1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687
|
/*
This file is part of BioD.
Copyright (C) 2012-2016 Artem Tarasov <lomereiter@gmail.com>
Permission is hereby granted, free of charge, to any person obtaining a
copy of this software and associated documentation files (the "Software"),
to deal in the Software without restriction, including without limitation
the rights to use, copy, modify, merge, publish, distribute, sublicense,
and/or sell copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in
all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
DEALINGS IN THE SOFTWARE.
*/
/// $(P $(D BamRead) type provides convenient interface for working with SAM/BAM records.)
///
/// $(P All flags, tags, and fields can be accessed and modified.)
///
/// Examples:
/// ---------------------------
/// import std.conv;
/// ...
/// assert(!read.is_unmapped); // check flag
/// assert(read.ref_id != -1); // access field
///
/// int edit_distance = to!int(read["NM"]); // access tag
/// read["NM"] = 0; // modify tag
/// read["NM"] = null; // remove tag
/// read["NM"] = null; // no-op
///
/// foreach (tag, value; read) // iterate over tags
/// writeln(tag, " ", value); // and print their keys and values
///
/// read.sequence = "AGCAGACTACGTGTGCATAC"; // sets base qualities to 255
/// assert(read.base_qualities[0] == 255);
/// read.is_unmapped = true; // set flag
/// read.ref_id = -1; // set field
/// ---------------------------
module bio.std.hts.bam.read;
import bio.core.base;
import bio.core.utils.format;
import bio.std.hts.bam.abstractreader;
import bio.std.hts.bam.cigar;
import bio.std.hts.bam.writer;
import bio.std.hts.bam.tagvalue;
import bio.std.hts.bam.bai.bin;
import bio.std.hts.bam.md.core;
import bio.std.hts.utils.array;
import bio.std.hts.utils.value;
import bio.core.utils.switchendianness;
import bio.std.hts.thirdparty.msgpack : Packer, unpack;
import std.algorithm;
import std.range;
import std.conv;
import std.format;
import std.exception;
import std.system;
import std.traits;
import std.array;
import std.bitmanip;
import core.stdc.stdlib;
/**
BAM record representation.
*/
struct BamRead {
mixin TagStorage;
/// Reference index in BAM file header
@property int ref_id() const nothrow { return _refID; }
/// ditto
@property void ref_id(int n) { _dup(); _refID = n; }
/// Reference sequence name ('*' for unmapped reads)
@property string ref_name() const nothrow { return _ref_id_to_string(ref_id); }
/// 0-based leftmost coordinate of the first matching base
@property int position() const nothrow { return _pos; }
/// ditto
@property void position(int n) { _dup(); _pos = n; _recalculate_bin(); }
/// Indexing bin which this read belongs to. Recalculated when position is changed.
@property bio.std.hts.bam.bai.bin.Bin bin() const nothrow { return Bin(_bin); }
/// Mapping quality. Equals to 255 if not available, otherwise
/// equals to rounded -10 * log10(P {mapping position is wrong}).
@property ubyte mapping_quality() const nothrow { return _mapq; }
/// ditto
@property void mapping_quality(ubyte n) { _dup(); _mapq = n; }
/// Flag bits (should be used on very rare occasions, see flag getters/setters below)
@property ushort flag() const nothrow { return _flag; }
/// ditto
@property void flag(ushort n) { _dup(); _flag = n; }
/// Sequence length. In fact, sequence.length can be used instead, but that might be
/// slower if the compiler is not smart enough to optimize away unrelated stuff.
@property int sequence_length() const nothrow { return _l_seq; }
/// Mate reference ID
@property int mate_ref_id() const nothrow { return _next_refID; }
/// ditto
@property void mate_ref_id(int n) { _dup(); _next_refID = n; }
/// Mate reference sequence name ('*' for unmapped mates)
@property string mate_ref_name() const nothrow { return _ref_id_to_string(_next_refID); }
/// Mate position
@property int mate_position() const nothrow { return _next_pos; }
/// ditto
@property void mate_position(int n) { _dup(); _next_pos = n; }
/// Template length
@property int template_length() const nothrow { return _tlen; }
/// ditto
@property void template_length(int n) { _dup(); _tlen = n; }
// ------------------------ FLAG GETTERS/SETTERS -------------------------------------- //
/// Template having multiple segments in sequencing
@property bool is_paired() const nothrow { return cast(bool)(flag & 0x1); }
/// ditto
@property void is_paired(bool b) { _setFlag( 0, b); }
/// Each segment properly aligned according to the aligner
@property bool proper_pair() const nothrow { return cast(bool)(flag & 0x2); }
/// ditto
@property void proper_pair(bool b) { _setFlag( 1, b); }
/// Segment unmapped
@property bool is_unmapped() const nothrow { return cast(bool)(flag & 0x4); }
/// ditto
@property void is_unmapped(bool b) { _setFlag( 2, b); }
/// Next segment in the template unmapped
@property bool mate_is_unmapped() const nothrow { return cast(bool)(flag & 0x8); }
/// ditto
@property void mate_is_unmapped(bool b) { _setFlag( 3, b); }
/// Sequence being reverse complemented
@property bool is_reverse_strand() const nothrow { return cast(bool)(flag & 0x10); }
/// ditto
@property void is_reverse_strand(bool b) { _setFlag( 4, b); }
/// Sequence of the next segment in the template being reversed
@property bool mate_is_reverse_strand() const nothrow { return cast(bool)(flag & 0x20); }
/// ditto
@property void mate_is_reverse_strand(bool b) { _setFlag( 5, b); }
/// The first segment in the template
@property bool is_first_of_pair() const nothrow { return cast(bool)(flag & 0x40); }
/// ditto
@property void is_first_of_pair(bool b) { _setFlag( 6, b); }
/// The last segment in the template
@property bool is_second_of_pair() const nothrow { return cast(bool)(flag & 0x80); }
/// ditto
@property void is_second_of_pair(bool b) { _setFlag( 7, b); }
/// Secondary alignment
@property bool is_secondary_alignment() const nothrow { return cast(bool)(flag & 0x100); }
/// ditto
@property void is_secondary_alignment(bool b) { _setFlag( 8, b); }
/// Not passing quality controls
@property bool failed_quality_control() const nothrow { return cast(bool)(flag & 0x200); }
/// ditto
@property void failed_quality_control(bool b) { _setFlag( 9, b); }
/// PCR or optical duplicate
@property bool is_duplicate() const nothrow { return cast(bool)(flag & 0x400); }
/// ditto
@property void is_duplicate(bool b) { _setFlag(10, b); }
/// Supplementary alignment
@property bool is_supplementary() const nothrow { return cast(bool)(flag & 0x800); }
/// ditto
@property void is_supplementary(bool b) { _setFlag(11, b); }
/// Convenience function, returns '+' or '-' indicating the strand.
