1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907
|
# ----------------------------------------------------------------------------
# Copyright (c) 2013--, scikit-bio development team.
#
# Distributed under the terms of the Modified BSD License.
#
# The full license is in the file COPYING.txt, distributed with this software.
# ----------------------------------------------------------------------------
import pandas as pd
import io
import unittest
from collections import OrderedDict
from skbio import TabularMSA, Protein, DNA, RNA
from skbio.io import StockholmFormatError
from skbio.io.format.stockholm import (_stockholm_to_tabular_msa,
_tabular_msa_to_stockholm,
_stockholm_sniffer)
from skbio.util import get_data_path
class TestStockholmSniffer(unittest.TestCase):
def setUp(self):
self.positives = [get_data_path(e) for e in [
'stockholm_extensive',
'stockholm_minimal',
'stockholm_rna',
'stockholm_runon_gf_with_whitespace',
'stockholm_runon_gf_no_whitespace',
'stockholm_duplicate_sequence_names',
'stockholm_duplicate_gr',
'stockholm_duplicate_gc',
'stockholm_invalid_nonexistent_gr',
'stockholm_invalid_nonexistent_gs',
'stockholm_no_data',
'stockholm_blank_lines',
'stockholm_differing_gc_data_length',
'stockholm_differing_gr_data_length',
'stockholm_differing_seq_lengths',
'stockholm_duplicate_sequence_names',
'stockholm_duplicate_tree_ids',
'stockholm_extensive_mixed',
'stockholm_invalid_data_type',
'stockholm_malformed_gf_line',
'stockholm_malformed_gs_line',
'stockholm_malformed_gr_line',
'stockholm_malformed_gc_line',
'stockholm_malformed_data_line',
'stockholm_metadata_only',
'stockholm_multiple_msa',
'stockholm_multiple_trees',
'stockholm_runon_gs_with_whitespace',
'stockholm_runon_gs_no_whitespace',
'stockholm_single_tree_with_id',
'stockholm_single_tree_without_id',
'stockholm_whitespace_only_lines',
'stockholm_all_data_types',
'stockholm_two_of_each_metadata',
'stockholm_data_only',
'stockholm_nonstring_labels',
'stockholm_missing_reference_items',
'stockholm_multiple_references',
'stockholm_runon_references',
'stockholm_runon_references_mixed',
'stockholm_single_reference',
'stockholm_missing_reference_items',
'stockholm_missing_rn_tag',
'stockholm_different_padding',
'stockholm_multi_line_tree_no_id',
'stockholm_multi_line_tree_with_id',
'stockholm_multiple_multi_line_trees'
]]
self.negatives = [get_data_path(e) for e in [
'stockholm_missing_header',
'empty',
'whitespace_only'
]]
def test_positives(self):
for fp in self.positives:
self.assertEqual(_stockholm_sniffer(fp), (True, {}))
def test_negatives(self):
for fp in self.negatives:
self.assertEqual(_stockholm_sniffer(fp), (False, {}))
class TestStockholmReader(unittest.TestCase):
def test_stockholm_extensive(self):
fp = get_data_path('stockholm_extensive')
msa = _stockholm_to_tabular_msa(fp, constructor=Protein)
exp = TabularMSA([Protein('MTCRAQLIAVPRASSLAE..AIACAQKM....'
'RVSRVPVYERS',
positional_metadata={'SA': list('9998877564'
'53524252..'
'55152525..'
'..36463774'
'777')}),
Protein('EVMLTDIPRLHINDPIMK..GFGMVINN....'
'..GFVCVENDE',
metadata={'OS': 'Bacillus subtilis'},
positional_metadata={'SS': list('CCCCCCCHHHH'
'HHHHHHH..HE'
'EEEEEE....E'
'EEEEEE'
'EEEH')}),
Protein('EVMLTDIPRLHINDPIMK..GFGMVINN...'
