1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040 2041 2042 2043 2044 2045 2046 2047 2048 2049 2050 2051 2052 2053 2054 2055 2056 2057 2058 2059 2060 2061 2062 2063 2064 2065 2066 2067 2068 2069 2070 2071 2072 2073 2074 2075 2076 2077 2078 2079 2080 2081 2082 2083 2084 2085 2086 2087 2088 2089 2090 2091 2092 2093 2094 2095 2096 2097 2098 2099 2100 2101 2102 2103 2104 2105 2106 2107 2108 2109 2110 2111 2112 2113 2114 2115 2116 2117 2118 2119 2120 2121 2122 2123 2124 2125 2126 2127 2128 2129 2130 2131 2132 2133 2134 2135 2136 2137 2138 2139 2140 2141 2142 2143 2144 2145 2146 2147 2148 2149 2150 2151 2152 2153 2154 2155 2156 2157 2158 2159 2160 2161 2162 2163 2164 2165 2166 2167 2168 2169 2170 2171 2172 2173 2174 2175 2176 2177 2178 2179 2180 2181 2182 2183 2184 2185 2186 2187 2188 2189 2190 2191 2192 2193 2194 2195 2196 2197 2198 2199 2200 2201 2202 2203 2204 2205 2206 2207 2208 2209 2210 2211 2212 2213 2214 2215 2216 2217 2218 2219 2220 2221 2222 2223 2224 2225 2226 2227 2228 2229 2230 2231 2232 2233 2234 2235 2236 2237 2238 2239 2240 2241 2242 2243 2244 2245 2246 2247 2248 2249 2250 2251 2252 2253 2254 2255 2256 2257 2258 2259 2260 2261 2262 2263 2264 2265 2266 2267 2268 2269 2270 2271 2272 2273 2274 2275 2276 2277 2278 2279 2280 2281 2282 2283 2284 2285 2286 2287 2288 2289 2290 2291 2292 2293 2294 2295 2296 2297 2298 2299 2300 2301 2302 2303 2304 2305 2306 2307 2308 2309 2310 2311 2312 2313 2314 2315 2316 2317 2318 2319 2320 2321 2322 2323 2324 2325 2326 2327 2328 2329 2330 2331 2332 2333 2334 2335 2336 2337 2338 2339 2340 2341 2342 2343 2344 2345 2346 2347 2348 2349 2350 2351 2352 2353 2354 2355 2356 2357 2358 2359 2360 2361 2362 2363 2364 2365 2366 2367 2368 2369 2370 2371 2372 2373 2374 2375 2376 2377 2378 2379 2380 2381 2382 2383 2384 2385 2386 2387 2388 2389 2390 2391 2392 2393 2394 2395 2396 2397 2398 2399 2400 2401 2402 2403 2404 2405 2406 2407 2408 2409 2410 2411
|
# ----------------------------------------------------------------------------
# Copyright (c) 2013--, scikit-bio development team.
#
# Distributed under the terms of the Modified BSD License.
#
# The full license is in the file LICENSE.txt, distributed with this software.
# ----------------------------------------------------------------------------
import re
import collections
import numbers
from contextlib import contextmanager
import numpy as np
import pandas as pd
import skbio.sequence.distance
from skbio._base import SkbioObject
from skbio.metadata._mixin import (
MetadataMixin,
PositionalMetadataMixin,
IntervalMetadataMixin,
)
from skbio.metadata import IntervalMetadata
from skbio.sequence._repr import _SequenceReprBuilder
from skbio.sequence._alphabet import (
_alphabet_to_hashes,
_indices_in_alphabet_ascii,
_indices_in_observed,
)
from skbio.util import find_duplicates
from skbio.util._decorator import classonlymethod, overrides
from skbio.io.registry import Read, Write
class Sequence(
MetadataMixin,
PositionalMetadataMixin,
IntervalMetadataMixin,
collections.abc.Sequence,
SkbioObject,
):
"""Store generic sequence data and optional associated metadata.
``Sequence`` objects do not enforce an alphabet or grammar and are thus the
most generic objects for storing sequence data. ``Sequence`` objects do not
necessarily represent biological sequences. For example, ``Sequence`` can
be used to represent a position in a multiple sequence alignment.
Subclasses ``DNA``, ``RNA``, and ``Protein`` enforce the IUPAC character
set [1]_ for, and provide operations specific to, each respective molecule
type.
``Sequence`` objects consist of the underlying sequence data, as well
as optional metadata and positional metadata. The underlying sequence
is immutable, while the metdata and positional metadata are mutable.
Parameters
----------
sequence : str, Sequence, or 1D np.ndarray (np.uint8 or '\\|S1')
Characters representing the sequence itself.
metadata : dict, optional
Arbitrary metadata which applies to the entire sequence. A shallow copy
of the ``dict`` will be made (see Examples section below for details).
positional_metadata : pd.DataFrame consumable, optional
Arbitrary per-character metadata (e.g., sequence read quality
scores). Must be able to be passed directly to ``pd.DataFrame``
constructor. Each column of metadata must be the same length as
`sequence`. A shallow copy of the positional metadata will be made if
necessary (see Examples section below for details).
interval_metadata : IntervalMetadata
Arbitrary metadata which applies to intervals within a sequence to
store interval features (such as genes, ncRNA on the sequence).
lowercase : bool or str, optional
If ``True``, lowercase sequence characters will be converted to
uppercase characters. If ``False``, no characters will be converted.
If a str, it will be treated as a key into the positional metadata of
the object. All lowercase characters will be converted to uppercase,
and a ``True`` value will be stored in a boolean array in the
positional metadata under the key.
See Also
--------
DNA
RNA
Protein
References
----------
.. [1] Nomenclature for incompletely specified bases in nucleic acid
sequences: recommendations 1984.
Nucleic Acids Res. May 10, 1985; 13(9): 3021-3030.
A Cornish-Bowden
Examples
--------
>>> from skbio import Sequence
>>> from skbio.metadata import IntervalMetadata
**Creating sequences:**
Create a sequence without any metadata:
>>> seq = Sequence('GGUCGUGAAGGA')
>>> seq
Sequence
---------------
Stats:
length: 12
---------------
0 GGUCGUGAAG GA
Create a sequence with metadata and positional metadata:
>>> metadata = {'authors': ['Alice'], 'desc':'seq desc', 'id':'seq-id'}
>>> positional_metadata = {'exons': [True, True, False, True],
... 'quality': [3, 3, 4, 10]}
>>> interval_metadata = IntervalMetadata(4)
>>> interval = interval_metadata.add([(1, 3)], metadata={'gene': 'sagA'})
>>> seq = Sequence('ACGT', metadata=metadata,
... positional_metadata=positional_metadata,
... interval_metadata=interval_metadata)
>>> seq
Sequence
-----------------------------
Metadata:
'authors': <class 'list'>
'desc': 'seq desc'
'id': 'seq-id'
Positional metadata:
'exons': <dtype: bool>
'quality': <dtype: int64>
Interval metadata:
1 interval feature
Stats:
length: 4
-----------------------------
0 ACGT
**Retrieving underlying sequence data:**
Retrieve underlying sequence:
>>> seq.values # doctest: +NORMALIZE_WHITESPACE
array([b'A', b'C', b'G', b'T'],
dtype='|S1')
Underlying sequence immutable:
>>> values = np.array([b'T', b'C', b'G', b'A'], dtype='|S1')
>>> seq.values = values # doctest: +SKIP
Traceback (most recent call last):
...
AttributeError: can't set attribute
>>> seq.values[0] = b'T'
Traceback (most recent call last):
...