@property char strand() const nothrow {
return is_reverse_strand ? '-' : '+';
}
/// ditto
@property void strand(char c) {
enforce(c == '-' || c == '+', "Strand must be '-' or '+'");
is_reverse_strand = c == '-';
}
/// Read name, length must be in 1..255 interval.
@property string name() const nothrow {
// notice -1: the string is zero-terminated, so we should strip that '\0'
return cast(string)(_chunk[_read_name_offset .. _read_name_offset + _l_read_name - 1]);
}
/// ditto
@property void name(string new_name) {
enforce(new_name.length >= 1 && new_name.length <= 255,
"name length must be in 1-255 range");
_dup();
bio.std.hts.utils.array.replaceSlice(_chunk,
_chunk[_read_name_offset .. _read_name_offset + _l_read_name - 1],
cast(ubyte[])new_name);
_l_read_name = cast(ubyte)(new_name.length + 1);
}
/// List of CIGAR operations
@property const(CigarOperation)[] cigar() const nothrow {
return cast(const(CigarOperation)[])(_chunk[_cigar_offset .. _cigar_offset +
_n_cigar_op * CigarOperation.sizeof]);
}
/// ditto
@property void cigar(const(CigarOperation)[] c) {
enforce(c.length < 65536, "Too many CIGAR operations, must be <= 65535");
_dup();
bio.std.hts.utils.array.replaceSlice(_chunk,
_chunk[_cigar_offset .. _cigar_offset + _n_cigar_op * CigarOperation.sizeof],
cast(ubyte[])c);
_n_cigar_op = cast(ushort)(c.length);
_recalculate_bin();
}
/// Extended CIGAR where M operators are replaced with =/X based
/// on information from MD tag. Throws if the read doesn't have MD
/// tag.
auto extended_cigar() @property const {
Value md = this["MD"];
enforce(md.is_string);
return makeExtendedCigar(cigar, mdOperations(*cast(string*)(&md)));
}
/// The number of reference bases covered by this read.
/// $(BR)
/// Returns 0 if the read is unmapped.
int basesCovered() const {
if (this.is_unmapped) {
return 0; // actually, valid alignments should have empty cigar string
}
return reduce!"a + b.length"(0, filter!"a.is_reference_consuming"(cigar));
}
/// Human-readable representation of CIGAR string (same as in SAM format)
string cigarString() const {
char[] str;
// guess size of resulting string
str.reserve(_n_cigar_op * 3);
foreach (cigar_op; cigar) {
str ~= to!string(cigar_op.length);
str ~= cigar_op.type;
}
return cast(string)str;
}
private @property inout(ubyte)[] raw_sequence_data() inout nothrow {
return _chunk[_seq_offset .. _seq_offset + (_l_seq + 1) / 2];
}
/// Read-only random-access range for access to sequence data.
static struct SequenceResult {
private size_t _index;
private ubyte[] _data = void;
private size_t _len = void;
private bool _use_first_4_bits = void;
this(const(ubyte[]) data, size_t len, bool use_first_4_bits=true) {
_data = cast(ubyte[])data;
_len = len;
_use_first_4_bits = use_first_4_bits;
}
///
@property bool empty() const {
return _index >= _len;
}
///
@property bio.core.base.Base front() const {
return opIndex(0);
}
///
@property bio.core.base.Base back() const {
return opIndex(_len - 1);
}
/*
I have no fucking idea why this tiny piece of code
does NOT get inlined by stupid DMD compiler.
Therefore I use string mixin instead.
(hell yeah! Back to the 90s! C macros rulez!)
private size_t _getActualPosition(size_t index) const
{
if (_use_first_4_bits) {
// [0 1] [2 3] [4 5] [6 7] ...
// |
// V
// 0 1 2 3
return index >> 1;
} else {
// [. 0] [1 2] [3 4] [5 6] ...
// |
// V
// 0 1 2 3
return (index >> 1) + (index & 1);
}
}*/
private static string _getActualPosition(string index) {
return "((" ~ index ~") >> 1) + " ~
"(_use_first_4_bits ? 0 : ((" ~ index ~ ") & 1))";
}
private bool _useFirst4Bits(size_t index) const
{
auto res = index % 2 == 0;
if (!_use_first_4_bits) {
res = !res;
}
return res;
}
///
@property SequenceResult save() const {
return SequenceResult(_data[mixin(_getActualPosition("_index")) .. $],
_len - _index,
_useFirst4Bits(_index));
}
///
SequenceResult opSlice(size_t i, size_t j) const {
return SequenceResult(_data[mixin(_getActualPosition("_index + i")) .. $],
j - i,
_useFirst4Bits(_index + i));
}
///
@property bio.core.base.Base opIndex(size_t i) const {
auto pos = _index + i;
if (_use_first_4_bits)
{
if (pos & 1)
return Base.fromInternalCode(_data[pos >> 1] & 0xF);
else
return Base.fromInternalCode(_data[pos >> 1] >> 4);
}
else
{
if (pos & 1)
return Base.fromInternalCode(_data[(pos >> 1) + 1] >> 4);
else
return Base.fromInternalCode(_data[pos >> 1] & 0xF);
}
assert(false);
}
/// ditto
@property void opIndexAssign(bio.core.base.Base base, size_t i) {
auto pos = _index + i;
if (_use_first_4_bits)
{
if (pos & 1)
_data[pos >> 1] &= 0xF0, _data[pos >> 1] |= base.internal_code;
else
_data[pos >> 1] &= 0x0F, _data[pos >> 1] |= base.internal_code << 4;
}
else
{
if (pos & 1)
_data[(pos >> 1) + 1] &= 0x0F, _data[(pos >> 1) + 1] |= base.internal_code << 4;
else
_data[pos >> 1] &= 0xF0, _data[pos >> 1] |= base.internal_code;
}
}
///
void popFront() {
++_index;
}
///
void popBack() {
--_len;
}
///
@property size_t length() const {
return _len - _index;
}
alias length opDollar;
void toString(scope void delegate(const(char)[]) dg) const {
char[256] buf = void;
size_t total = this.length;
size_t written = 0;
while (written < total) {
size_t n = min(buf.length, total - written);
foreach (j; 0 .. n)
buf[j] = opIndex(written + j).asCharacter;
dg(buf[0 .. n]);
written += n;
}
}
}
/// Random-access range of characters
@property SequenceResult sequence() const {
return SequenceResult(raw_sequence_data, sequence_length);
}
static assert(isRandomAccessRange!(ReturnType!sequence));
/// Sets query sequence. Sets all base qualities to 255 (i.e. unknown).