'...GFVCVENDE',
positional_metadata={'AS': list('___________'
'_____*_____'
'___________'
'________'
'__'),
'IN': list('___________'
'_1_________'
'_____2_____'
'_____0_'
'___')})],
metadata={'ID': 'CBS', 'AC': 'PF00571',
'AU': 'Bateman A', 'SQ': '67'},
positional_metadata={'SS_cons': list('CCCCCHHHHHHHH'
'HHHHH..EEEEEE'
'EE....EEEEEEE'
'EEEH')},
index=['O83071/192-246', 'O31698/88-139',
'O31699/88-139'])
self.assertEqual(msa, exp)
def test_stockholm_extensive_mixed(self):
fp = get_data_path('stockholm_extensive_mixed')
msa = _stockholm_to_tabular_msa(fp, constructor=Protein)
exp = TabularMSA([Protein('MTCRAQLIAVPRASSLAE..AIACAQKM....'
'RVSRVPVYERS',
positional_metadata={'SA': list('9998877564'
'53524252..'
'55152525..'
'..36463774'
'777')}),
Protein('EVMLTDIPRLHINDPIMK..GFGMVINN....'
'..GFVCVENDE',
metadata={'OS': 'Bacillus subtilis'},
positional_metadata={'SS': list('CCCCCCCHHHH'
'HHHHHHH..HE'
'EEEEEE....E'
'EEEEEE'
'EEEH')}),
Protein('EVMLTDIPRLHINDPIMK..GFGMVINN...'
'...GFVCVENDE',
positional_metadata={'AS': list('___________'
'_____*_____'
'___________'
'________'
'__'),
'IN': list('___________'
'_1_________'
'_____2_____'
'_____0_'
'___')})],
metadata={'ID': 'CBS', 'AC': 'PF00571',
'AU': 'Bateman A', 'SQ': '67'},
positional_metadata={'SS_cons': list('CCCCCHHHHHHHH'
'HHHHH..EEEEEE'
'EE....EEEEEEE'
'EEEH')},
index=['O83071/192-246', 'O31698/88-139',
'O31699/88-139'])
self.assertEqual(msa, exp)
def test_stockholm_minimal(self):
fp = get_data_path('stockholm_minimal')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([DNA('TGTGTCGCAGTTGTCGTTTG')], index=['0235244'])
self.assertEqual(msa, exp)
def test_stockholm_rna(self):
fp = get_data_path('stockholm_rna')
msa = _stockholm_to_tabular_msa(fp, constructor=RNA)
exp = TabularMSA([RNA('AAGGGUUAUUUAUAUACUUU'),
RNA('UGCUAAGAGUGGGGAUGAUU'),
RNA('GCCACAACCGAUUAGAUAGA'),
RNA('UUAGAAACCGAUGGACCGAA')],
metadata={'AC': 'G2134T23', 'ID': 'ARD'},
positional_metadata=(
{'AC_cons': list('GGGACUGGACAUCUAUUCAG')}),
index=['RTC2231', 'RTF2124', 'RTH3322', 'RTB1512'])
self.assertEqual(msa, exp)
def test_stockholm_runon_gf(self):
fp = get_data_path('stockholm_runon_gf_no_whitespace')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([DNA('ACTGGTTCAATG')],
metadata={'CC': 'CBS domains are small intracellular'
' modules mostly found in 2 or four '
'copies within a protein.'},
index=['GG1344'])
self.assertEqual(msa, exp)
fp = get_data_path('stockholm_runon_gf_with_whitespace')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
self.assertEqual(msa, exp)
def test_stockholm_runon_gs(self):
fp = get_data_path('stockholm_runon_gs_no_whitespace')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([DNA('ATCGTTCAGTG',
metadata={'LN': 'This is a runon GS line.'})],
index=['seq1'])
self.assertEqual(msa, exp)
fp = get_data_path('stockholm_runon_gs_with_whitespace')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
self.assertEqual(msa, exp)
def test_stockholm_metadata_only(self):
fp = get_data_path('stockholm_metadata_only')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'NM': 'Kestrel Gorlick',
'DT': 'February 5th, 2016'})
self.assertEqual(msa, exp)
def test_stockholm_no_data(self):
fp = get_data_path('stockholm_no_data')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([])
self.assertEqual(msa, exp)
def test_stockholm_with_blank_lines(self):
fp = get_data_path('stockholm_blank_lines')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'AL': 'ABCD', 'NM': '1234'})
