File: test_align_split.h

package info (click to toggle)
seqan2 2.4.0+dfsg-11~bpo9+1
  • links: PTS, VCS
  • area: main
  • in suites: stretch-backports
  • size: 223,500 kB
  • sloc: cpp: 256,886; ansic: 91,672; python: 8,339; sh: 995; xml: 570; makefile: 251; awk: 51
file content (561 lines) | stat: -rw-r--r-- 23,819 bytes parent folder | download | duplicates (3)
// ==========================================================================
//                 SeqAn - The Library for Sequence Analysis
// ==========================================================================
// Copyright (c) 2006-2018, Knut Reinert, FU Berlin
// All rights reserved.
// Redistribution and use in source and binary forms, with or without
// modification, are permitted provided that the following conditions are met:
//     * Redistributions of source code must retain the above copyright
//       notice, this list of conditions and the following disclaimer.
//     * Redistributions in binary form must reproduce the above copyright
//       notice, this list of conditions and the following disclaimer in the
//       documentation and/or other materials provided with the distribution.
//     * Neither the name of Knut Reinert or the FU Berlin nor the names of
//       its contributors may be used to endorse or promote products derived
//       from this software without specific prior written permission.
// ==========================================================================
// Author: Manuel Holtgrewe <>
// ==========================================================================
// Tests for the align_split module.
// ==========================================================================


#include <seqan/basic.h>
#include <seqan/sequence.h>

#include <seqan/align_split.h>

    // Define the input sequences.
    seqan::DnaString seqL =   "AGCCTGTTAGATAAGATAGCTGTGGT";
    seqan::DnaString seqR =                         "GGCTAGTAGGCAGTCAGCGACAT";

    // Variables for the alignments.
    seqan::Align<seqan::DnaString> alignL, alignR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    resize(rows(alignL), 2);
    assignSource(row(alignL, 0), contig);
    assignSource(row(alignL, 1), seqL);
    resize(rows(alignR), 2);
    assignSource(row(alignR, 0), contig);
    assignSource(row(alignR, 1), seqR);

    int res = splitAlignment(alignL, alignR, score);
    // clearClipping(row(alignL, 0));
    // clearClipping(row(alignL, 1));
    // clearClipping(row(alignR, 0));
    // clearClipping(row(alignR, 1));
    // std::cerr << "alignL\n"
    //           << alignL
    //           << "--------------\n"
    //           << "alignR\n"
    //           << alignR;
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << row(alignL, 0) << row(alignR, 0);
    SEQAN_ASSERT_EQ(contig, contigS.str());

    SEQAN_ASSERT_EQ(seqan::CharString("AGCATGTTAGATAAGATAGCTGT"), row(alignL, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("AGCCTGTTAGATAAGATAGCTGT"), row(alignL, 1));
    SEQAN_ASSERT_EQ(clippedBeginPosition(row(alignL, 0)), 0);
    SEQAN_ASSERT_EQ(clippedBeginPosition(row(alignL, 1)), 0);
    SEQAN_ASSERT_EQ(clippedEndPosition(row(alignL, 0)), 23);
    SEQAN_ASSERT_EQ(clippedEndPosition(row(alignL, 1)), 23);

    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGCCAT"), row(alignR, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGACAT"), row(alignR, 1));
    SEQAN_ASSERT_EQ(clippedBeginPosition(row(alignR, 0)), 23);
    SEQAN_ASSERT_EQ(clippedBeginPosition(row(alignR, 1)), 1);
    SEQAN_ASSERT_EQ(clippedEndPosition(row(alignR, 0)), 45);
    SEQAN_ASSERT_EQ(clippedEndPosition(row(alignR, 1)), 23);

    // Define the input sequences.
    seqan::DnaString contig = "AGCATGTTAGATAAGATAGCTGTGCT"                                   "AGTAGGCAGTCAGCGCCAT";

    // Variables for the alignments.
    seqan::Align<seqan::DnaString> alignL, alignR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    resize(rows(alignL), 2);
    assignSource(row(alignL, 0), contig);
    assignSource(row(alignL, 1), seqL);
    resize(rows(alignR), 2);
    assignSource(row(alignR, 0), contig);
    assignSource(row(alignR, 1), seqR);

    int res = splitAlignment(alignL, alignR, score);
    // clearClipping(row(alignL, 0));
    // clearClipping(row(alignL, 1));
    // clearClipping(row(alignR, 0));
    // clearClipping(row(alignR, 1));
    // std::cerr << "alignL\n"
    //           << alignL
    //           << "--------------\n"
    //           << "alignR\n"
    //           << alignR;
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << row(alignL, 0) << row(alignR, 0);
    SEQAN_ASSERT_EQ(contig, contigS.str());