@property void sequence(string seq)
{
_dup();
auto raw_length = (seq.length + 1) / 2;
// set sequence
auto replacement = uninitializedArray!(ubyte[])(raw_length + seq.length);
replacement[raw_length .. $] = 0xFF;
for (size_t i = 0; i < raw_length; ++i) {
replacement[i] = cast(ubyte)(Base(seq[2 * i]).internal_code << 4);
if (seq.length > 2 * i + 1)
replacement[i] |= cast(ubyte)(Base(seq[2 * i + 1]).internal_code);
}
bio.std.hts.utils.array.replaceSlice(_chunk,
_chunk[_seq_offset .. _tags_offset],
replacement);
_l_seq = cast(int)seq.length;
}
/// Quality data (phred-based scores)
@property inout(ubyte)[] base_qualities() inout nothrow {
return _chunk[_qual_offset .. _qual_offset + _l_seq * char.sizeof];
}
/// Set quality data - array length must be of the same length as the sequence.
@property void base_qualities(const(ubyte)[] quality) {
enforce(quality.length == _l_seq, "Quality data must be of the same length as sequence");
_dup();
_chunk[_qual_offset .. _qual_offset + _l_seq] = quality;
}
/*
Constructs the struct from memory chunk
*/
this(ubyte[] chunk, bool fix_byte_order=true) {
// Switching endianness lazily is not a good idea:
//
// 1) switching byte order is pretty fast
// 2) lazy switching for arrays can kill the performance,
// it has to be done once
// 3) the code will be too complicated, whereas there're
// not so many users of big-endian systems
//
// In summa, BAM is little-endian format, so big-endian
// users will suffer anyway, it's unavoidable.
_chunk = chunk;
this._is_slice = true;
if (fix_byte_order && std.system.endian != Endian.littleEndian) {
switchChunkEndianness();
// Dealing with tags is the responsibility of TagStorage.
fixTagStorageByteOrder();
}
}
// Doesn't touch tags, only fields.
// @@@TODO: NEEDS TESTING@@@
private void switchChunkEndianness() {
// First 8 fields are 32-bit integers:
//
// 0) refID int
// 1) pos int
// 2) bin_mq_nl uint
// 3) flag_nc uint
// 4) l_seq int
// 5) next_refID int
// 6) next_pos int
// 7) tlen int
// ----------------------------------------------------
// (after them name follows which is string)
//
switchEndianness(_chunk.ptr, 8 * uint.sizeof);
// Then we need to switch endianness of CIGAR data:
switchEndianness(_chunk.ptr + _cigar_offset,
_n_cigar_op * uint.sizeof);
}
private size_t calculateChunkSize(string read_name,
string sequence,
in CigarOperation[] cigar)
{
return 8 * int.sizeof
+ (read_name.length + 1) // tailing '\0'
+ uint.sizeof * cigar.length
+ ubyte.sizeof * ((sequence.length + 1) / 2)
+ ubyte.sizeof * sequence.length;
}
/// Construct alignment from basic information about it.
///
/// Other fields can be set afterwards.
this(string read_name, // info for developers:
string sequence, // these 3 fields are needed
in CigarOperation[] cigar) // to calculate size of _chunk
{
enforce(read_name.length < 256, "Too long read name, length must be <= 255");
enforce(cigar.length < 65536, "Too many CIGAR operations, must be <= 65535");
if (this._chunk is null) {
this._chunk = new ubyte[calculateChunkSize(read_name, sequence, cigar)];
}
this._refID = -1; // set default values
this._pos = -1; // according to SAM/BAM
this._mapq = 255; // specification
this._next_refID = -1;
this._next_pos = -1;
this._tlen = 0;
this._l_read_name = cast(ubyte)(read_name.length + 1); // tailing '\0'
this._n_cigar_op = cast(ushort)(cigar.length);
this._l_seq = cast(int)(sequence.length);
// now all offsets can be calculated through corresponding properties
// set default quality
_chunk[_qual_offset .. _qual_offset + sequence.length] = 0xFF;
// set CIGAR data
auto _len = cigar.length * CigarOperation.sizeof;
_chunk[_cigar_offset .. _cigar_offset + _len] = cast(ubyte[])(cigar);
// set read_name
auto _offset = _read_name_offset;
_chunk[_offset .. _offset + read_name.length] = cast(ubyte[])read_name;
_chunk[_offset + read_name.length] = cast(ubyte)'\0';
this._is_slice = false;
this.sequence = sequence;
}
/// Deep copy of the record.
BamRead dup() @property const {
BamRead result;
result._chunk = this._chunk.dup;
result._is_slice = false;
result._modify_in_place = false;
result._reader = cast()_reader;
return result;
}
/// Compare two alignments, including tags
/// (the tags must follow in the same order for equality).
bool opEquals(BamRead other) const pure nothrow {
// don't forget about _is_slice trick
auto m = _cigar_offset;
return _chunk[0 .. m - 1] == other._chunk[0 .. m - 1] &&
_chunk[m .. $] == other._chunk[m .. $];
}
bool opEquals(const(BamRead) other) const pure nothrow {
return opEquals(cast()other);
}
/// Size of the alignment record when output to stream in BAM format.