self.assertEqual(msa, exp)
def test_stockholm_with_whitespace_only_lines(self):
fp = get_data_path('stockholm_whitespace_only_lines')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'AL': 'ABCD', 'NM': '1234'})
self.assertEqual(msa, exp)
def test_stockholm_single_tree_without_id(self):
fp = get_data_path('stockholm_single_tree_without_id')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'NH': 'ABCD'})
self.assertEqual(msa, exp)
def test_stockholm_single_tree_with_id(self):
fp = get_data_path('stockholm_single_tree_with_id')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'NH': {'tree1': 'ABCD'}})
self.assertEqual(msa, exp)
def test_stockholm_multiple_trees(self):
fp = get_data_path('stockholm_multiple_trees')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'NH': {'tree1': 'ABCD',
'tree2': 'EFGH',
'tree3': 'IJKL'}})
self.assertEqual(msa, exp)
def test_stockhom_single_reference(self):
fp = get_data_path('stockholm_single_reference')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RM', '123456789'),
('RT', 'A Title'),
('RA', 'The Author'),
('RL', 'A Location'),
('RC', 'Comment')])]})
self.assertEqual(msa, exp)
def test_stockholm_multiple_references(self):
fp = get_data_path('stockholm_multiple_references')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RM', '123456789'),
('RT', 'Title 1'),
('RA', 'Author 1'),
('RL', 'Location 1'),
('RC', 'Comment 1')]),
OrderedDict([('RM', '987654321'),
('RT', 'Title 2'),
('RA', 'Author 2'),
('RL', 'Location 2'),
('RC', 'Comment 2')]),
OrderedDict([('RM', '132465879'),
('RT', 'Title 3'),
('RA', 'Author 3'),
('RL', 'Location 3'),
('RC', 'Comment 3')])]})
self.assertEqual(msa, exp)
def test_stockholm_runon_references(self):
fp = get_data_path('stockholm_runon_references')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RM', '123456789'),
('RT', 'A Runon Title'),
('RA', 'The Author'),
('RL', 'A Location'),
('RC', 'A Runon Comment')])]})
self.assertEqual(msa, exp)
def test_stockholm_mixed_runon_references(self):
fp = get_data_path('stockholm_runon_references_mixed')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RC', 'A Runon Comment'),
('RM', '123456789'),
('RT', 'A Runon Title'),
('RA', 'The Author'),
('RL', 'A Location')])]})
self.assertEqual(msa, exp)
def test_stockholm_to_msa_different_padding(self):
fp = get_data_path('stockholm_different_padding')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RC',
'A Runon Comment Without '
'Whitespace')]),
OrderedDict([('RC',
'A Runon Comment With '
'Whitespace')])]})
self.assertEqual(msa, exp)
def test_stockholm_handles_missing_reference_items(self):
fp = get_data_path('stockholm_missing_reference_items')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RT', 'A Title'),
('RA', 'The Author')])]})
self.assertEqual(msa, exp)
def test_stockholm_multi_line_tree_no_id(self):
fp = get_data_path('stockholm_multi_line_tree_no_id')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'NH': 'ABCDEFGH'})
self.assertEqual(msa, exp)
def test_stockholm_multiple_multi_line_trees(self):
fp = get_data_path('stockholm_multiple_multi_line_trees')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'NH': {'tree1': 'ABCDEFGH',
'tree2': 'IJKLMNOP'}})
self.assertEqual(msa, exp)
def test_stockholm_multi_line_tree_with_id(self):
fp = get_data_path('stockholm_multi_line_tree_with_id')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
exp = TabularMSA([], metadata={'NH': {'tree1': 'ABCDEFGH'}})
