GFF3.
Parameters
----------
interval_metadata : IntervalMetadata
seq_id : str
Seq id for the current annotation. It will be used as the 1st column
in the GFF3.
fh : file handler
the file object to output
skip_subregion : bool
Whether to skip outputting each sub region as a line in GFF3.
'''
column_keys = ['source', 'type', 'score', 'strand', 'phase']
voca_change = _vocabulary_change('gff3', False)
voca_skip = _vocabulary_skip('gff3')
voca_skip.extend(column_keys)
# these characters have reserved meanings in column 9 and must be
# escaped when used in other contexts
escape = str.maketrans({';': '%3B',
'=': '%3D',
'&': '%26',
',': '%2C'})
for interval in interval_metadata._intervals:
md = interval.metadata
bd = interval.bounds
start = str(bd[0][0] + 1)
end = str(bd[-1][-1])
source, feat_type, score, strand, phase = [
str(md.get(i, '.')) for i in column_keys]
columns = [seq_id, source, feat_type, start, end, score, strand, phase]
# serialize the attributes in column 9
attr = []
# use sort to make the output order deterministic
for k in sorted(md):
if k in voca_skip:
# skip the metadata that doesn't go to attribute column
continue
v = md[k]
if k in voca_change:
k = voca_change[k]
if isinstance(v, Iterable) and not isinstance(v, str):
# if there are multiple values for this attribute,
# convert them to str and concat them with ","
v = ','.join(str(i).translate(escape) for i in v)
else:
v = v.translate(escape)
attr.append('%s=%s' % (k.translate(escape), v))
columns.append(';'.join(attr))
fh.write('\t'.join(columns))
fh.write('\n')
# if there are multiple regions for this feature,
# output each region as a standalone line in GFF3.
if len(bd) > 1 and skip_subregion is False:
for start, end in bd:
# if this is a gene, then each sub region should be an exon
if columns[2] == 'gene':
columns[2] = 'exon'
columns[3] = str(start + 1)
columns[4] = str(end)
try:
parent = md['ID']
except KeyError:
raise GFF3FormatError(
'You need provide ID info for '
'the parent interval feature: %r' % interval)
columns[8] = 'Parent=%s' % parent
fh.write('\t'.join(columns))
fh.write('\n')
def _serialize_seq(seq, fh, skip_subregion=True):
'''Serialize a sequence to GFF3.'''
_serialize_interval_metadata(
seq.interval_metadata, seq.metadata['id'], fh, skip_subregion)
fh.write('##FASTA\n')
write(seq, into=fh, format='fasta')
|