/// Includes block_size as well (see SAM/BAM specification)
@property size_t size_in_bytes() const {
return int.sizeof + _chunk.length;
}
package void write(BamWriter writer) {
writer.writeInteger(cast(int)(_chunk.length));
ubyte old_byte = _chunk[_cigar_offset - 1];
_chunk[_cigar_offset - 1] = 0;
if (std.system.endian != Endian.littleEndian) {
switchChunkEndianness();
writer.writeByteArray(_chunk[0 .. _tags_offset]);
switchChunkEndianness();
} else {
writer.writeByteArray(_chunk[0 .. _tags_offset]);
}
_chunk[_cigar_offset - 1] = old_byte;
writeTags(writer);
}
/// Packs message in the following format:
/// $(BR)
/// MsgPack array with elements
/// $(OL
/// $(LI name - string)
/// $(LI flag - ushort)
/// $(LI reference sequence id - int)
/// $(LI leftmost mapping position (1-based) - int)
/// $(LI mapping quality - ubyte)
/// $(LI array of CIGAR operation lengths - int[])
/// $(LI array of CIGAR operation types - ubyte[])
/// $(LI mate reference sequence id - int)
/// $(LI mate position (1-based) - int)
/// $(LI template length - int)
/// $(LI segment sequence - string)
/// $(LI phred-base quality - ubyte[])
/// $(LI tags - map: string -> value))
void toMsgpack(Packer)(ref Packer packer) const {
packer.beginArray(13);
packer.pack(cast(ubyte[])name);
packer.pack(flag);
packer.pack(ref_id);
packer.pack(position + 1);
packer.pack(mapping_quality);
packer.pack(array(map!"a.length"(cigar)));
packer.pack(array(map!"a.type"(cigar)));
packer.pack(mate_ref_id);
packer.pack(mate_position);
packer.pack(template_length);
packer.pack(to!string(sequence));
packer.pack(base_qualities);
packer.beginMap(tagCount());
foreach (key, value; this) {
packer.pack(key);
packer.pack(value);
}
}
/// String representation.
/// $(BR)
/// Possible formats are SAM ("%s") and JSON ("%j")
void toString(scope void delegate(const(char)[]) sink, FormatSpec!char fmt) const {
if (size_in_bytes < 10000 && fmt.spec == 's') {
auto p = cast(char*)alloca(size_in_bytes * 5);
char* end = p;
toSam(end);
sink(p[0 .. end - p]);
} else if (size_in_bytes < 5000 && fmt.spec == 'j') {
auto p = cast(char*)alloca(size_in_bytes * 10 + 1000);
char* end = p;
toJson(end);
sink(p[0 .. end - p]);
} else if (fmt.spec == 's') {
toSam(sink);
} else if (fmt.spec == 'j') {
toJson(sink);
} else {
throw new FormatException("unknown format specifier");
}
}
/// ditto
void toSam(Sink)(auto ref Sink sink) const
if (isSomeSink!Sink)
{
sink.write(name);
sink.write('\t');
sink.write(flag);
sink.write('\t');
if (ref_id == -1 || _reader is null)
sink.write('*');
else
sink.write(_reader.reference_sequences[ref_id].name);
sink.write('\t');
sink.write(position + 1);
sink.write('\t');
sink.write(mapping_quality);
sink.write('\t');
if (cigar.length == 0)
sink.write('*');
else
foreach (op; cigar)
op.toSam(sink);
sink.write('\t');
if (mate_ref_id == ref_id) {
if (mate_ref_id == -1)
sink.write("*\t");
else
sink.write("=\t");
} else {
if (mate_ref_id == -1 || _reader is null) {
sink.write("*\t");
} else {
auto mate_name = _reader.reference_sequences[mate_ref_id].name;
sink.write(mate_name);
sink.write("\t");
}
}
sink.write(mate_position + 1);
sink.write('\t');
sink.write(template_length);
sink.write('\t');
if (sequence_length == 0)
sink.write('*');
else
foreach (char c; sequence)
sink.write(c);
sink.write('\t');
if (base_qualities.length == 0 || base_qualities[0] == 0xFF)
sink.write('*');
else
foreach (qual; base_qualities)
sink.write(cast(char)(qual + 33));
foreach (k, v; this) {
sink.write('\t');
sink.write(k);
sink.write(':');
v.toSam(sink);
}
}
/// ditto
string toSam()() const {
return to!string(this);
}
/// JSON representation
void toJson(Sink)(auto ref Sink sink) const
if (isSomeSink!Sink)
{
sink.write(`{"qname":`); sink.writeJson(name);
sink.write(`,"flag":`); sink.write(flag);
sink.write(`,"rname":`);
if (ref_id == -1 || _reader is null)
sink.write(`"*"`);
else
sink.writeJson(_reader.reference_sequences[ref_id].name);
sink.write(`,"pos":`); sink.write(position + 1);
sink.write(`,"mapq":`); sink.write(mapping_quality);
sink.write(`,"cigar":"`);
if (cigar.empty)
sink.write('*');
else
foreach (op; cigar)
op.toSam(sink);
sink.write('"');
sink.write(`,"rnext":`);
if (mate_ref_id == ref_id) {
if (mate_ref_id == -1)
sink.write(`"*"`);
else
sink.write(`"="`);
} else if (mate_ref_id == -1 || _reader is null) {
sink.write(`"*"`);
} else {
sink.writeJson(_reader.reference_sequences[mate_ref_id].name);
}
sink.write(`,"pnext":`); sink.write(mate_position + 1);
sink.write(`,"tlen":`); sink.write(template_length);
sink.write(`,"seq":"`);
if (sequence_length == 0)
sink.write('*');
else
foreach (char c; sequence)
sink.write(c);
sink.write('"');
sink.write(`,"qual":`);
sink.writeJson(base_qualities);
sink.write(`,"tags":{`);
bool not_first = false;
foreach (k, v; this) {
if (not_first)
sink.write(',');
sink.writeJson(k);
sink.write(':');
v.toJson(sink);
not_first = true;
}
sink.write("}}");
}
/// ditto
string toJson()() const {
auto w = appender!(char[])();
toJson((const(char)[] s) { w.put(s); });
return cast(string)w.data;
}
/// Associates read with BAM reader. This is done automatically
/// if this read is obtained through BamReader/Reference methods.
void associateWithReader(bio.std.hts.bam.abstractreader.IBamSamReader reader) {
_reader = reader;
}
/// Associated BAM/SAM reader.
inout(bio.std.hts.bam.abstractreader.IBamSamReader) reader() @property inout {
return _reader;
}
///
bool is_slice_backed() @property const {
return _is_slice;
}
/// Raw representation of the read. Occasionally useful for dirty hacks!
inout(ubyte)[] raw_data() @property inout {
return _chunk;
}
/// ditto
void raw_data(ubyte[] data) @property {
_chunk = data;
}
package ubyte[] _chunk; // holds all the data,
// the access is organized via properties
// (see below)
private:
// by specs, name ends with '\0'
// let's use this byte for something useful!