self.assertEqual(msa, exp)
def test_multiple_msa_file(self):
fp = get_data_path('stockholm_multiple_msa')
msa = _stockholm_to_tabular_msa(fp, constructor=RNA)
exp = TabularMSA([RNA('AAGGGUUAUUUAUAUACUUU'),
RNA('UGCUAAGAGUGGGGAUGAUU'),
RNA('GCCACAACCGAUUAGAUAGA'),
RNA('UUAGAAACCGAUGGACCGAA')],
metadata={'AC': 'G2134T23', 'ID': 'ARD'},
positional_metadata=(
{'AC_cons': list('GGGACUGGACAUCUAUUCAG')}),
index=['RTC2231', 'RTF2124', 'RTH3322', 'RTB1512'])
self.assertEqual(msa, exp)
def test_stockholm_maintains_order(self):
fp = get_data_path('stockholm_two_of_each_metadata')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
msa_order = list(msa.metadata.items())
exp_order = [('NM', 'Kestrel Gorlick'), ('DT', 'February 5th, 2016')]
self.assertEqual(msa_order, exp_order)
msa_order = list(msa[0].metadata.items())
exp_order = [('AL', 'ABCD'), ('NS', '1234')]
self.assertEqual(msa_order, exp_order)
msa_order = list(msa.positional_metadata.columns)
exp_order = ['SS_cons', 'AS_cons']
self.assertEqual(msa_order, exp_order)
msa_order = list(msa[0].positional_metadata.columns)
exp_order = ['SS', 'AS']
self.assertEqual(msa_order, exp_order)
def test_stockholm_duplicate_tree_id_error(self):
fp = get_data_path('stockholm_duplicate_tree_ids')
with self.assertRaisesRegex(StockholmFormatError,
r'Tree.*tree1.*in file.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_stockholm_missing_reference_number_error(self):
fp = get_data_path('stockholm_missing_rn_tag')
with self.assertRaisesRegex(StockholmFormatError,
r"Expected 'RN'.*'RL' tag."):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_nonexistent_gr_error(self):
fp = get_data_path('stockholm_invalid_nonexistent_gr')
with self.assertRaisesRegex(StockholmFormatError,
r'GS or GR.*nonexistent '
'sequence.*RL1355.'):
_stockholm_to_tabular_msa(fp, constructor=RNA)
def test_nonexistent_gs_error(self):
fp = get_data_path('stockholm_invalid_nonexistent_gs')
with self.assertRaisesRegex(StockholmFormatError,
r'GS or GR.*nonexistent sequence.*AC14.'):
_stockholm_to_tabular_msa(fp, constructor=RNA)
def test_duplicate_sequence_names_error(self):
fp = get_data_path('stockholm_duplicate_sequence_names')
with self.assertRaisesRegex(
StockholmFormatError,
r'duplicate sequence name.*ASR132.*supported by the reader.'):
_stockholm_to_tabular_msa(fp, constructor=RNA)
def test_duplicate_gr_error(self):
fp = get_data_path('stockholm_duplicate_gr')
with self.assertRaisesRegex(StockholmFormatError,
r'Found duplicate GR.*OS.*LFDR3.*supported'
' by the reader.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_duplicate_gc_error(self):
fp = get_data_path('stockholm_duplicate_gc')
with self.assertRaisesRegex(StockholmFormatError,
r'Found duplicate GC.*SS_cons.*supported '
'by the reader.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_empty_file_error(self):
fp = get_data_path('empty')
with self.assertRaisesRegex(StockholmFormatError, r'File is empty.'):
_stockholm_to_tabular_msa(fp, constructor=RNA)
def test_missing_header_error(self):
fp = get_data_path('stockholm_missing_header')
with self.assertRaisesRegex(StockholmFormatError,
r'File missing.*header'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_missing_footer_error(self):
fp = get_data_path('stockholm_missing_footer')
with self.assertRaisesRegex(StockholmFormatError,
r'Final line.*only "//".'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_data_type_error(self):
fp = get_data_path('stockholm_invalid_data_type')