ValueError: assignment destination is read-only
**Retrieving sequence metadata:**
Retrieve metadata:
>>> seq.metadata
{'authors': ['Alice'], 'desc': 'seq desc', 'id': 'seq-id'}
Retrieve positional metadata:
>>> seq.positional_metadata
exons quality
0 True 3
1 True 3
2 False 4
3 True 10
Retrieve interval metadata:
>>> seq.interval_metadata # doctest: +ELLIPSIS
1 interval feature
------------------
Interval(interval_metadata=<...>, bounds=[(1, 3)], \
fuzzy=[(False, False)], metadata={'gene': 'sagA'})
**Updating sequence metadata:**
.. warning:: Be aware that a shallow copy of ``metadata`` and
``positional_metadata`` is made for performance. Since a deep copy is
not made, changes made to mutable Python objects stored as metadata may
affect the metadata of other ``Sequence`` objects or anything else that
shares a reference to the object. The following examples illustrate this
behavior.
First, let's create a sequence and update its metadata:
>>> metadata = {'id': 'seq-id', 'desc': 'seq desc', 'authors': ['Alice']}
>>> seq = Sequence('ACGT', metadata=metadata)
>>> seq.metadata['id'] = 'new-id'
>>> seq.metadata['pubmed'] = 12345
>>> seq.metadata
{'id': 'new-id', 'desc': 'seq desc', 'authors': ['Alice'], 'pubmed': 12345}
Note that the original metadata dictionary (stored in variable
``metadata``) hasn't changed because a shallow copy was made:
>>> metadata
{'id': 'seq-id', 'desc': 'seq desc', 'authors': ['Alice']}
>>> seq.metadata == metadata
False
Note however that since only a *shallow* copy was made, updates to mutable
objects will also change the original metadata dictionary:
>>> seq.metadata['authors'].append('Bob')
>>> seq.metadata['authors']
['Alice', 'Bob']
>>> metadata['authors']
['Alice', 'Bob']
This behavior can also occur when manipulating a sequence that has been
derived from another sequence:
>>> subseq = seq[1:3]
>>> subseq
Sequence
-----------------------------
Metadata:
'authors': <class 'list'>
'desc': 'seq desc'
'id': 'new-id'
'pubmed': 12345
Stats:
length: 2
-----------------------------
0 CG
>>> subseq.metadata
{'id': 'new-id', 'desc': 'seq desc', 'authors': ['Alice', 'Bob'], \
'pubmed': 12345}
The subsequence has inherited the metadata of its parent sequence. If we
update the subsequence's author list, we see the changes propagated in the
parent sequence and original metadata dictionary:
>>> subseq.metadata['authors'].append('Carol')
>>> subseq.metadata['authors']
['Alice', 'Bob', 'Carol']
>>> seq.metadata['authors']
['Alice', 'Bob', 'Carol']
>>> metadata['authors']
['Alice', 'Bob', 'Carol']
The behavior for updating positional metadata is similar. Let's create a
new sequence with positional metadata that is already stored in a
``pd.DataFrame``:
>>> positional_metadata = pd.DataFrame(
... {'list': [[], [], [], []], 'quality': [3, 3, 4, 10]})
>>> seq = Sequence('ACGT', positional_metadata=positional_metadata)
>>> seq
Sequence
-----------------------------
Positional metadata:
'list': <dtype: object>
'quality': <dtype: int64>
Stats:
length: 4
-----------------------------
0 ACGT
>>> seq.positional_metadata
list quality
0 [] 3
1 [] 3
2 [] 4
3 [] 10
Now let's update the sequence's positional metadata by adding a new column
and changing a value in another column:
>>> seq.positional_metadata['gaps'] = [False, False, False, False]
>>> seq.positional_metadata.loc[0, 'quality'] = 999
>>> seq.positional_metadata
list quality gaps
0 [] 999 False
1 [] 3 False
2 [] 4 False
3 [] 10 False
Note that the original positional metadata (stored in variable
``positional_metadata``) hasn't changed because a shallow copy was made:
>>> positional_metadata
list quality
0 [] 3
1 [] 3
2 [] 4
3 [] 10
>>> seq.positional_metadata.equals(positional_metadata)
False
Next let's create a sequence that has been derived from another sequence:
>>> subseq = seq[1:3]
>>> subseq
Sequence
-----------------------------
Positional metadata:
'list': <dtype: object>
'quality': <dtype: int64>
'gaps': <dtype: bool>
Stats:
length: 2
-----------------------------
0 CG
>>> subseq.positional_metadata
list quality gaps
0 [] 3 False
1 [] 4 False
As described above for metadata, since only a *shallow* copy was made of
the positional metadata, updates to mutable objects will also change the
parent sequence's positional metadata and the original positional metadata
``pd.DataFrame``:
>>> subseq.positional_metadata.loc[0, 'list'].append('item')
>>> subseq.positional_metadata
list quality gaps
0 [item] 3 False
1 [] 4 False
>>> seq.positional_metadata
list quality gaps
0 [] 999 False
1 [item] 3 False
2 [] 4 False
3 [] 10 False
>>> positional_metadata
list quality
0 [] 3
1 [item] 3
2 [] 4
3 [] 10
You can also update the interval metadata. Let's re-create a
``Sequence`` object with interval metadata at first:
>>> seq = Sequence('ACGT')
>>> interval = seq.interval_metadata.add(
... [(1, 3)], metadata={'gene': 'foo'})
You can update directly on the ``Interval`` object:
>>> interval # doctest: +ELLIPSIS
Interval(interval_metadata=<...>, bounds=[(1, 3)], \
fuzzy=[(False, False)], metadata={'gene': 'foo'})
>>> interval.bounds = [(0, 2)]
>>> interval # doctest: +ELLIPSIS
Interval(interval_metadata=<...>, bounds=[(0, 2)], \
fuzzy=[(False, False)], metadata={'gene': 'foo'})
You can also query and obtain the interval features you are
interested and then modify them:
>>> intervals = list(seq.interval_metadata.query(metadata={'gene': 'foo'}))
>>> intervals[0].fuzzy = [(True, False)]
>>> print(intervals[0]) # doctest: +ELLIPSIS
Interval(interval_metadata=<...>, bounds=[(0, 2)], \
fuzzy=[(True, False)], metadata={'gene': 'foo'})
"""
read = Read()
write = Write()
_num_ascii_codes = 128
_num_extended_ascii_codes = 256
# ASCII is built such that the difference between uppercase and lowercase
# is the 6th bit.
_ascii_invert_case_bit_offset = 32
_ascii_lowercase_boundary = 90
default_write_format = "fasta"
__hash__ = None
@property
def values(self):
r"""Array containing underlying sequence characters.
Notes
-----
This property is not writeable.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('AACGA')
>>> s.values # doctest: +NORMALIZE_WHITESPACE
array([b'A', b'A', b'C', b'G', b'A'],
dtype='|S1')
"""
return self._bytes.view("|S1")
@property
def __array_interface__(self):
r"""Array interface for compatibility with numpy.
This property allows a ``Sequence`` object to share its underlying data
buffer (``Sequence.values``) with numpy. See [1]_ for more details.
References
----------
.. [1] http://docs.scipy.org/doc/numpy/reference/arrays.interface.html
Examples
--------
>>> import numpy as np
>>> from skbio import Sequence
>>> seq = Sequence('ABC123')
>>> np.asarray(seq) # doctest: +NORMALIZE_WHITESPACE
array([b'A', b'B', b'C', b'1', b'2', b'3'],
dtype='|S1')
"""
return self.values.__array_interface__
@property
def observed_chars(self):
r"""Set of observed characters in the sequence.
Notes
-----
This property is not writeable.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('AACGAC')
>>> s.observed_chars == {'G', 'A', 'C'}
True
"""
return set(str(self))
@property
def _string(self):
return self._bytes.tobytes()
@classonlymethod
def concat(cls, sequences, how="strict"):
r"""Concatenate an iterable of ``Sequence`` objects.
Parameters
----------
sequences : iterable (Sequence)
An iterable of ``Sequence`` objects or appropriate subclasses.
how : {'strict', 'inner', 'outer'}, optional
How to intersect the `positional_metadata` of the sequences.
If 'strict': the `positional_metadata` must have the exact same
columns; 'inner': an inner-join of the columns (only the shared set
of columns are used); 'outer': an outer-join of the columns
(all columns are used: missing values will be padded with NaN).
