1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57
|
\name{PairwiseAlignmentTFBS}
\Rdversion{1.1}
\docType{class}
\alias{PairwiseAlignmentTFBS}
\alias{alignments}
\alias{alignments,PairwiseAlignmentTFBS-method}
\alias{alnlength,PairwiseAlignmentTFBS-method}
\alias{conservation1,PairwiseAlignmentTFBS-method}
%\alias{searchAln,PWMatrix,PairwiseAlignmentTFBS,missing-method}
%\alias{searchAln,PWMatrixList,PairwiseAlignmentTFBS,missing-method}
\alias{seqlength,PairwiseAlignmentTFBS-method}
\alias{seqname,PairwiseAlignmentTFBS-method}
\title{Class \code{"PairwiseAlignmentTFBS"}}
\description{
The PairwiseAlignmentTFBS object is a container for pairwise alignment
and its corresponding information.
}
\usage{
## Constructor
PairwiseAlignmentTFBS(pattern, subject, type="global",
substitutionMatrix=NULL, gapOpening=0,
gapExtension=-1, seqname1="Unknown", seqname2="Unknown",
windowSize=51L, cutoff=0.7)
}
\section{Slots}{
\describe{
\item{\code{alignments}:}{Object of class \code{"PairwiseAlignments"}: A PairwiseAlignments object representing the pairwise alignment sequence.}
\item{\code{seqname1}:}{Object of class \code{"character"}: Sequence name of first sequence}
\item{\code{seqname2}:}{Object of class \code{"character"}: Sequence name of second sequence}
\item{\code{conservation1}:}{Object of class \code{"numeric"}: Conservation score based on the first sequence in the pairwise alignment.}
\item{\code{windowSize}:}{Object of class \code{"integer"}: The window size used to compute the conservation profile.}
\item{\code{cutoff}:}{Object of class \code{"numeric"}: The conservation cutoff (between 0 and 1) for including the region in the results of the pattern search.}
\item{\code{seq1length}:}{Object of class \code{"integer"}: The first sequence's length}
\item{\code{seq2length}:}{Object of class \code{"integer"}: The second sequence's length}
}
}
\author{
Ge Tan
}
\seealso{
%% ~~objects to See Also as \code{\link{~~fun~~}}, ~~~
%% ~~or \code{\linkS4class{CLASSNAME}} for links to other classes ~~~
\code{\link{searchAln}}
}
\examples{
\dontrun{
aln = PairwiseAlignmentTFBS(
pattern="ACTTCACCAGCTCCCTGGCGGTAAGTTGATC---AAAGG---AAACGCAAAGTTTTCAAG",
subject="GTTTCACTACTTCCTTTCGGGTAAGTAAATATATAAATATATAAAAATATAATTTTCATC",
windowSize=13L)
}
}
\keyword{classes}
|