File: gb2fasta.Rd

package info (click to toggle)
r-cran-seqinr 3.4-5-2
  • links: PTS, VCS
  • area: main
  • in suites: buster
  • size: 5,876 kB
  • sloc: ansic: 1,987; makefile: 14
file content (40 lines) | stat: -rw-r--r-- 1,103 bytes parent folder | download | duplicates (3)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
\name{gb2fasta}
\alias{gb2fasta}
\title{Conversion of GenBank file into fasta file}
\description{
Converts a single entry in GenBank format into a fasta file.
}
\usage{
gb2fasta(source.file, destination.file)
}
\arguments{
  \item{source.file}{ GenBank file }
  \item{destination.file}{ Fasta file }
}
\details{
Multiple entries in GenBank file are not supported.
}
\value{
  none
}
\references{
  \code{citation("seqinr")}
}
\author{J.R. Lobry}
\seealso{ \code{\link{oriloc}} }
\examples{
  myGenBankFile <- system.file("sequences/ct.gbk.gz", package = "seqinr")
  myFastaFileName <- "Acinetobacter_ADP1_uid61597.fasta"
  gb2fasta(myGenBankFile, myFastaFileName)
  readLines(myFastaFileName)[1:5]
  #
  # Should be :
  #
  # [1] ">CHLTCG 1042519 bp"                                          
  # [2] "gcggccgcccgggaaattgctaaaagatgggagcaaagagttagagatctacaagataaa"
  # [3] "ggtgctgcacgaaaattattaaatgatcctttaggccgacgaacacctaattatcagagc"
  # [4] "aaaaatccaggtgagtatactgtagggaattccatgttttacgatggtcctcaggtagcg"
  # [5] "aatctccagaacgtcgacactggtttttggctggacatgagcaatctctcagacgttgta"
  #
}
\keyword{utilities}