Returns
-------
Sequence
The returned sequence will be an instance of the class which
called this class-method.
Raises
------
ValueError
If `how` is not one of: 'strict', 'inner', or 'outer'.
ValueError
If `how` is 'strict' and the `positional_metadata` of each sequence
does not have the same columns.
TypeError
If the sequences cannot be cast as the calling class.
Notes
-----
The sequence-wide metadata (``Sequence.metadata``) is not retained
during concatenation.
Sequence objects can be cast to a different type only when the new
type is an ancestor or child of the original type. Casting between
sibling types is not allowed, e.g. ``DNA`` -> ``RNA`` is not
allowed, but ``DNA`` -> ``Sequence`` or ``Sequence`` -> ``DNA``
would be.
Examples
--------
Concatenate two DNA sequences into a new DNA object:
>>> from skbio import DNA, Sequence
>>> s1 = DNA("ACGT")
>>> s2 = DNA("GGAA")
>>> DNA.concat([s1, s2])
DNA
--------------------------
Stats:
length: 8
has gaps: False
has degenerates: False
has definites: True
GC-content: 50.00%
--------------------------
0 ACGTGGAA
Concatenate DNA sequences into a Sequence object (type coercion):
>>> Sequence.concat([s1, s2])
Sequence
-------------
Stats:
length: 8
-------------
0 ACGTGGAA
Positional metadata is conserved:
>>> s1 = DNA('AcgT', lowercase='one')
>>> s2 = DNA('GGaA', lowercase='one',
... positional_metadata={'two': [1, 2, 3, 4]})
>>> result = DNA.concat([s1, s2], how='outer')
>>> result
DNA
---------------------------
Positional metadata:
'one': <dtype: bool>
'two': <dtype: float64>
Stats:
length: 8
has gaps: False
has degenerates: False
has definites: True
GC-content: 50.00%
---------------------------
0 ACGTGGAA
>>> result.positional_metadata
one two
0 False NaN
1 True NaN
2 True NaN
3 False NaN
4 False 1.0
5 False 2.0
6 True 3.0
7 False 4.0
"""
if how not in {"strict", "inner", "outer"}:
raise ValueError("`how` must be 'strict', 'inner', or 'outer'.")
seqs = list(sequences)
if len(seqs) == 0:
return cls("")
for seq in seqs:
seq._assert_can_cast_to(cls)
if how == "strict":
how = "inner"
cols = set()
for s in seqs:
if s.has_positional_metadata():
cols.add(frozenset(s.positional_metadata))
else:
cols.add(frozenset())
if len(cols) > 1:
raise ValueError(
"The positional metadata of the sequences do"
" not have matching columns. Consider setting"
" how='inner' or how='outer'"
)
seq_data = []
pm_data = []
for seq in seqs:
seq_data.append(seq._bytes)
pm_data.append(seq.positional_metadata)
if not seq.has_positional_metadata():
del seq.positional_metadata
pm = pd.concat(pm_data, join=how, ignore_index=True, sort=True)
bytes_ = np.concatenate(seq_data)
im = IntervalMetadata.concat(i.interval_metadata for i in seqs)
return cls(bytes_, positional_metadata=pm, interval_metadata=im)
@classmethod
def _assert_can_cast_to(cls, target):
if not (issubclass(cls, target) or issubclass(target, cls)):
raise TypeError("Cannot cast %r as %r." % (cls.__name__, target.__name__))
@overrides(PositionalMetadataMixin)
def _positional_metadata_axis_len_(self):
return len(self)
@overrides(IntervalMetadataMixin)
def _interval_metadata_axis_len_(self):
return len(self)
def __init__(
self,
sequence,
metadata=None,
positional_metadata=None,
interval_metadata=None,
lowercase=False,
):
if isinstance(sequence, np.ndarray):
if sequence.dtype == np.uint8:
self._set_bytes_contiguous(sequence)
elif sequence.dtype == "|S1":
sequence = sequence.view(np.uint8)
# Guarantee the sequence is an array (might be scalar before
# this).
if sequence.shape == ():
sequence = np.array([sequence], dtype=np.uint8)
self._set_bytes_contiguous(sequence)
else:
raise TypeError(
"Can only create sequence from numpy.ndarray of dtype "
"np.uint8 or '|S1'. Invalid dtype: %s" % sequence.dtype
)
elif isinstance(sequence, Sequence):
# Sequence casting is acceptable between direct
# decendants/ancestors
sequence._assert_can_cast_to(type(self))
if metadata is None and sequence.has_metadata():
metadata = sequence.metadata
if positional_metadata is None and sequence.has_positional_metadata():
positional_metadata = sequence.positional_metadata
if interval_metadata is None and sequence.has_interval_metadata():
interval_metadata = sequence.interval_metadata
sequence = sequence._bytes
self._owns_bytes = False
self._set_bytes(sequence)
else:
# Encode as ascii to raise UnicodeEncodeError if necessary.
if isinstance(sequence, str):
sequence = sequence.encode("ascii")
s = np.frombuffer(sequence, dtype=np.uint8)
# There are two possibilities (to our knowledge) at this point:
# Either the sequence we were given was something string-like,
# (else it would not have made it past frombuffer), or it was a
# numpy scalar, and so our length must be 1.
if isinstance(sequence, np.generic) and len(s) != 1:
raise TypeError(
"Can cannot create a sequence with %r" % type(sequence).__name__
)
sequence = s
self._owns_bytes = False
self._set_bytes(sequence)
MetadataMixin._init_(self, metadata=metadata)
PositionalMetadataMixin._init_(self, positional_metadata=positional_metadata)
IntervalMetadataMixin._init_(self, interval_metadata=interval_metadata)
if lowercase is False:
pass
elif lowercase is True or isinstance(lowercase, str):
lowercase_mask = self._bytes > self._ascii_lowercase_boundary
self._convert_to_uppercase(lowercase_mask)
# If it isn't True, it must be a string_type
if lowercase is not True:
self.positional_metadata[lowercase] = lowercase_mask
else:
raise TypeError(
"lowercase keyword argument expected a bool or "
"string, but got %s" % type(lowercase)
)
def _set_bytes_contiguous(self, sequence):
r"""Munge the sequence data into a numpy array of dtype uint8."""
if not sequence.flags["C_CONTIGUOUS"]:
# numpy doesn't support views of non-contiguous arrays. Since we're
# making heavy use of views internally, and users may also supply
# us with a view, make sure we *always* store a contiguous array to
# avoid hard-to-track bugs. See
# https://github.com/numpy/numpy/issues/5716
sequence = np.ascontiguousarray(sequence)
self._owns_bytes = True
else:
self._owns_bytes = False
self._set_bytes(sequence)
def _set_bytes(self, sequence):
sequence.flags.writeable = False
self._bytes = sequence
def _convert_to_uppercase(self, lowercase):
if np.any(lowercase):
with self._byte_ownership():
self._bytes[lowercase] ^= self._ascii_invert_case_bit_offset
def __contains__(self, subsequence):
r"""Determine if a subsequence is contained in this sequence.
Parameters
----------
subsequence : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
The putative subsequence.
Returns
-------
bool
Indicates whether `subsequence` is contained in this sequence.
Raises
------
TypeError
If `subsequence` is a ``Sequence`` object with a different type
than this sequence.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUCGUGAAGGA')
>>> 'GGU' in s
True
>>> 'CCC' in s
False
"""
return self._munge_to_bytestring(subsequence, "in") in self._string
def __eq__(self, other):
r"""Determine if this sequence is equal to another.
Sequences are equal if they are *exactly* the same type and their
sequence characters, metadata, and positional metadata are the same.
Parameters
----------
other : Sequence
Sequence to test for equality against.
Returns
-------
bool
Indicates whether this sequence is equal to `other`.
