File: hunchback_related.fasta

package info (click to toggle)
rnahybrid 2.1.2-5
  • links: PTS, VCS
  • area: main
  • in suites: buster, sid
  • size: 2,024 kB
  • sloc: ansic: 16,465; sh: 1,892; makefile: 76
file content (25 lines) | stat: -rw-r--r-- 1,438 bytes parent folder | download | duplicates (2)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
>3CEL000772
tgaggacgtcctcgttaaggaaacacttcccatagccccttaccctcgtctagtgaccca
ttctgaaatcggcagatagactttcatgtagctggtttaagttttctcttcattttcttt
aacttatcaatgttcgggcgttaccacttttctaatcatggccagtttcttgcacgtaca
cctcaaccgtccatttccatgaaatctcatacttgttactgttttcttttacctctgatg
tcacattttctctctgtctcactttctacctccaaacatattttactacttgtattgaat
gccaaaaaataccatatttattaaggagcattgttcatttacagttttgtactctcagag
cgtgttattatctagaagcaattgtatactgttctcagtacatgtagtacctcccccaga
atacttgtttctgttactatgtacccctcttattaacttcgggatatgaaactttttatg
tttcattttctattgatttcatttgtttgtcattttcaagctcctctttccacataagct
ttaactgcatgtctttcatttttatttatttctatttgccaattgtttaactatgcacac
atttgtttcatgtttctccagagataactttcccaaattcaagtttgcgccaactcgtgc
tgctcttttattgtacggttttataacgtttccgtcttgaaatcagagattgtagccgtt
ttttgaaaaggatatgccaaagaatcgtcccccaccctctagttgtcatttgttaaatag
ccgaagtgacccaacaacccgcttttgtcccctctactaataaccgttttattattatta
tcactcaatatttatctttttatgtacttctttcactgctcccatgtcgtgatttctgat
ttcacattttccagactatctcgcactttcattctacctcaatacatcccagcttttttg
ccatacattctccgattcgaattcatgtgtgctcgtttaactattattacctgtatccac
cgattacttttttgtttattcgctcccttttttctatctcaggaatgatttatagttttc
aatttgtcttctcacaactcatctaaactacttgtccgctaccttatgtacctcattgac
tcattttgccatcacccaatacaatttatacctcaatactgtctcttacctgtataatgc
cttctacctccaatttttaccatctattctagttaattaccattttctacctcaacccat
tttctattatacaaccgttccacctcaaacttcagtgcgttcttctgtcatcatgtacaa
ttttctttcttcgaattttgattcgaatgtcaatttatcaatttataaaaactccaataa
aaaagcatcttgaagcaaaaaa