File: let-7.fasta

package info (click to toggle)
rnahybrid 2.1.2-5
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, buster, sid
  • size: 2,024 kB
  • sloc: ansic: 16,465; sh: 1,892; makefile: 76
file content (2 lines) | stat: -rw-r--r-- 30 bytes parent folder | download | duplicates (2)
1
2
>let-7
ugagguaguagguuguauaguu