Examples
--------
Define two ``Sequence`` objects that have the same underlying sequence
of characters:
>>> from skbio import Sequence
>>> s = Sequence('ACGT')
>>> t = Sequence('ACGT')
The two sequences are considered equal because they are the same type,
their underlying sequence of characters are the same, and their
optional metadata attributes (``metadata`` and ``positional_metadata``)
were not provided:
>>> s == t
True
>>> t == s
True
Define another sequence object with a different sequence of characters
than the previous two sequence objects:
>>> u = Sequence('ACGA')
>>> u == t
False
Define a sequence with the same sequence of characters as ``u`` but
with different metadata, positional metadata, and interval metadata:
>>> v = Sequence('ACGA', metadata={'id': 'abc'},
... positional_metadata={'quality':[1, 5, 3, 3]})
>>> _ = v.interval_metadata.add([(0, 1)])
The two sequences are not considered equal because their metadata,
positional metadata, and interval metadata do not match:
>>> u == v
False
"""
# checks ordered from least to most expensive
if self.__class__ != other.__class__:
return False
if not MetadataMixin._eq_(self, other):
return False
if self._string != other._string:
return False
if not PositionalMetadataMixin._eq_(self, other):
return False
if not IntervalMetadataMixin._eq_(self, other):
return False
return True
def __ne__(self, other):
r"""Determine if this sequence is not equal to another.
Sequences are not equal if they are not *exactly* the same type, or
their sequence characters, metadata, or positional metadata differ.
Parameters
----------
other : Sequence
Sequence to test for inequality against.
Returns
-------
bool
Indicates whether this sequence is not equal to `other`.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('ACGT')
>>> t = Sequence('ACGT')
>>> s != t
False
>>> u = Sequence('ACGA')
>>> u != t
True
>>> v = Sequence('ACGA', metadata={'id': 'v'})
>>> u != v
True
"""
return not (self == other)
def __getitem__(self, indexable):
r"""Slice this sequence.
Notes
-----
This drops the ``self.interval_metadata`` from the returned
new ``Sequence`` object.
Parameters
----------
indexable : int, slice, iterable (int and slice), 1D array_like (bool)
The position(s) to return from this sequence. If `indexable` is an
iterable of integers, these are assumed to be indices in the
sequence to keep. If `indexable` is a 1D ``array_like`` of
booleans, these are assumed to be the positions in the sequence to
keep.
Returns
-------
Sequence
New sequence containing the position(s) specified by `indexable` in
this sequence. Positional metadata will be sliced in the same
manner and included in the returned sequence. `metadata` is
included in the returned sequence.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUCGUGAAGGA')
Obtain a single character from the sequence:
>>> s[1]
Sequence
-------------
Stats:
length: 1
-------------
0 G
Obtain a slice:
>>> s[7:]
Sequence
-------------
Stats:
length: 5
-------------
0 AAGGA
Obtain characters at the following indices:
>>> s[[3, 4, 7, 0, 3]]
Sequence
-------------
Stats:
length: 5
-------------
0 CGAGC
Obtain characters at positions evaluating to `True`:
>>> s = Sequence('GGUCG')
>>> index = [True, False, True, 'a' == 'a', False]
>>> s[index]
Sequence
-------------
Stats:
length: 3
-------------
0 GUC
"""
if not isinstance(indexable, np.ndarray) and (
(not isinstance(indexable, str)) and hasattr(indexable, "__iter__")
):
indexable_ = indexable
indexable = np.asarray(indexable)
if indexable.dtype == object:
indexable = list(indexable_) # TODO: Don't blow out memory
if len(indexable) == 0:
# indexing with an empty list, so convert to ndarray and
# fall through to ndarray slicing below
indexable = np.asarray(indexable)
else:
seq = np.concatenate(
list(_slices_from_iter(self._bytes, indexable))
)
index = _as_slice_if_single_index(indexable)
positional_metadata = None
if self.has_positional_metadata():
pos_md_slices = list(
_slices_from_iter(self.positional_metadata, index)
)
positional_metadata = pd.concat(pos_md_slices, sort=True)
metadata = None
if self.has_metadata():
metadata = self.metadata
return self._constructor(
sequence=seq,
metadata=metadata,
positional_metadata=positional_metadata,
)
elif isinstance(indexable, str) or isinstance(indexable, bool):
raise IndexError(
"Cannot index with %s type: %r" % (type(indexable).__name__, indexable)
)
if (
isinstance(indexable, np.ndarray)
and indexable.dtype == bool
and len(indexable) != len(self)
):
raise IndexError(
"An boolean vector index must be the same length"
" as the sequence (%d, not %d)." % (len(self), len(indexable))
)
if isinstance(indexable, np.ndarray) and indexable.size == 0:
# convert an empty ndarray to a supported dtype for slicing a numpy
# array
indexable = indexable.astype(int)
seq = self._bytes[indexable]
positional_metadata = self._slice_positional_metadata(indexable)
metadata = None
if self.has_metadata():
metadata = self.metadata
return self._constructor(
sequence=seq,
metadata=metadata,
positional_metadata=positional_metadata,
)
def _slice_positional_metadata(self, indexable):
if self.has_positional_metadata():
if _is_single_index(indexable):
index = _single_index_to_slice(indexable)
else:
index = indexable
return self.positional_metadata.iloc[index]
else:
return None
def __len__(self):
r"""Return the number of characters in this sequence.
Returns
-------
int
The length of this sequence.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> len(s)
4
"""
return self._bytes.size
def __bool__(self):
r"""Return truth value (truthiness) of sequence.
Returns
-------
bool
True if length of sequence is greater than 0, else False.
Examples
--------
>>> from skbio import Sequence
>>> bool(Sequence(''))
False
>>> bool(Sequence('ACGT'))
True
"""
return len(self) > 0
def __iter__(self):
r"""Iterate over positions in this sequence.
Yields
------
Sequence
Single character subsequence, one for each position in the
sequence.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> for c in s:
... str(c)
'G'
'G'
'U'
'C'
"""
for i in range(len(self)):
yield self[i]
def __reversed__(self):
r"""Iterate over positions in this sequence in reverse order.
Yields
------
Sequence
Single character subsequence, one for each position in the
sequence.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> for c in reversed(s):
... str(c)
'C'
'U'
'G'
'G'
"""
return iter(self[::-1])
def __str__(self):
r"""Return sequence characters as a string.
Returns
-------
str
Sequence characters as a string. No metadata or positional
metadata will be included.
See Also
--------
sequence
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUCGUAAAGGA', metadata={'id':'hello'})
>>> str(s)
'GGUCGUAAAGGA'
"""
return str(self._string.decode("ascii"))
def __repr__(self):
r"""Return a string representation of this sequence object.
Representation includes:
* sequence type
* metadata keys and values: will display key/value if it is an
understood type, otherwise just the type will be displayed. If it is
an understood type whose representation is too long, just the type
will be displayed
* positional metadata: column names and column dtypes will be displayed
in the order they appear in the positional metadata ``pd.DataFrame``.
Column names (i.e., keys) follow the same display rules as metadata
keys
* interval metadata: the number of interval features will be displayed.
* sequence stats (e.g., length)
* up to five lines of chunked sequence data. Each line of chunked
sequence data displays the current position in the sequence
Returns
-------
str
String representation of this sequence object.
Notes
-----
Subclasses can override Sequence._repr_stats to provide custom
statistics.
Examples
--------
Short sequence without metadata:
>>> from skbio import Sequence
>>> from skbio.metadata._interval import IntervalMetadata
>>> Sequence('ACGTAATGGATACGTAATGCA')
Sequence
-------------------------
Stats:
length: 21
-------------------------
0 ACGTAATGGA TACGTAATGC A
Longer sequence displays first two lines and last two lines:
>>> Sequence('ACGT' * 100)
Sequence
---------------------------------------------------------------------
Stats:
length: 400
---------------------------------------------------------------------
0 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
60 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
...