    SEQAN_ASSERT_EQ(seqan::CharString("AGCATGTTAGATAAGATAGCTGT"), row(alignL, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("AGCCTGTTAGATAAGATAGCTGT"), row(alignL, 1));
    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGCCAT"), row(alignR, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGACAT"), row(alignR, 1));

    // Define the input sequences.  contig1 has an insertion with respect to contig1.

    // Variables for the alignments.
    seqan::Align<seqan::DnaString> alignL, alignR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    resize(rows(alignL), 2);
    assignSource(row(alignL, 0), contig1);
    assignSource(row(alignL, 1), contig2);
    resize(rows(alignR), 2);
    assignSource(row(alignR, 0), contig1);
    assignSource(row(alignR, 1), contig2);

    int res = splitAlignment(alignL, alignR, score);
    // clearClipping(row(alignL, 0));
    // clearClipping(row(alignL, 1));
    // clearClipping(row(alignR, 0));
    // clearClipping(row(alignR, 1));
    // std::cerr << "alignL\n"
    //           << alignL
    //           << "--------------\n"
    //           << "alignR\n"
    //           << alignR;
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << row(alignL, 0) << row(alignR, 0);
    SEQAN_ASSERT_EQ(contig1, contigS.str());

    SEQAN_ASSERT_EQ(seqan::CharString("AGCATTTTAGATAAGATAG"), row(alignL, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("AGCATGTTAGATAAGATAG"), row(alignL, 1));
    SEQAN_ASSERT_EQ(seqan::CharString("CTGTGCTAGTAGGCAGTCAGCGCCTT"), row(alignR, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("CTGTGCTAGTAGGCAGTCAGCGCCAT"), row(alignR, 1));

    // Define the input sequences.
    seqan::DnaString seqL =   "AGCCTGTTAGATAAGATAGCTGTGGT";
    seqan::DnaString seqR =                         "GGCTAGTAGGCAGTCAGCGACAT";

    // Variables for the alignments.
    seqan::Gaps<seqan::DnaString> gapsHL, gapsVL, gapsHR, gapsVR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    assignSource(gapsHL, contig);
    assignSource(gapsVL, seqL);
    assignSource(gapsHR, contig);
    assignSource(gapsVR, seqR);

    int res = splitAlignment(gapsHL, gapsVL, gapsHR, gapsVR, score);
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << gapsHL << gapsHR;
    SEQAN_ASSERT_EQ(contig, contigS.str());


    // Define the input sequences.
    seqan::DnaString contig = "AGCATGTTAGATAAGATAGCTGTGCT"                                   "AGTAGGCAGTCAGCGCCAT";

    // Variables for the alignments.
    seqan::Gaps<seqan::DnaString> gapsHL, gapsVL, gapsHR, gapsVR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    assignSource(gapsHL, contig);
    assignSource(gapsVL, seqL);
    assignSource(gapsHR, contig);
    assignSource(gapsVR, seqR);

    int res = splitAlignment(gapsHL, gapsVL, gapsHR, gapsVR, score);
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << gapsHL << gapsHR;
    SEQAN_ASSERT_EQ(contig, contigS.str());


    // Define the input sequences.  contig1 has an insertion with respect to contig1.

    // Variables for the alignments.
    seqan::Gaps<seqan::DnaString> gapsHL, gapsVL, gapsHR, gapsVR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    assignSource(gapsHL, contig1);
    assignSource(gapsVL, contig2);
    assignSource(gapsHR, contig1);
    assignSource(gapsVR, contig2);

    int res = splitAlignment(gapsHL, gapsVL, gapsHR, gapsVR, score);
    // clearClipping(gapsHL);
    // clearClipping(gapsVL);
    // clearClipping(gapsHR);
    // clearClipping(gapsVR);
    // std::cerr << "gapsHL\n"
    //           << gapsHL << "\n"
    //           << "gapsVL\n"
    //           << gapsVL << "\n"
    //           << "gapsHL\n"
    //           << gapsHL << "\n"
    //           << "gapsHR\n"
    //           << gapsHR << "\n";
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << gapsHL << gapsHR;
    SEQAN_ASSERT_EQ(contig1, contigS.str());