//
// (Of course this places some restrictions on usage,
// but allows to reduce size of record.)
bool _is_slice() @property const {
return cast(bool)(_chunk[_cigar_offset - 1] & 1);
}
void _is_slice(bool is_slice) @property {
_chunk[_cigar_offset - 1] &= 0b11111110;
_chunk[_cigar_offset - 1] |= (is_slice ? 1 : 0);
}
// don't call _dup() if the record is modified
bool _modify_in_place() @property const {
return cast(bool)(_chunk[_cigar_offset - 1] & 2);
}
void _modify_in_place(bool in_place) @property {
_chunk[_cigar_offset - 1] &= 0b11111101;
_chunk[_cigar_offset - 1] |= (in_place ? 2 : 0);
}
IBamSamReader _reader;
string _ref_id_to_string(int ref_id) const nothrow {
if (_reader is null)
return "?";
if (ref_id < 0)
return "*";
return _reader.reference_sequences[ref_id].name;
}
// Official field names from SAM/BAM specification.
// For internal use only
@property int _refID() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 0));
}
@property int _pos() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 1));
}
@property uint _bin_mq_nl() const nothrow pure @system {
return *(cast(uint*)(_chunk.ptr + int.sizeof * 2));
}
@property uint _flag_nc() const nothrow {
return *(cast(uint*)(_chunk.ptr + int.sizeof * 3));
}
@property int _l_seq() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 4));
}
@property int _next_refID() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 5));
}
@property int _next_pos() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 6));
}
@property int _tlen() const nothrow {
return *(cast( int*)(_chunk.ptr + int.sizeof * 7));
}
// Setters, also only for internal use
@property void _refID(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 0)) = n; }
@property void _pos(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 1)) = n; }
@property void _bin_mq_nl(uint n) { *(cast(uint*)(_chunk.ptr + int.sizeof * 2)) = n; }
@property void _flag_nc(uint n) { *(cast(uint*)(_chunk.ptr + int.sizeof * 3)) = n; }
@property void _l_seq(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 4)) = n; }
@property void _next_refID(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 5)) = n; }
@property void _next_pos(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 6)) = n; }
@property void _tlen(int n) { *(cast( int*)(_chunk.ptr + int.sizeof * 7)) = n; }
// Additional useful properties, also from SAM/BAM specification
//
// The layout of bin_mq_nl and flag_nc is as follows
// (upper bits -------> lower bits):
//
// bin_mq_nl [ { bin (16b) } { mapping quality (8b) } { read name length (8b) } ]
//
// flag_nc [ { flag (16b) } { n_cigar_op (16b) } ]
//
@property ushort _bin() const nothrow {
return _bin_mq_nl >> 16;
}
@property ubyte _mapq() const nothrow {
return (_bin_mq_nl >> 8) & 0xFF;
}
@property ubyte _l_read_name() const nothrow pure {
return _bin_mq_nl & 0xFF;
}
@property ushort _flag() const nothrow {
return _flag_nc >> 16;
}
@property ushort _n_cigar_op() const nothrow {
return _flag_nc & 0xFFFF;
}
// Setters for those properties
@property void _bin(ushort n) { _bin_mq_nl = (_bin_mq_nl & 0xFFFF) | (n << 16); }
@property void _mapq(ubyte n) { _bin_mq_nl = (_bin_mq_nl & ~0xFF00) | (n << 8); }
@property void _l_read_name(ubyte n) { _bin_mq_nl = (_bin_mq_nl & ~0xFF ) | n; }
@property void _flag(ushort n) { _flag_nc = (_flag_nc & 0xFFFF) | (n << 16); }
@property void _n_cigar_op(ushort n) { _flag_nc = (_flag_nc & ~0xFFFF) | n; }
// Offsets of various arrays in bytes.
// Currently, are computed each time, so if speed will be an issue,
// they can be made fields instead of properties.
@property size_t _read_name_offset() const nothrow pure {
return 8 * int.sizeof;
}
@property size_t _cigar_offset() const nothrow pure {
return _read_name_offset + _l_read_name * char.sizeof;
}
@property size_t _seq_offset() const nothrow {
return _cigar_offset + _n_cigar_op * uint.sizeof;
}
@property size_t _qual_offset() const nothrow {
return _seq_offset + (_l_seq + 1) / 2;
}
// Offset of auxiliary data
@property size_t _tags_offset() const nothrow {
return _qual_offset + _l_seq;
}
// Sets n-th flag bit to boolean value b.
void _setFlag(int n, bool b) {
assert(n < 16);
// http://graphics.stanford.edu/~seander/bithacks.html#ConditionalSetOrClearBitsWithoutBranching
ushort mask = cast(ushort)(1 << n);
_flag = (_flag & ~cast(int)(mask)) | ((-cast(int)b) & mask);
}
// If _chunk is still a slice, not an array, duplicate it.
// Used when some part of alignment record is modified by user.
//
// Basically, it's sort of copy-on-write: a lot of read-only alignments
// may point to the same location, but every modified one allocates its
// own chunk of memory.
void _dup() {
if (_is_slice && !_modify_in_place) {
_chunk = _chunk.dup;
_is_slice = false;
}
}
public:
// Calculates bin number.
void _recalculate_bin() {
_bin = reg2bin(position, position + basesCovered());
}
}
/// Lazy tag storage.
///
/// Provides hash-like access and opportunity to iterate
/// storage like an associative array.
mixin template TagStorage() {
// Provides access to chunk of memory which contains tags.
// This way, every time _tags_offset gets updated
// (due to update of cigar string/read name/sequence and memory move),
// the change is reflected automatically in tag storage.
private @property const(ubyte)[] _tags_chunk() const {
return _chunk[_tags_offset .. $];
}
/// Hash-like access to tags. Time complexity is $(BIGOH number of tags).
/// $(BR)
/// If tag with such $(I key) is not found, returned value 'is nothing'.
/// $(BR)
/// If key length is different from 2, exception is thrown.
/// $(BR)
/// Special case when $(I value) represents nothing is used for removing tag
/// (assuming that no more than one with this key is presented in the record).