with self.assertRaisesRegex(StockholmFormatError,
r"Unrecognized.*'#=GZ"):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_malformed_gf_line_error(self):
fp = get_data_path('stockholm_malformed_gf_line')
with self.assertRaisesRegex(StockholmFormatError,
r'Line contains 2.*must contain.*3.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_malformed_gs_line_error(self):
fp = get_data_path('stockholm_malformed_gs_line')
with self.assertRaisesRegex(StockholmFormatError,
r'Line contains 3.*must contain.*4.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_malformed_gr_line_error(self):
fp = get_data_path('stockholm_malformed_gr_line')
with self.assertRaisesRegex(StockholmFormatError,
r'Line contains 2.*must contain.*4.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_malformed_gc_line_error(self):
fp = get_data_path('stockholm_malformed_gc_line')
with self.assertRaisesRegex(StockholmFormatError,
r'Line contains 2.*must contain.*3.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_malformed_data_line_error(self):
fp = get_data_path('stockholm_malformed_data_line')
with self.assertRaisesRegex(StockholmFormatError,
r'Line contains 1.*must contain.*2.'):
_stockholm_to_tabular_msa(fp, constructor=DNA)
def test_differing_sequence_lengths_error(self):
fp = get_data_path('stockholm_differing_seq_lengths')
with self.assertRaisesRegex(ValueError, r'Each sequence.*11 != 10'):
_stockholm_to_tabular_msa(fp, constructor=RNA)
def test_differing_data_lengths_gr_error(self):
fp = get_data_path('stockholm_differing_gr_data_length')
with self.assertRaisesRegex(ValueError, r'Number.*7.*(8).'):
_stockholm_to_tabular_msa(fp, constructor=RNA)
def test_differing_data_lengths_gc_error(self):
fp = get_data_path('stockholm_differing_gc_data_length')
with self.assertRaisesRegex(ValueError, r'Number.*12.*(10).'):
_stockholm_to_tabular_msa(fp, constructor=RNA)
def test_no_constructor_error(self):
fp = get_data_path('empty')
with self.assertRaisesRegex(ValueError, r'Must provide.*parameter.'):
_stockholm_to_tabular_msa(fp)
def test_unsupported_constructor_error(self):
fp = get_data_path('empty')
with self.assertRaisesRegex(TypeError,
r'`constructor`.*`GrammaredSequence`.'):
_stockholm_to_tabular_msa(fp, constructor=TabularMSA)
class TestStockholmWriter(unittest.TestCase):
def test_msa_to_stockholm_extensive(self):
fp = get_data_path('stockholm_all_data_types')
msa = TabularMSA([DNA('GAGGCCATGCCCAGGTGAAG',
metadata=OrderedDict([('DT', 'February 1, 2016'),
('NM', 'Unknown')])),
DNA('ACCTGAGCCACAGTAGAAGT'),
DNA('CCCTTCGCTGGAAATGTATG',
metadata={'DT': 'Unknown'},
positional_metadata=OrderedDict([('AS',
list('CCGAAAGT'
'CGTTCGA'
'AAATG')),
('SS',
list('GGCGAGTC'
'GTTCGAGC'
'TGG'
'C'))]))],
metadata=OrderedDict([('NM', 'Kestrel Gorlick'),
('DT', 'February 11, 2016'),
('FN', 'Writer test file')]),
positional_metadata=OrderedDict([('AS_cons',
list('CGTTCGTTCTAAC'
'AATTCCA')),
('SS_cons',
list('GGCGCTACGACCT'
'ACGACCG'))]),
index=['seq1', 'seq2', 'seq3'])
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_minimal(self):
fp = get_data_path('stockholm_minimal')
msa = TabularMSA([DNA('TGTGTCGCAGTTGTCGTTTG')], index=['0235244'])
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_single_tree(self):
fp = get_data_path('stockholm_single_tree_without_id')
msa = TabularMSA([], metadata=OrderedDict([('NH', 'ABCD')]))
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_single_tree_as_dict(self):