300 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
360 ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
Sequence with metadata, positional metadata, and interval metadata:
>>> metadata = {
... 'id': 'seq-id',
... 'description': 'description of the sequence, wrapping across '
... 'lines if it\'s too long',
... 'authors': ['Alice', 'Bob', 'Carol'],
... 'year': 2015,
... 'published': True
... }
>>> positional_metadata = {
... 'exons': [True, True, False, True],
... 'quality': [3, 10, 11, 10]
... }
>>> seq = Sequence('ACGT', metadata=metadata,
... positional_metadata=positional_metadata)
>>> _ = seq.interval_metadata.add([(0, 2)], metadata={'gene': 'sagA'})
>>> seq
Sequence
----------------------------------------------------------------------
Metadata:
'authors': <class 'list'>
'description': "description of the sequence, wrapping across lines
if it's too long"
'id': 'seq-id'
'published': True
'year': 2015
Positional metadata:
'exons': <dtype: bool>
'quality': <dtype: int64>
Interval metadata:
1 interval feature
Stats:
length: 4
----------------------------------------------------------------------
0 ACGT
"""
return _SequenceReprBuilder(
seq=self,
width=71, # 79 for pep8, 8 space indent for docstrings
indent=4,
chunk_size=10,
).build()
def _repr_stats(self):
r"""Define statistics to display in the sequence's repr.
Subclasses can override this method to provide type-specific
statistics.
This method computes a single statistic: length.
Returns
-------
list
List of tuples where each tuple represents a statistic. Each tuple
contains exactly two ``str`` elements: the statistic's name/label,
and the str-formatted value of the statistic. Ordering of
statistics (i.e., list order) determines display order in the
sequence repr.
"""
return [("length", "%d" % len(self))]
def __copy__(self):
r"""Return a shallow copy of this sequence.
See Also
--------
copy
Notes
-----
This method is equivalent to ``seq.copy(deep=False)``.
"""
return self._copy(False, {})
def __deepcopy__(self, memo):
r"""Return a deep copy of this sequence.
See Also
--------
copy
Notes
-----
This method is equivalent to ``seq.copy(deep=True)``.
"""
return self._copy(True, memo)
def _copy(self, deep, memo):
# strategy: copy the sequence without metadata first, then set metadata
# attributes with copies. we take this approach instead of simply
# passing the metadata through the Sequence constructor because we
# don't want to copy twice (this could happen when deep=True, where we
# deep copy here and then shallow copy in the Sequence constructor). we
# also directly set the private metadata attributes instead of using
# their public setters to avoid an unnecessary copy
# we don't make a distinction between deep vs. shallow copy of bytes
# because dtype=np.uint8. we only need to make the distinction when
# dealing with object dtype
bytes_ = np.copy(self._bytes)
seq_copy = self._constructor(
sequence=bytes_,
metadata=None,
positional_metadata=None,
interval_metadata=None,
)
if deep:
seq_copy._metadata = MetadataMixin._deepcopy_(self, memo)
seq_copy._positional_metadata = PositionalMetadataMixin._deepcopy_(
self, memo
)
seq_copy._interval_metadata = IntervalMetadataMixin._deepcopy_(self, memo)
else:
seq_copy._metadata = MetadataMixin._copy_(self)
seq_copy._positional_metadata = PositionalMetadataMixin._copy_(self)
seq_copy._interval_metadata = IntervalMetadataMixin._copy_(self)
return seq_copy
def lowercase(self, lowercase):
r"""Return a case-sensitive string representation of the sequence.
Parameters
----------
lowercase: str or boolean vector
If lowercase is a boolean vector, it is used to set sequence
characters to lowercase in the output string. True values in the
boolean vector correspond to lowercase characters. If lowercase
is a str, it is treated like a key into the positional metadata,
pointing to a column which must be a boolean vector.
That boolean vector is then used as described previously.
Returns
-------
str
String representation of sequence with specified characters set to
lowercase.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('ACGT')
>>> s.lowercase([True, True, False, False])
'acGT'
>>> s = Sequence('ACGT',
... positional_metadata={
... 'exons': [True, False, False, True]})
>>> s.lowercase('exons')
'aCGt'
Constructor automatically populates a column in positional metadata
when the ``lowercase`` keyword argument is provided with a column name:
>>> s = Sequence('ACgt', lowercase='introns')
>>> s.lowercase('introns')
'ACgt'
>>> s = Sequence('ACGT', lowercase='introns')
>>> s.lowercase('introns')
'ACGT'
"""
index = self._munge_to_index_array(lowercase)
outbytes = self._bytes.copy()
outbytes[index] ^= self._ascii_invert_case_bit_offset
return str(outbytes.tobytes().decode("ascii"))
def count(self, subsequence, start=None, end=None):
r"""Count occurrences of a subsequence in this sequence.
Parameters
----------
subsequence : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
Subsequence to count occurrences of.
start : int, optional
The position at which to start counting (inclusive).
end : int, optional
The position at which to stop counting (exclusive).
Returns
-------
int
Number of occurrences of `subsequence` in this sequence.
Raises
------
ValueError
If `subsequence` is of length 0.
TypeError
If `subsequence` is a ``Sequence`` object with a different type
than this sequence.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUCG')
>>> s.count('G')
3
>>> s.count('GG')
1
>>> s.count('T')
0
>>> s.count('G', 2, 5)
1
"""
if len(subsequence) == 0:
raise ValueError("`count` is not defined for empty subsequences.")
return self._string.count(
self._munge_to_bytestring(subsequence, "count"), start, end
)
def replace(self, where, character):
r"""Replace values in this sequence with a different character.
Parameters
----------
where : 1D array_like (bool) or iterable (slices or ints) or str
Indicates positions in the sequence to replace with `character`.
Can be a boolean vector, an iterable of indices/slices, or a
string that is a key in `positional_metadata` pointing to a
boolean vector.
character : str or bytes
Character that will replace chosen items in this sequence.
Returns
-------
Sequence
Copy of this sequence, with chosen items replaced with chosen
character. All metadata is retained.
Examples
--------
Let's create and display a Sequence:
>>> from skbio import Sequence
>>> sequence = Sequence('GGTACCAACG')
>>> str(sequence)
'GGTACCAACG'
Let's call ``replace`` on the Sequence using a boolean vector for
``where`` and assign it to a new variable:
>>> seq = sequence.replace([False, False, False, True, False, False,
... True, True, False, False], '-')
Let's take a look at the new Sequence:
>>> str(seq)
'GGT-CC--CG'
Other types of input are accepted by the ``where`` parameter. Let's
pass in a list of indices and slices that is equivalent to the boolean
vector we used previously:
>>> str(seq) == str(sequence.replace([3, slice(6, 8)], '-'))
True
``where`` also accepts a boolean vector contained in
``Sequence.positional_metadata``:
>>> sequence.positional_metadata = {'where':
... [False, False, False, True, False,
... False, True, True, False, False]}
Let's pass in the key ``'where'`` and compare to ``seq``:
>>> str(seq) == str(sequence.replace('where', '-'))
True
"""
if isinstance(character, bytes) is not True:
character = character.encode("ascii")
character = ord(character)
index = self._munge_to_index_array(where)
seq_bytes = self._bytes.copy()
seq_bytes[index] = character
metadata = None
if self.has_metadata():
metadata = self.metadata
positional_metadata = None
if self.has_positional_metadata():
positional_metadata = self.positional_metadata
interval_metadata = None
if self.has_interval_metadata():
interval_metadata = self.interval_metadata
# Use __class__ instead of _constructor so that validations are
# performed for subclasses (the user could have introduced invalid
# characters).
return self.__class__(
seq_bytes,
metadata=metadata,
positional_metadata=positional_metadata,
interval_metadata=interval_metadata,
)
def index(self, subsequence, start=None, end=None):
r"""Find position where subsequence first occurs in the sequence.
Parameters
----------
subsequence : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
Subsequence to search for in this sequence.
start : int, optional
The position at which to start searching (inclusive).
end : int, optional
The position at which to stop searching (exclusive).
Returns
-------
int
Position where `subsequence` first occurs in this sequence.