///
/// Examples:
/// ----------------------------
/// auto v = read["NM"];
/// assert(v.is_integer);
///
/// auto v = read["MN"];
/// assert(v.is_nothing); // no such tag
///
/// read["NM"] = 3; // converted to bio.std.hts.bam.tagvalue.Value implicitly
///
/// read["NM"] = null; // removes tag
/// assert(read["NM"].is_nothing);
/// ----------------------------
bio.std.hts.bam.tagvalue.Value opIndex(string key) const {
enforce(key.length == 2, "Key length must be 2");
auto __tags_chunk = _tags_chunk; // _tags_chunk is evaluated lazily
if (__tags_chunk.length < 4)
return Value(null);
size_t offset = 0;
while (offset + 1 < __tags_chunk.length) {
if (__tags_chunk[offset .. offset + 2] == key) {
offset += 2;
return readValue(offset, __tags_chunk);
} else {
offset += 2;
skipValue(offset, __tags_chunk);
}
}
return Value(null);
}
/// ditto
void opIndexAssign(T)(T value, string key)
if (is(T == Value) || __traits(compiles, GetTypeId!T))
{
static if(is(T == Value)) {
enforce(key.length == 2, "Key length must be 2");
auto __tags_chunk = _tags_chunk;
_dup();
size_t offset = 0;
while (offset + 1 < __tags_chunk.length) {
if (__tags_chunk[offset .. offset + 2] == key) {
if (value.is_nothing) {
// special case - remove tag
removeValueAt(offset);
} else {
replaceValueAt(offset + 2, value);
}
return;
} else {
offset += 2;
skipValue(offset, __tags_chunk);
}
}
if (!value.is_nothing)
appendTag(key, value);
} else {
opIndexAssign(Value(value), key);
}
}
/// Append new tag to the end, skipping check if it already exists. $(BIGOH 1)
void appendTag(string key, Value value) {
auto oldlen = _chunk.length;
_chunk.length = _chunk.length + sizeInBytes(value) + 2 * char.sizeof;
_chunk[oldlen .. oldlen + 2] = cast(ubyte[])key;
emplaceValue(_chunk.ptr + oldlen + 2, value);
}
/// Remove all tags
void clearAllTags() {
_chunk.length = _tags_offset;
}
/// Number of tags. $(BIGOH number of tags)
size_t tagCount() {
size_t result = 0;
size_t offset = 0;
auto __tags_chunk = _tags_chunk;
while (offset + 1 < __tags_chunk.length) {
offset += 2;
skipValue(offset, __tags_chunk);
result += 1;
}
return result;
}
// replace existing tag
private void replaceValueAt(size_t offset, Value value) {
// offset points to the beginning of the value
auto begin = offset;
auto __tags_chunk = _tags_chunk;
skipValue(offset, __tags_chunk); // now offset is updated and points to the end
auto end = offset;
prepareSlice(_chunk, __tags_chunk[begin .. end], sizeInBytes(value));
emplaceValue(_chunk.ptr + _tags_offset + begin, value);
}
// remove existing tag
private void removeValueAt(size_t begin) {
// offset points to the beginning of the value
auto offset = begin + 2;
auto __tags_chunk = _tags_chunk;
skipValue(offset, __tags_chunk);
auto end = offset;
// this does the job (see prepareSlice code)
prepareSlice(_chunk, __tags_chunk[begin .. end], 0);
}
/// Provides opportunity to iterate over tags.
int opApply(scope int delegate(const ref string k, const ref Value v) dg) const {
size_t offset = 0;
auto __tags_chunk = _tags_chunk;
while (offset + 1 < __tags_chunk.length) {
auto key = cast(string)__tags_chunk[offset .. offset + 2];
offset += 2;
auto val = readValue(offset, __tags_chunk);
auto res = dg(key, val);
if (res != 0) {
return res;
}
}
return 0;
}
/// Returns the number of tags. Time complexity is $(BIGOH number of tags)
size_t tagCount() const {
size_t res = 0;
size_t offset = 0;
auto __tags_chunk = _tags_chunk;
while (offset + 1 < __tags_chunk.length) {
offset += 2;
skipValue(offset, __tags_chunk);
res += 1;
}
return res;
}
private void writeTags(BamWriter writer) {
if (std.system.endian == Endian.littleEndian) {
writer.writeByteArray(_tags_chunk[]);
} else {
fixTagStorageByteOrder();
writer.writeByteArray(_tags_chunk[]);
fixTagStorageByteOrder();
}
}
// Reads value which starts from (_tags_chunk.ptr + offset) address,
// and updates offset to the end of value. O(1)
private Value readValue(ref size_t offset, const(ubyte)[] tags_chunk) const {
char type = cast(char)tags_chunk[offset++];
return readValueFromArray(type, tags_chunk, offset);
}
// Increases offset so that it points to the next value. O(1).
private void skipValue(ref size_t offset, const(ubyte)[] tags_chunk) const {
char type = cast(char)tags_chunk[offset++];
if (type == 'Z' || type == 'H') {
while (tags_chunk[offset++] != 0) {}
} else if (type == 'B') {
char elem_type = cast(char)tags_chunk[offset++];
auto length = *(cast(uint*)(tags_chunk.ptr + offset));
offset += uint.sizeof + charToSizeof(elem_type) * length;
} else {
offset += charToSizeof(type);
}
}
/*
Intended to be used in constructor for initial endianness fixing
in case the library is used on big-endian system.
NOT TESTED AT ALL!!!
