File: cel-hbl-1.fasta

package info (click to toggle)
rnahybrid 2.1.2-5
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, buster, sid
  • size: 2,024 kB
  • sloc: ansic: 16,465; sh: 1,892; makefile: 76
file content (20 lines) | stat: -rw-r--r-- 1,552 bytes parent folder | download | duplicates (6)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
>F13D11.2.1|F13D11.2.1 assembly=CEL116|chr=X|strand=forward|downstream UTR
TGAGGACGTCCTCGTTAAGGAAACACTTCCCATAGCCCCTTACCCTCGTCTAGTGACCCATTCTGAAATCGGCAGATAGA
CTTTCATGTAGCTGGTTTAAGTTTTCTCTTCATTTTCTTTAACTTATCAATGTTCGGGCGTTACCACTTTTCTAATCATG
GCCAGTTTCTTGCACGTACACCTCAACCGTCCATTTCCATGAAATCTCATACTTGTTACTGTTTTCTTTTACCTCTGATG
TCACATTTTCTCTCTGTCTCACTTTCTACCTCCAAACATATTTTACTACTTGTATTGAATGCCAAAAAATACCATATTTA
TTAAGGAGCATTGTTCATTTACAGTTTTGTACTCTCAGAGCGTGTTATTATCTAGAAGCAATTGTATACTGTTCTCAGTA
CATGTAGTACCTCCCCCAGAATACTTGTTTCTGTTACTATGTACCCCTCTTATTAACTTCGGGATATGAAACTTTTTATG
TTTCATTTTCTATTGATTTCATTTGTTTGTCATTTTCAAGCTCCTCTTTCCACATAAGCTTTAACTGCATGTCTTTCATT
TTTATTTATTTCTATTTGCCAATTGTTTAACTATGCACACATTTGTTTCATGTTTCTCCAGAGATAACTTTCCCAAATTC
AAGTTTGCGCCAACTCGTGCTGCTCTTTTATTGTACGGTTTTATAACGTTTCCGTCTTGAAATCAGAGATTGTAGCCGTT
TTTTGAAAAGGATATGCCAAAGAATCGTCCCCCACCCTCTAGTTGTCATTTGTTAAATAGCCGAAGTGACCCAACAACCC
GCTTTTGTCCCCTCTACTAATAACCGTTTTATTATTATTATCACTCAATATTTATCTTTTTATGTACTTCTTTCACTGCT
CCCATGTCGTGATTTCTGATTTCACATTTTCCAGACTATCTCGCACTTTCATTCTACCTCAATACATCCCAGCTTTTTTG
CCATACATTCTCCGATTCGAATTCATGTGTGCTCGTTTAACTATTATTACCTGTATCCACCGATTACTTTTTTGTTTATT
CGCTCCCTTTTTTCTATCTCAGGAATGATTTATAGTTTTCAATTTGTCTTCTCACAACTCATCTAAACTACTTGTCCGCT
ACCTTATGTACCTCATTGACTCATTTTGCCATCACCCAATACAATTTATACCTCAATACTGTCTCTTACCTGTATAATGC
CTTCTACCTCCAATTTTTACCATCTATTCTAGTTAATTACCATTTTCTACCTCAACCCATTTTCTATTATACAACCGTTC
CACCTCAAACTTCAGTGCGTTCTTCTGTCATCATGTACAATTTTCTTTCTTCGAATTTTGATTCGAATGTCAATTTATCA
ATTTATAAAAACTCCAATAAAAAAGCATCTTGAAGCATCTTGTTTTACCACATATATCAAAACTTCAAAGTACACAATTA
ATCGGATCATCAGAAAAA