    // Define the input sequences.
    seqan::DnaString seqL =   "AGCCTGTTAGATAAGATAGCTGTGGT";
    seqan::DnaString seqR =                         "GGCTAGTAGGCAGTCAGCGACAT";

    // Variables for the alignments.
    seqan::Align<seqan::DnaString> alignL, alignR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    resize(rows(alignL), 2);
    assignSource(row(alignL, 0), contig);
    assignSource(row(alignL, 1), seqL);
    resize(rows(alignR), 2);
    assignSource(row(alignR, 0), contig);
    assignSource(row(alignR, 1), seqR);

    int res = splitAlignment(alignL, alignR, score, -10, 10);

    // clearClipping(row(alignL, 0));
    // clearClipping(row(alignL, 1));
    // clearClipping(row(alignR, 0));
    // clearClipping(row(alignR, 1));
    // std::cerr << "alignL\n"
    //           << alignL
    //           << "--------------\n"
    //           << "alignR\n"
    //           << alignR;

    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << row(alignL, 0) << row(alignR, 0);
    SEQAN_ASSERT_EQ(contig, contigS.str());

    SEQAN_ASSERT_EQ(seqan::CharString("AGCATGTTAGATAAGATAGCTGT"), row(alignL, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("AGCCTGTTAGATAAGATAGCTGT"), row(alignL, 1));
    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGCCAT"), row(alignR, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGACAT"), row(alignR, 1));

    // Define the input sequences.
    seqan::DnaString contig = "AGCATGTTAGATAAGATAGCTGTGCT"                                   "AGTAGGCAGTCAGCGCCAT";

    // Variables for the alignments.
    seqan::Align<seqan::DnaString> alignL, alignR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    resize(rows(alignL), 2);
    assignSource(row(alignL, 0), contig);
    assignSource(row(alignL, 1), seqL);
    resize(rows(alignR), 2);
    assignSource(row(alignR, 0), contig);
    assignSource(row(alignR, 1), seqR);

    int res = splitAlignment(alignL, alignR, score, -10, 10);
    // clearClipping(row(alignL, 0));
    // clearClipping(row(alignL, 1));
    // clearClipping(row(alignR, 0));
    // clearClipping(row(alignR, 1));
    // std::cerr << "alignL\n"
    //           << alignL
    //           << "--------------\n"
    //           << "alignR\n"
    //           << alignR;
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << row(alignL, 0) << row(alignR, 0);
    SEQAN_ASSERT_EQ(contig, contigS.str());

    SEQAN_ASSERT_EQ(seqan::CharString("AGCATGTTAGATAAGATAGCTGT"), row(alignL, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("AGCCTGTTAGATAAGATAGCTGT"), row(alignL, 1));
    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGCCAT"), row(alignR, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("GCTAGTAGGCAGTCAGCGACAT"), row(alignR, 1));

    // Define the input sequences.  contig1 has an insertion with respect to contig1.

    // Variables for the alignments.
    seqan::Align<seqan::DnaString> alignL, alignR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    resize(rows(alignL), 2);
    assignSource(row(alignL, 0), contig1);
    assignSource(row(alignL, 1), contig2);
    resize(rows(alignR), 2);
    assignSource(row(alignR, 0), contig1);
    assignSource(row(alignR, 1), contig2);

    int res = splitAlignment(alignL, alignR, score, -12, 0);
    // clearClipping(row(alignL, 0));
    // clearClipping(row(alignL, 1));
    // clearClipping(row(alignR, 0));
    // clearClipping(row(alignR, 1));
    // std::cerr << "alignL\n"
    //           << alignL
    //           << "--------------\n"
    //           << "alignR\n"
    //           << alignR;
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << row(alignL, 0) << row(alignR, 0);
    SEQAN_ASSERT_EQ(contig1, contigS.str());

    SEQAN_ASSERT_EQ(seqan::CharString("AGCATTTTAGATAAGATAG"), row(alignL, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("AGCATGTTAGATAAGATAG"), row(alignL, 1));
    SEQAN_ASSERT_EQ(seqan::CharString("CTGTGCTAGTAGGCAGTCAGCGCCTT"), row(alignR, 0));
    SEQAN_ASSERT_EQ(seqan::CharString("CTGTGCTAGTAGGCAGTCAGCGCCAT"), row(alignR, 1));