*/
private void fixTagStorageByteOrder() {
/* TODO: TEST ON BIG-ENDIAN SYSTEM!!! */
const(ubyte)* p = _tags_chunk.ptr;
const(ubyte)* end = p + _chunk.length;
while (p < end) {
p += 2; // skip tag name
char type = *(cast(char*)p);
++p; // skip type
if (type == 'Z' || type == 'H') {
while (*p != 0) { // zero-terminated
++p; // string
}
++p; // skip '\0'
} else if (type == 'B') { // array
char elem_type = *(cast(char*)p);
uint size = charToSizeof(elem_type);
switchEndianness(p, uint.sizeof);
uint length = *(cast(uint*)p);
p += uint.sizeof; // skip length
if (size != 1) {
for (auto j = 0; j < length; j++) {
switchEndianness(p, size);
p += size;
}
} else {
// skip
p += length;
}
} else {
uint size = charToSizeof(type);
if (size != 1) {
switchEndianness(p, size);
p += size;
} else {
++p;
}
}
}
}
}
unittest {
import std.algorithm;
import std.stdio;
import std.math;
// stderr.writeln("Testing BamRead behaviour...");
auto read = BamRead("readname",
"AGCTGACTACGTAATAGCCCTA",
[CigarOperation(22, 'M')]);
assert(read.sequence_length == 22);
assert(read.cigar.length == 1);
assert(read.cigarString() == "22M");
assert(read.name == "readname");
assert(equal(read.sequence(), "AGCTGACTACGTAATAGCCCTA"));
read.name = "anothername";
assert(read.name == "anothername");
assert(read.cigarString() == "22M");
read.base_qualities = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22];
assert(reduce!"a+b"(0, read.base_qualities) == 253);
read["RG"] = 15;
assert(read["RG"] == 15);
read["X1"] = [1, 2, 3, 4, 5];
assert(read["X1"] == [1, 2, 3, 4, 5]);
read.cigar = [CigarOperation(20, 'M'), CigarOperation(2, 'X')];
assert(read.cigarString() == "20M2X");
read["RG"] = cast(float)5.6;
assert(isClose(to!float(read["RG"]), 5.6));
read.sequence = "AGCTGGCTACGTAATAGCCCT";
assert(read.sequence_length == 21);
assert(read.base_qualities.length == 21);
assert(read.base_qualities[20] == 255);
assert(equal(read.sequence(), "AGCTGGCTACGTAATAGCCCT"));
assert(retro(read.sequence)[2] == 'C');
assert(retro(read.sequence)[0] == 'T');
assert(read.sequence[4] == 'G');
assert(read.sequence[0] == 'A');
assert(equal(read.sequence[0..8], "AGCTGGCT"));
assert(equal(read.sequence[3..5], "TG"));
assert(equal(read.sequence[3..9][1..4], "GGC"));
read["X1"] = 42;
assert(read["X1"] == 42);
assert(read.tagCount() == 2);
read["X1"] = null;
assert(read["X1"].is_nothing);
assert(read.tagCount() == 1);
read.sequence = "GTAAGCTGGCACTAGCAGCCT";
read.cigar = [CigarOperation(read.sequence_length, 'M')];
read["RG"] = null;
read["RG"] = "readgroup1";
assert(read.tagCount() == 1);
read["RG"] = null;
assert(read.tagCount() == 0);
read.sequence[5] = Base('N');
read.sequence[6] = Base('A');
read.sequence[7] = Base('C');
read.sequence[8] = Base('G');
read.base_qualities[5] = 42;
assert(read.sequence[5 .. 9].equal("NACG"));
assert(read.base_qualities[5] == 42);
// Test MsgPack serialization/deserialization
{
import std.typecons;
static import bio.std.hts.thirdparty.msgpack;
auto packer = bio.std.hts.thirdparty.msgpack.packer(Appender!(ubyte[])());
read.toMsgpack(packer);
auto data = packer.stream.data;
auto rec = unpack(data).via.array;
assert(rec[0].as!(ubyte[]) == "anothername");
assert(rec[5].as!(int[]) == [21]);
assert(rec[6].as!(ubyte[]) == ['M']);
assert(rec[10].as!(ubyte[]) == to!string(read.sequence));
}
read.clearAllTags();
assert(read.tagCount() == 0);
}
/// $(P BamRead wrapper which precomputes $(D end_position) = $(D position) + $(D basesCovered()).)
///
/// $(P Computation of basesCovered() takes quite a few cycles. Therefore in places where this
/// property is frequently accessed, it makes sense to precompute it for later use.)
///
/// $(P The idea is that this should be a drop-in replacement for BamRead in algorithms,
/// as the struct uses 'alias this' construction for the wrapped read.)
struct EagerBamRead(R=BamRead) {
///
this(R read) {
this.read = read;
this.end_position = read.position + read.basesCovered();
}
///
R read;
///
alias read this;
/// End position on the reference, computed as position + basesCovered().
int end_position;
///
EagerBamRead dup() @property const {
return EagerBamRead(read.dup);
}
}
static assert(is(EagerBamRead!BamRead : BamRead));
/// Checks if $(D T) behaves like $(D BamRead)
template isBamRead(T)
{
static if (is(Unqual!T : BamRead))
enum isBamRead = true;
else
enum isBamRead = __traits(compiles,
{
T t; bool p;
p = t.ref_id == 1; p = t.position == 2; p = t.bin.id == 3;
p = t.mapping_quality == 4; p = t.flag == 5; p = t.sequence_length == 6;
p = t.mate_ref_id == 7; p = t.mate_position == 8; p = t.template_length == 9;
p = t.is_paired; p = t.proper_pair; p = t.is_unmapped;
p = t.mate_is_unmapped; p = t.mate_is_reverse_strand; p = t.is_first_of_pair;
p = t.is_second_of_pair; p = t.is_secondary_alignment; p = t.failed_quality_control;
p = t.is_duplicate; p = t.strand == '+'; p = t.name == "";
p = t.cigar[0].type == 'M'; p = t.basesCovered() > 42; p = t.cigarString() == "";
p = t.sequence[0] == 'A'; p = t.base_qualities[0] == 0;
});
}
// Comparison function for 'queryname' sorting order based on https://github.com/samtools/htsjdk/blob/master/src/main/java/htsjdk/samtools/SAMRecordQueryNameComparator.java
bool compareReadNamesAsPicard(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
{
if(a1.name == a2.name)
{
if(a1.is_paired() || a2.is_paired())
{
if(!a1.is_paired())
return false;
if(!a2.is_paired())
return true;
if(a1.is_first_of_pair() && a2.is_second_of_pair())
return true;
if(a1.is_second_of_pair() && a2.is_first_of_pair())
return false;
}
if(a1.strand() != a2.strand())
{
return a1.strand() == '-' ? false : true;
}
if(a1.is_secondary_alignment() != a2.is_secondary_alignment())
{
return a2.is_secondary_alignment();
}
if(a1.is_supplementary() != a2.is_supplementary())
{
return a2.is_supplementary();
}
if(!a1["HI"].is_nothing)
{
if(a2["HI"].is_nothing)
return true;
int i1 = to!int(a1["HI"]);
int i2 = to!int(a2["HI"]);
return i1 < i2;
}
else
if(!a2["HI"].is_nothing)
return false;
}
return a1.name < a2.name;
}
bool compareReadNamesAsPicard(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isSomeString!R2)
{
return a1.name < a2;
}