fp = get_data_path('stockholm_single_tree_with_id')
msa = TabularMSA([], metadata={'NH': {'tree1': 'ABCD'}})
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_multiple_trees(self):
fp = get_data_path('stockholm_multiple_trees')
msa = TabularMSA([], metadata=OrderedDict([('NH',
OrderedDict([('tree1',
'ABCD'),
('tree2',
'EFGH'),
('tree3',
'IJKL')]))]))
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_single_reference(self):
fp = get_data_path('stockholm_single_reference')
msa = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RM', '123456789'),
('RT', 'A Title'),
('RA', 'The Author'),
('RL', 'A Location'),
('RC', 'Comment')])]})
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_multiple_references(self):
fp = get_data_path('stockholm_multiple_references')
msa = TabularMSA(
[],
metadata={'RN': [OrderedDict([('RM', '123456789'),
('RT', 'Title 1'),
('RA', 'Author 1'),
('RL', 'Location 1'),
('RC', 'Comment 1')]),
OrderedDict([('RM', '987654321'),
('RT', 'Title 2'),
('RA', 'Author 2'),
('RL', 'Location 2'),
('RC', 'Comment 2')]),
OrderedDict([('RM', '132465879'),
('RT', 'Title 3'),
('RA', 'Author 3'),
('RL', 'Location 3'),
('RC', 'Comment 3')])]})
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_data_only(self):
fp = get_data_path('stockholm_data_only')
msa = TabularMSA([RNA('ACUCCGACAUGCUCC'),
RNA('UAGUGCCGAACGCUG'),
RNA('GUGUGGGCGUGAUUC')],
index=['seq1', 'seq2', 'seq3'])
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_nonstring_values(self):
fp = get_data_path('stockholm_nonstring_labels')
msa = TabularMSA([DNA('ACTG', metadata=OrderedDict([(8, 123)]),
positional_metadata=OrderedDict([(1.0,
[1, 2, 3, 4])])
)],
metadata=OrderedDict([(1.3, 2857)]),
positional_metadata=OrderedDict([(25, [4, 3, 2, 1])]),
index=[11214])
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_msa_to_stockholm_empty(self):
fp = get_data_path('stockholm_no_data')
msa = TabularMSA([])
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_extensive(self):
fp = get_data_path('stockholm_extensive')
msa = _stockholm_to_tabular_msa(fp, constructor=Protein)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_minimal(self):
fp = get_data_path('stockholm_minimal')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_single_tree(self):
fp = get_data_path('stockholm_single_tree_without_id')
msa = _stockholm_to_tabular_msa(fp, constructor=Protein)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_multiple_trees(self):
fp = get_data_path('stockholm_multiple_trees')
msa = _stockholm_to_tabular_msa(fp, constructor=Protein)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_single_reference(self):
fp = get_data_path('stockholm_single_reference')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_multiple_references(self):
fp = get_data_path('stockholm_multiple_references')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_missing_references(self):
fp = get_data_path('stockholm_missing_reference_items')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_data_only(self):
fp = get_data_path('stockholm_data_only')
msa = _stockholm_to_tabular_msa(fp, constructor=RNA)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_nonstring_index_values(self):
fp = get_data_path('stockholm_nonstring_labels')
msa = _stockholm_to_tabular_msa(fp, constructor=DNA)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_round_trip_empty(self):
fp = get_data_path('stockholm_no_data')
msa = _stockholm_to_tabular_msa(fp, constructor=Protein)