Raises
------
ValueError
If `subsequence` is not present in this sequence.
TypeError
If `subsequence` is a ``Sequence`` object with a different type
than this sequence.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('ACACGACGTT-')
>>> s.index('ACG')
2
"""
try:
return self._string.index(
self._munge_to_bytestring(subsequence, "index"), start, end
)
except ValueError:
raise ValueError("%r is not present in %r." % (subsequence, self))
def distance(self, other, metric=None):
r"""Compute the distance to another sequence.
Parameters
----------
other : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
Sequence to compute the distance to. If `other` is a ``Sequence``
object, it must be the same type as this sequence. Other input
types will be converted into a ``Sequence`` object of the same type
as this sequence.
metric : function, optional
Function used to compute the distance between this sequence and
`other`. If ``None`` (the default), Hamming distance will be used
(:func:`skbio.sequence.distance.hamming`). `metric` should take two
``skbio.Sequence`` objects and return a ``float``. The sequence
objects passed to `metric` will be the same type as this sequence.
See :mod:`skbio.sequence.distance` for other predefined metrics
that can be supplied via `metric`.
Returns
-------
float
Distance between this sequence and `other` as defined by `metric`.
Raises
------
TypeError
If `other` is a ``Sequence`` object with a different type than this
sequence.
See Also
--------
skbio.sequence.distance
fraction_diff
fraction_same
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> t = Sequence('AGUC')
Compute Hamming distance (the default metric):
>>> s.distance(t)
0.25
Use a custom metric:
>>> def custom_metric(s1, s2): return 0.42
>>> s.distance(t, custom_metric)
0.42
"""
# TODO refactor this method to accept a name (string) of the distance
# metric to apply and accept **kwargs
other = self._munge_to_self_type(other, "distance")
if metric is None:
metric = skbio.sequence.distance.hamming
return float(metric(self, other))
def matches(self, other):
r"""Find positions that match with another sequence.
Parameters
----------
other : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
Sequence to compare to.
Returns
-------
1D np.ndarray (bool)
Boolean vector where ``True`` at position ``i`` indicates a match
between the sequences at their positions ``i``.
Raises
------
ValueError
If the sequences are not the same length.
TypeError
If `other` is a ``Sequence`` object with a different type than this
sequence.
See Also
--------
mismatches
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> t = Sequence('GAUU')
>>> s.matches(t)
array([ True, False, True, False], dtype=bool)
"""
other = self._munge_to_sequence(other, "matches/mismatches")
if len(self) != len(other):
raise ValueError(
"Match and mismatch vectors can only be "
"generated from equal length sequences."
)
return self._bytes == other._bytes
def mismatches(self, other):
r"""Find positions that do not match with another sequence.
Parameters
----------
other : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
Sequence to compare to.
Returns
-------
1D np.ndarray (bool)
Boolean vector where ``True`` at position ``i`` indicates a
mismatch between the sequences at their positions ``i``.
Raises
------
ValueError
If the sequences are not the same length.
TypeError
If `other` is a ``Sequence`` object with a different type than this
sequence.
See Also
--------
matches
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> t = Sequence('GAUU')
>>> s.mismatches(t)
array([False, True, False, True], dtype=bool)
"""
return np.invert(self.matches(other))
def match_frequency(self, other, relative=False):
r"""Return count of positions that are the same between two sequences.
Parameters
----------
other : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
Sequence to compare to.
relative : bool, optional
If ``True``, return the relative frequency of matches instead of
the count.
Returns
-------
int or float
Number of positions that are the same between the sequences. This
will be an ``int`` if `relative` is ``False`` and a ``float``
if `relative` is ``True``.
Raises
------
ValueError
If the sequences are not the same length.
TypeError
If `other` is a ``Sequence`` object with a different type than this
sequence.
See Also
--------
mismatch_frequency
matches
mismatches
distance
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> t = Sequence('AGUC')
>>> s.match_frequency(t)
3
>>> s.match_frequency(t, relative=True)
0.75
"""
if relative:
return float(self.matches(other).mean())
else:
return int(self.matches(other).sum())
def mismatch_frequency(self, other, relative=False):
r"""Return count of positions that differ between two sequences.
Parameters
----------
other : str, Sequence, or 1D np.ndarray (np.uint8 or '\|S1')
Sequence to compare to.
relative : bool, optional
If ``True``, return the relative frequency of mismatches instead of
the count.
Returns
-------
int or float
Number of positions that differ between the sequences. This will be
an ``int`` if `relative` is ``False`` and a ``float``
if `relative` is ``True``.
Raises
------
ValueError
If the sequences are not the same length.
TypeError
If `other` is a ``Sequence`` object with a different type than this
sequence.
See Also
--------
match_frequency
matches
mismatches
distance
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('GGUC')
>>> t = Sequence('AGUC')
>>> s.mismatch_frequency(t)
1
>>> s.mismatch_frequency(t, relative=True)
0.25
"""
if relative:
return float(self.mismatches(other).mean())
else:
return int(self.mismatches(other).sum())
def frequencies(self, chars=None, relative=False):
r"""Compute frequencies of characters in the sequence.
Parameters
----------
chars : str or set of str, optional
Characters to compute the frequencies of. May be a ``str``
containing a single character or a ``set`` of single-character
strings. If ``None``, frequencies will be computed for all
characters present in the sequence.
relative : bool, optional
If ``True``, return the relative frequency of each character
instead of its count. If `chars` is provided, relative frequencies
will be computed with respect to the number of characters in the
sequence, **not** the total count of characters observed in
`chars`. Thus, the relative frequencies will not necessarily sum to
1.0 if `chars` is provided.
Returns
-------
dict
Frequencies of characters in the sequence.
Raises
------
TypeError
If `chars` is not a ``str`` or ``set`` of ``str``.
ValueError
If `chars` is not a single-character ``str`` or a ``set`` of
single-character strings.
ValueError
If `chars` contains characters outside the allowable range of
characters in a ``Sequence`` object.
See Also
--------
kmer_frequencies
iter_kmers
Notes
-----
If the sequence is empty (i.e., length zero), ``relative=True``,
**and** `chars` is provided, the relative frequency of each specified
character will be ``np.nan``.
If `chars` is not provided, this method is equivalent to, but faster
than, ``seq.kmer_frequencies(k=1)``.
If `chars` is not provided, it is equivalent to, but faster than,
passing ``chars=seq.observed_chars``.
Examples
--------
Compute character frequencies of a sequence:
>>> from skbio import Sequence
>>> seq = Sequence('AGAAGACC')
>>> freqs = seq.frequencies()
>>> dict(sorted(freqs.items())) # display dict in sorted order
{'A': 4, 'C': 2, 'G': 2}
Compute relative character frequencies:
>>> freqs = seq.frequencies(relative=True)
>>> dict(sorted(freqs.items()))
{'A': 0.5, 'C': 0.25, 'G': 0.25}
Compute relative frequencies of characters A, C, and T:
>>> freqs = seq.frequencies(chars={'A', 'C', 'T'}, relative=True)
>>> dict(sorted(freqs.items()))
{'A': 0.5, 'C': 0.25, 'T': 0.0}
Note that since character T is not in the sequence we receive a
relative frequency of 0.0. The relative frequencies of A and C are
relative to the number of characters in the sequence (8), **not** the
number of A and C characters (4 + 2 = 6).