bool compareReadNamesAsPicard(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isSomeString!R1 && isBamRead!R2)
{
return a1 < a2.name;
}
/// $(P Comparison function for 'queryname' sorting order
/// (return whether first read is 'less' than second))
///
/// $(P This function can be called on:
/// $(UL
/// $(LI two reads)
/// $(LI read and string in any order)))
bool compareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
{
return a1.name < a2.name;
}
bool compareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isSomeString!R2)
{
return a1.name < a2;
}
bool compareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isSomeString!R1 && isBamRead!R2)
{
return a1 < a2.name;
}
int mixedStrCompare(string a, string b) {
import std.ascii : isDigit;
while (!a.empty && !b.empty) {
if (a.front.isDigit && b.front.isDigit) {
// skip zeros
int za, zb;
while (!a.empty && a.front == '0') { ++za; a.popFront(); }
while (!b.empty && b.front == '0') { ++zb; b.popFront(); }
// skip equal digits
while (!a.empty && !b.empty && a.front.isDigit && a.front == b.front) {
a.popFront();
b.popFront();
}
if (!a.empty && !b.empty && a.front.isDigit && b.front.isDigit) {
// the number of leading digits in each string is non-zero
size_t i = 0, maxi = min(a.length, b.length);
while (i < maxi && a[i].isDigit && b[i].isDigit) ++i;
if (i < a.length && a[i].isDigit) return 1; // a contains more digits
if (i < b.length && b[i].isDigit) return -1; // b contains more digits
// the counts are equal, compare first digits
return cast(byte)a.front - cast(byte)b.front;
} else if (!a.empty && a.front.isDigit) return 1;
else if (!b.empty && b.front.isDigit) return -1;
else if (za != zb) return za - zb; // order by the number of leading zeros
} else {
// lexicographical comparison for non-digits
if (a.front != b.front) return cast(byte)a.front - cast(byte)b.front;
a.popFront(); b.popFront();
}
}
return (!a.empty) ? 1 : (!b.empty) ? -1 : 0;
}
/// $(P Comparison function for 'queryname' sorting order as in Samtools
/// (returns whether first read is 'less' than second in a 'mixed' order,
/// i.e. numbers inside the strings are compared by their integer value))
///
/// $(P This function can be called on:
/// $(UL
/// $(LI two reads)
/// $(LI read and string in any order)))
bool mixedCompareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
{
return mixedStrCompare(a1.name, a2.name) < 0;
}
bool mixedCompareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isSomeString!R2)
{
return mixedStrCompare(a1.name, a2) < 0;
}
bool mixedCompareReadNames(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isSomeString!R1 && isBamRead!R2)
{
return mixedStrCompare(a1, a2.name) < 0;
}
unittest {
assert(mixedStrCompare("BC0123", "BC01234") < 0);
assert(mixedStrCompare("BC0123", "BC0123Z") < 0);
assert(mixedStrCompare("BC01234", "BC01234") == 0);
assert(mixedStrCompare("BC0123DEF45", "BC01234DEF45") < 0);
assert(mixedStrCompare("BC01236DEF45", "BC01234DEF45") > 0);
assert(mixedStrCompare("BC012", "BC0012") < 0);
assert(mixedStrCompare("BC0012DE0034", "BC0012DE34") > 0);
assert(mixedStrCompare("BC12DE0034", "BC012DE34") < 0);
assert(mixedStrCompare("1235", "1234") > 0);
}
// small utility function to get the value of the HI tag and return '0'
// if it is not defined
private int getHI(R)(auto ref R r)
if (isBamRead!R)
{
auto v = r["HI"];
if (v.is_nothing)
return 0;
return to!int(v);
}
/// $(P Comparison function for 'queryname' sorting order setting mates
/// of the same alignments adjacent with the first mate coming before
/// the second mate)
bool compareReadNamesAndMates(R1, R2)(const auto ref R1 r1, const auto ref R2 r2)
if (isBamRead!R1 && isBamRead!R2)
{
if (r1.name == r2.name) {
if (getHI(r1) == getHI(r2))
return r1.flag() < r2.flag();
return getHI(r1) < getHI(r2);
}
return r1.name < r2.name;
}
/// $(P Comparison function for 'queryname' sorting order as in Samtools
/// setting mates of the same alignments adjacent with the first mate
/// coming before the second mate)
bool mixedCompareReadNamesAndMates(R1, R2)(const auto ref R1 r1, const auto ref R2 r2)
if (isBamRead!R1 && isBamRead!R2)
{
if (mixedStrCompare(r1.name, r2.name) == 0) {
if (getHI(r1) == getHI(r2))
return r1.flag() < r2.flag();
return getHI(r1) < getHI(r2);
}
return mixedStrCompare(r1.name, r2.name) < 0;
}
/// $(P Comparison function for 'coordinate' sorting order
/// (returns whether first read is 'less' than second))
///
/// $(P This function can be called on:
/// $(UL
/// $(LI two reads (in this case, reference IDs are also taken into account))
/// $(LI read and integer in any order)))
/// This function takes read direction into account (used for original samtools style sorting)
bool compareCoordinatesAndStrand(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
{
if (a1.ref_id == -1) return false; // unmapped reads should be last
if (a2.ref_id == -1) return true;
if (a1.ref_id < a2.ref_id) return true;
if (a1.ref_id > a2.ref_id) return false;
if (a1.position < a2.position) return true;
if (a1.position > a2.position) return false;
return !a1.is_reverse_strand && a2.is_reverse_strand;
}
bool compareCoordinates(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isBamRead!R2)
{
if (a1.ref_id == -1) return false; // unmapped reads should be last
if (a2.ref_id == -1) return true;
if (a1.ref_id < a2.ref_id) return true;
if (a1.ref_id > a2.ref_id) return false;
return (a1.position < a2.position);
}
bool compareCoordinates(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isBamRead!R1 && isIntegral!R2)
{
return a1.position < a2;
}
bool compareCoordinates(R1, R2)(const auto ref R1 a1, const auto ref R2 a2)
if (isIntegral!R1 && isBamRead!R2)
{
return a1 < a2.position;
}
static assert(isTwoWayCompatible!(compareReadNames, BamRead, string));
static assert(isTwoWayCompatible!(compareCoordinates, BamRead, int));
/// Allows modification of the read in-place even if it's slice-backed.
struct UniqueRead(R) {
R read;
alias read this;
this(R read) {
this.read = read;
this.read._modify_in_place = true;
}
~this() {
this.read._modify_in_place = false;
}
}
/// ditto
auto assumeUnique(R)(auto ref R read) if (isBamRead!R) {
return UniqueRead!R(read);
}
|