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
obs = fh.getvalue()
fh.close()
with io.open(fp) as fh:
exp = fh.read()
self.assertEqual(obs, exp)
def test_unoriginal_index_error(self):
msa = TabularMSA([DNA('ATCGCCAGCT'), DNA('TTGTGCTGGC')],
index=['seq1', 'seq1'])
with self.assertRaisesRegex(StockholmFormatError,
r'index labels must be unique.'):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
def test_unoriginal_gr_feature_names_error(self):
pos_metadata_dataframe = pd.DataFrame(
[
list('GAGCAAGCCACTAGA'),
list('TCCTTGAACTACCCG'),
list('TCAGCTCTGCAGCGT'),
list('GTCAGGCGCTCGGTG')
],
index=['AC', 'SS', 'AS', 'AC']
).T
msa = TabularMSA([DNA('CGTCAATCTCGAACT',
positional_metadata=pos_metadata_dataframe)],
index=['seq1'])
with self.assertRaisesRegex(StockholmFormatError,
r'Sequence-specific positional metadata.*'
'must be unique. Found 1 duplicate'):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
def test_unoriginal_gc_feature_names_error(self):
pos_metadata_dataframe = pd.DataFrame(
[
list('GAGCAAGCCACTAGA'),
list('TCCTTGAACTACCCG'),
list('TCAGCTCTGCAGCGT'),
list('GTCAGGCGCTCGGTG')
],
index=['AC', 'SS', 'SS', 'AC']
).T
msa = TabularMSA([DNA('CCCCTGCTTTCGTAG')],
positional_metadata=pos_metadata_dataframe)
with self.assertRaisesRegex(StockholmFormatError,
r'Multiple sequence alignment positional '
'metadata.*must be unique. Found 2 '
'duplicate'):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
def test_gr_wrong_dataframe_item_length_error(self):
seq1 = list('GAGCAAGCCACTAGA')
seq1.append('GG')
pos_metadata_dataframe = pd.DataFrame({'AC': seq1,
'SS': list('TCCTTGAACTACCCGA'),
'AS': list('TCAGCTCTGCAGCGTT')})
msa = TabularMSA([DNA('TCCTTGAACTACCCGA',
positional_metadata=pos_metadata_dataframe)])
with self.assertRaisesRegex(StockholmFormatError,
r'Sequence-specific positional metadata.*'
r'must contain a single character.*Found '
r'value\(s\) in column AC'):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
def test_gc_wrong_dataframe_item_length_error(self):
seq1 = list('GAGCAAGCCACTAGA')
seq1.append('GG')
pos_metadata_dataframe = pd.DataFrame({'AC': seq1,
'SS': list('TCCTTGAACTACCCGA'),
'AS': list('TCAGCTCTGCAGCGTT')})
msa = TabularMSA([DNA('TCCTTGAACTACCCGA')],
positional_metadata=pos_metadata_dataframe)
message = (r'Multiple sequence alignment positional metadata.*must '
r'contain a single character.*Found value\(s\) in column '
'AC')
with self.assertRaisesRegex(StockholmFormatError, message):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
def test_rn_not_list_of_refs_error(self):
msa = TabularMSA([], metadata={'RN': '1'})
with self.assertRaisesRegex(StockholmFormatError,
r"Expected 'RN'.*list of reference"
".*got '1'"):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
def test_rn_data_not_in_dict_error(self):
msa = TabularMSA([], metadata={'RN': [OrderedDict([('RL',
'Flagstaff')]),
'Incorrect Item']})
with self.assertRaisesRegex(StockholmFormatError,
r"Expected reference information.*stored"
" as a dictionary, found.*2 stored as "
"'str'"):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
def test_invalid_reference_tag_error(self):
msa = TabularMSA([], metadata={'RN': [OrderedDict([('RL', 'Flagstaff'),
('foo', 'bar')])]})
with self.assertRaisesRegex(StockholmFormatError,
r"Invalid reference.*foo' found "
"in.*1.*Valid reference tags are:"):
fh = io.StringIO()
_tabular_msa_to_stockholm(msa, fh)
if __name__ == '__main__':
unittest.main()
|