File: SeqFastadna.Rd

package info (click to toggle)
r-cran-seqinr 3.4-5-2
  • links: PTS, VCS
  • area: main
  • in suites: buster
  • size: 5,876 kB
  • sloc: ansic: 1,987; makefile: 14
file content (43 lines) | stat: -rw-r--r-- 1,639 bytes parent folder | download | duplicates (4)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
\name{SeqFastadna}
\alias{SeqFastadna}
\alias{is.SeqFastadna}
\alias{as.SeqFastadna}
\alias{summary.SeqFastadna}
\title{ Class for DNA sequence in Fasta Format}
\description{
  \code{as.SeqFastadna} is called by many functions as \code{read.fasta}. It creates an object of class \code{SeqFastadna}. 
  \code{is.SeqFastadna} returns TRUE if the object is of class \code{SeqFastadna}. 
  \code{summary.SeqFastadna} gives the base composition of an object of class \code{SeqFastadna}.
}
\usage{
as.SeqFastadna(object, name = NULL, Annot = NULL)
is.SeqFastadna(object)
\method{summary}{SeqFastadna}(object, alphabet = s2c("acgt"), ...)
}
\arguments{
  \item{object}{a vector of chars representing a biological sequence} 
  \item{name}{ \code{NULL} a character string specifying a name for the sequence } 
  \item{Annot}{ \code{NULL} a character string specifying some annotations for the sequence }
  \item{...}{additional arguments affecting the summary produced}
    \item{alphabet}{a vector of single characters}
}
\value{
  \code{as.SeqFastadna} returns an object sequence of class \code{SeqFastadna}.
  \code{summary.SeqFastadna} returns a list which the following components:
	\item{length}{ the legth of the sequence}
	\item{compo}{the base counting of the sequence} 
	\item{GC}{the percentage of G+C in the sequence}
}
\references{
  \code{citation("seqinr")}
}
\author{D. Charif}
\examples{
 s <- read.fasta(system.file("sequences/malM.fasta",package="seqinr"))
 is.SeqFastadna(s[[1]])
 summary(s[[1]])
 myseq <- s2c("acgttgatgctagctagcatcgat")
 as.SeqFastadna(myseq, name = "myseq", Annot = "blablabla")
 myseq
}
\keyword{utilities}