"""
freqs = np.bincount(self._bytes, minlength=self._num_extended_ascii_codes)
if chars is not None:
chars, indices = self._chars_to_indices(chars)
else:
(indices,) = np.nonzero(freqs)
# Downcast from int64 to uint8 then convert to str. This is safe
# because we are guaranteed to have indices in the range 0 to 255
# inclusive.
chars = indices.astype(np.uint8).tobytes().decode("ascii")
obs_counts = freqs[indices]
if relative:
obs_counts = obs_counts / len(self)
# Use tolist() for minor performance gain.
return dict(zip(chars, obs_counts.tolist()))
def _chars_to_indices(self, chars):
"""Convert characters to indices for Sequence.frequencies."""
if isinstance(chars, (str, bytes)):
chars = set([chars])
elif not isinstance(chars, set):
raise TypeError(
"`chars` must be of type `set`, not %r" % type(chars).__name__
)
# Impose an (arbitrary) ordering to `chars` so that we can return
# `indices` in that same order.
chars = list(chars)
indices = []
for char in chars:
if not isinstance(char, (str, bytes)):
raise TypeError(
"Each element of `chars` must be string-like, not %r"
% type(char).__name__
)
if len(char) != 1:
raise ValueError(
"Each element of `chars` must contain a single "
"character (found %d characters)" % len(char)
)
index = ord(char)
if index >= self._num_extended_ascii_codes:
raise ValueError(
"Character %r in `chars` is outside the range of "
"allowable characters in a `Sequence` object." % char
)
indices.append(index)
return chars, indices
def iter_kmers(self, k, overlap=True):
r"""Generate kmers of length `k` from this sequence.
Parameters
----------
k : int
The kmer length.
overlap : bool, optional
Defines whether the kmers should be overlapping or not.
Yields
------
Sequence
kmer of length `k` contained in this sequence.
Raises
------
ValueError
If `k` is less than 1.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('ACACGACGTT')
>>> for kmer in s.iter_kmers(4, overlap=False):
... str(kmer)
'ACAC'
'GACG'
>>> for kmer in s.iter_kmers(3, overlap=True):
... str(kmer)
'ACA'
'CAC'
'ACG'
'CGA'
'GAC'
'ACG'
'CGT'
'GTT'
"""
if k < 1:
raise ValueError("k must be greater than 0.")
if k > len(self):
return
if overlap:
step = 1
count = len(self) - k + 1
else:
step = k
count = len(self) // k
if len(self) == 0 or self.has_positional_metadata():
# Slower path when sequence is empty or positional metadata needs
# to be sliced.
for i in range(0, len(self) - k + 1, step):
yield self[i : i + k]
else:
# Optimized path when positional metadata doesn't need slicing.
kmers = np.lib.stride_tricks.as_strided(
self._bytes, shape=(k, count), strides=(1, step)
).T
metadata = None
if self.has_metadata():
metadata = self.metadata
for s in kmers:
yield self._constructor(
sequence=s, metadata=metadata, positional_metadata=None
)
def kmer_frequencies(self, k, overlap=True, relative=False):
r"""Return counts of words of length `k` from this sequence.
Parameters
----------
k : int
The word length.
overlap : bool, optional
Defines whether the kmers should be overlapping or not.
relative : bool, optional
If ``True``, return the relative frequency of each kmer instead of
its count.
Returns
-------
dict
Frequencies of words of length `k` contained in this sequence.
Raises
------
ValueError
If `k` is less than 1.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('ACACATTTATTA')
>>> freqs = s.kmer_frequencies(3, overlap=False)
>>> freqs
{'ACA': 1, 'CAT': 1, 'TTA': 2}
>>> freqs = s.kmer_frequencies(3, relative=True, overlap=False)
>>> freqs
{'ACA': 0.25, 'CAT': 0.25, 'TTA': 0.5}
"""
kmers = self.iter_kmers(k, overlap=overlap)
freqs = dict(collections.Counter((str(seq) for seq in kmers)))
if relative:
if overlap:
num_kmers = len(self) - k + 1
else:
num_kmers = len(self) // k
relative_freqs = {}
for kmer, count in freqs.items():
relative_freqs[kmer] = count / num_kmers
freqs = relative_freqs
return freqs
def find_with_regex(self, regex, ignore=None):
r"""Generate slices for patterns matched by a regular expression.
Parameters
----------
regex : str or regular expression object
String to be compiled into a regular expression, or a pre-
compiled regular expression object (e.g., from calling
``re.compile``).
ignore : 1D array_like (bool) or iterable (slices or ints), optional
Indicate the positions to ignore when matching.
Yields
------
slice
Location where the regular expression matched.
Examples
--------
>>> from skbio import Sequence
>>> s = Sequence('AATATACCGGTTATAA')
>>> for match in s.find_with_regex('(TATA+)'):
... match
... str(s[match])
slice(2, 6, None)
'TATA'
slice(11, 16, None)
'TATAA'
"""
if isinstance(regex, str):
regex = re.compile(regex)
lookup = np.arange(len(self))
if ignore is None:
string = str(self)
else:
ignore = self._munge_to_index_array(ignore)
lookup = np.delete(lookup, ignore)
string = str(self[lookup])
for match in regex.finditer(string):
# We start at 1 because we don't want the group that contains all
# other groups.
for g in range(1, len(match.groups()) + 1):
yield slice(lookup[match.start(g)], lookup[match.end(g) - 1] + 1)
def iter_contiguous(self, included, min_length=1, invert=False):
r"""Yield contiguous subsequences based on `included`.
Parameters
----------
included : 1D array_like (bool) or iterable (slices or ints)
`included` is transformed into a flat boolean vector where each
position will either be included or skipped. All contiguous
included positions will be yielded as a single region.
min_length : int, optional
The minimum length of a subsequence for it to be yielded.
Default is 1.
invert : bool, optional
Whether to invert `included` such that it describes what should be
skipped instead of included. Default is False.
Yields
------
Sequence
Contiguous subsequence as indicated by `included`.
Notes
-----
If slices provide adjacent ranges, then they will be considered the
same contiguous subsequence.
Examples
--------
Here we use `iter_contiguous` to find all of the contiguous ungapped
sequences using a boolean vector derived from our DNA sequence.
>>> from skbio import DNA
>>> s = DNA('AAA--TT-CCCC-G-')
>>> no_gaps = ~s.gaps()
>>> for ungapped_subsequence in s.iter_contiguous(no_gaps,
... min_length=2):
... print(ungapped_subsequence)
AAA
TT
CCCC
Note how the last potential subsequence was skipped because it would
have been smaller than our `min_length` which was set to 2.
We can also use `iter_contiguous` on a generator of slices as is
produced by `find_motifs` (and `find_with_regex`).
>>> from skbio import Protein
>>> s = Protein('ACDFNASANFTACGNPNRTESL')
>>> for subseq in s.iter_contiguous(s.find_motifs('N-glycosylation')):
... print(subseq)
NASANFTA
NRTE
Note how the first subsequence contains two N-glycosylation sites. This
happened because they were contiguous.
"""
idx = self._munge_to_index_array(included)
if invert:
idx = np.delete(np.arange(len(self)), idx)
# Adapted from http://stackoverflow.com/a/7353335/579416
for contig in np.split(idx, np.where(np.diff(idx) != 1)[0] + 1):
r = self[contig]
if len(r) >= min_length:
yield r
def to_indices(
self, alphabet=None, mask_gaps="auto", wildcard="auto", return_codes=False
):
r"""Convert the sequence into indices of characters.
The result will be indices of characters in an alphabet, if provided,
otherwise indices of unique characters observed in the sequence, in
which case the unique characters in sorted order will also be returned.
Parameters
----------
alphabet : iterable of scalar or skbio.SubstitutionMatrix, optional
Explicitly provided alphabet. The returned indices will be indices
of characters in this alphabet. If `None`, will return indices of
unique characters observed in the sequence.s
mask_gaps : 'auto' or bool, optional
Mask gap characters in the sequence, and return a masked array
instead of a standard array. The gap characters are defined by the
sequence's `gap_characters` attribute. If `'auto'` (default), will
return a standard array if no gap character is found, or a masked
array if gap character(s) are found.
wildcard : 'auto', str of length 1 or None, optional
A character to subsitute characters in the sequence that are absent
from the alphabet. If `'auto'` (default), will adopt the sequence's
`wildcard_char` attribute (if available). If no wildcard is given
and there are absent characters, will raise an error.
return_codes : bool, optional
Return observed characters as an array of ASCII code points instead
of a string. Not effective if `alphabet` is set.
Returns
-------
1D np.ndarray or np.ma.ndarray of uint8
Vector of character indices representing the sequence
str or 1D np.array of uint8, optional
Sorted unique characters observed in the sequence.
Raises
------
ValueError
If alphabet are not valid ASCII characters or contains duplicates.
ValueError
If gap(s) are to be masked but gap character(s) are not defined.
ValueError
If wildcard character is not a valid ASCII character.
Examples
--------
Convert a protein sequence into indices of unique amino acids in it.
Note that the unique characters are ordered.
>>> from skbio import Protein
>>> seq = Protein('MEEPQSDPSV')
>>> idx, uniq = seq.to_indices()
>>> idx
array([2, 1, 1, 3, 4, 5, 0, 3, 5, 6], dtype=uint8)
>>> uniq
'DEMPQSV'
Convert a DNA sequence into indices of nucleotides in an alphabet.
Note that the order of characters is consistent with the alphabet.
>>> from skbio import DNA
>>> seq = DNA('CTCAAAAGTC')
>>> idx = seq.to_indices(alphabet='TCGA')
>>> idx
array([1, 0, 1, 3, 3, 3, 3, 2, 0, 1], dtype=uint8)
Use the alphabet included in a substitution matrix.
>>> from skbio import SubstitutionMatrix
>>> sm = SubstitutionMatrix.by_name('NUC.4.4')
>>> idx = seq.to_indices(alphabet=sm)
>>> idx
array([3, 1, 3, 0, 0, 0, 0, 2, 1, 3], dtype=uint8)
Gap characters ("-" and ".") in the sequence will be masked
(`mask_gaps='auto'` is the default behavior).
>>> seq = DNA('GAG-CTC')
>>> idx = seq.to_indices(alphabet='ACGTN', mask_gaps='auto')
>>> print(idx)
[2 0 2 -- 1 3 1]
>>> print(idx.mask)
[False False False True False False False]
Characters not included in the alphabet will be substituted with a
wildcard character, such as "N" for nucleotides and "X" for amino
acids (`wildcard='auto'` is the default behavior).
>>> seq = DNA('GAGRCTC')
>>> idx = seq.to_indices(alphabet='ACGTN', wildcard='auto')
>>> idx
array([2, 0, 2, 4, 1, 3, 1], dtype=uint8)
"""
seq = self._bytes
# mask gap characters
mask = None
if mask_gaps in (True, "auto"):
gap_chars = getattr(self, "gap_chars", None)
if gap_chars:
# encode gap characters
gap_chars = list(map(ord, gap_chars))
# locate gaps in sequence
gaps = np.isin(seq, gap_chars)
if mask_gaps is True or gaps.any():
mask, seq = gaps, seq[~gaps]
elif mask_gaps is True:
raise ValueError(
"Gap character(s) are not defined for the " "sequence."
)
# according to an alphabet
if alphabet is not None:
# get wildcard character
if wildcard == "auto":
wildcard = getattr(self, "wildcard_char", None)
# encode wildcard character
if wildcard is not None:
try:
assert (wildcard := ord(wildcard)) < 128
except (TypeError, AssertionError):
raise ValueError("Wildcard must be a single ASCII " "character.")
# extract alphabet from a substitution matrix
if hasattr(alphabet, "_is_ascii"):
if alphabet._is_ascii is True:
indices = _indices_in_alphabet_ascii(
seq, alphabet._char_hash, wildcard=wildcard
)
else:
raise ValueError(
"Alphabet in the substitution matrix "
"are not single ASCII characters."
)
# process alphabet from scratch
else:
if find_duplicates(alphabet):
raise ValueError("Alphabet contains duplicated " "characters.")
try:
alphabet = _alphabet_to_hashes(alphabet)
except (TypeError, ValueError, UnicodeEncodeError):
raise ValueError(
"Alphabet cannot be encoded as single " "ASCII characters."
)
indices = _indices_in_alphabet_ascii(seq, alphabet, wildcard=wildcard)
# according to observed characters
else:
(indices,), observed = _indices_in_observed([seq])
indices = indices.astype(np.uint8)
if return_codes is False:
observed = observed.tobytes().decode("ascii")
# construct masked array
if mask is not None:
indices_ = np.full(mask.size, 255, dtype=np.uint8)
indices_[~mask] = indices
indices = np.ma.array(indices_, mask=mask)
if alphabet is not None:
return indices
else:
return indices, observed
def _constructor(self, **kwargs):
return self.__class__(**kwargs)
def _munge_to_index_array(self, sliceable):
r"""Return index array from something isomorphic to a boolean vector."""
if isinstance(sliceable, str):
if sliceable in self.positional_metadata:
if self.positional_metadata[sliceable].dtype == bool:
sliceable = self.positional_metadata[sliceable]
else:
raise TypeError(
"Column '%s' in positional metadata does "
"not correspond to a boolean vector" % sliceable
)
else:
raise ValueError(
"No positional metadata associated with key " "'%s'" % sliceable
)
if not hasattr(sliceable, "dtype") or (
hasattr(sliceable, "dtype") and sliceable.dtype == "object"
):
sliceable = tuple(sliceable)
bool_mode = False
int_mode = False
for s in sliceable:
if isinstance(s, (bool, np.bool_)):
bool_mode = True
elif isinstance(s, (slice, int, np.signedinteger)) or (
hasattr(s, "dtype") and s.dtype != bool
):
int_mode = True
else:
raise TypeError(
"Invalid type in iterable: %s, must be one"
" of {bool, int, slice, np.signedinteger}"
% s.__class__.__name__
)
if bool_mode and int_mode:
raise TypeError("Cannot provide iterable of both bool and" " int.")
sliceable = np.r_[sliceable]
if sliceable.dtype == bool:
if sliceable.size != len(self):
raise ValueError(
"Boolean array (%d) does not match length of"
" sequence (%d)." % (sliceable.size, len(self))
)
(normalized,) = np.where(sliceable)
else:
normalized = np.bincount(sliceable)
if np.any(normalized > 1):
raise ValueError("Overlapping index regions are not allowed.")
(normalized,) = np.where(normalized)
if np.any(normalized != sliceable):
raise ValueError("Index regions are out of order.")
return normalized
def _munge_to_self_type(self, other, method):
if isinstance(other, Sequence):
if type(other) is not type(self):
raise TypeError(
"Cannot use %s and %s together with `%s`"
% (self.__class__.__name__, other.__class__.__name__, method)
)
else:
return other
return self.__class__(other)
def _munge_to_sequence(self, other, method):
if isinstance(other, Sequence):
if type(other) is not type(self):
raise TypeError(
"Cannot use %s and %s together with `%s`"
% (self.__class__.__name__, other.__class__.__name__, method)
)
else:
return other
# We don't use self.__class__ or self._constructor here because we want
# to construct the most general type of Sequence object in order to
# avoid validation errors.
return Sequence(other)
def _munge_to_bytestring(self, other, method):
if isinstance(other, bytes):
return other
elif isinstance(other, str):
return other.encode("ascii")
else:
return self._munge_to_sequence(other, method)._string
@contextmanager
def _byte_ownership(self):
if not self._owns_bytes:
self._bytes = self._bytes.copy()
self._owns_bytes = True
self._bytes.flags.writeable = True
yield
self._bytes.flags.writeable = False
def _single_index_to_slice(start_index):
end_index = None if start_index == -1 else start_index + 1
return slice(start_index, end_index)
def _is_single_index(index):
return isinstance(index, numbers.Integral) and not isinstance(index, bool)
def _as_slice_if_single_index(indexable):
if _is_single_index(indexable):
return _single_index_to_slice(indexable)
else:
return indexable
def _slices_from_iter(array, indexables):
for i in indexables:
if isinstance(i, slice):
pass
elif _is_single_index(i):
i = _single_index_to_slice(i)
else:
raise IndexError(
"Cannot slice sequence from iterable " "containing %r." % i
)
yield array[i]
|