    // Define the input sequences.
    seqan::DnaString seqL =   "AGCCTGTTAGATAAGATAGCTGTGGT";
    seqan::DnaString seqR =                         "GGCTAGTAGGCAGTCAGCGACAT";

    // Variables for the alignments.
    seqan::Gaps<seqan::DnaString> gapsHL, gapsVL, gapsHR, gapsVR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    assignSource(gapsHL, contig);
    assignSource(gapsVL, seqL);
    assignSource(gapsHR, contig);
    assignSource(gapsVR, seqR);

    int res = splitAlignment(gapsHL, gapsVL, gapsHR, gapsVR, score, -10, 10);
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << gapsHL << gapsHR;
    SEQAN_ASSERT_EQ(contig, contigS.str());


    // Define the input sequences.
    seqan::DnaString contig = "AGCATGTTAGATAAGATAGCTGTGCT"                                   "AGTAGGCAGTCAGCGCCAT";

    // Variables for the alignments.
    seqan::Gaps<seqan::DnaString> gapsHL, gapsVL, gapsHR, gapsVR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    assignSource(gapsHL, contig);
    assignSource(gapsVL, seqL);
    assignSource(gapsHR, contig);
    assignSource(gapsVR, seqR);

    int res = splitAlignment(gapsHL, gapsVL, gapsHR, gapsVR, score, -10, 10);
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << gapsHL << gapsHR;
    SEQAN_ASSERT_EQ(contig, contigS.str());


    // Define the input sequences.  contig1 has an insertion with respect to contig1.

    // Variables for the alignments.
    seqan::Gaps<seqan::DnaString> gapsHL, gapsVL, gapsHR, gapsVR;
    seqan::Score<int, seqan::Simple> score(0, -1, -1, -1);

    assignSource(gapsHL, contig1);
    assignSource(gapsVL, contig2);
    assignSource(gapsHR, contig1);
    assignSource(gapsVR, contig2);

    int res = splitAlignment(gapsHL, gapsVL, gapsHR, gapsVR, score, -12, 0);
    // clearClipping(gapsHL);
    // clearClipping(gapsVL);
    // clearClipping(gapsHR);
    // clearClipping(gapsVR);
    // std::cerr << "gapsHL\n"
    //           << gapsHL << "\n"
    //           << "gapsVL\n"
    //           << gapsVL << "\n"
    //           << "gapsHL\n"
    //           << gapsHL << "\n"
    //           << "gapsHR\n"
    //           << gapsHR << "\n";
    SEQAN_ASSERT_EQ(res, -2);

    std::stringstream contigS;
    contigS << gapsHL << gapsHR;
    SEQAN_ASSERT_EQ(contig1, contigS.str());


    using namespace seqan;

    // Scenario 1:
    DnaString read     = "GAGCCGA" "GGACCG";

    Gaps<DnaString> refGapsLeft;
    Gaps<DnaString> refGapsRight;
    Gaps<DnaString> readGapsLeft;
    Gaps<DnaString> readGapsRight;

    setSource(refGapsLeft, refLeft);
    setSource(refGapsRight, refRight);
    setSource(readGapsLeft, read);
    setSource(readGapsRight, read);

    Score<int> scoring(1, -3, -4, -5);

    int splitScore = splitAlignment(readGapsLeft, refGapsLeft, readGapsRight, refGapsRight, scoring,
                                    AlignConfig<false, true, true, true>());

    SEQAN_ASSERT_EQ(splitScore, 13);
    SEQAN_ASSERT_EQ(readGapsLeft, "------------GAGCCGA");
    SEQAN_ASSERT_EQ(readGapsRight, "GGACCG-----------------------");

    // Scenario 2:

    setSource(refGapsLeft, refLeft);
    setSource(refGapsRight, refRight);
    setSource(readGapsLeft, read);
    setSource(readGapsRight, read);

    splitScore = splitAlignment(readGapsLeft, refGapsLeft, readGapsRight, refGapsRight, scoring,
                                AlignConfig<false, true, true, true>());

    SEQAN_ASSERT_EQ(splitScore, 147);
    SEQAN_ASSERT_EQ(readGapsLeft, "---------------------------------------------------AGGGGTTTCGCCATGTTGGCCTGGCTGGTCTCGAAT");


    // Scenario 3:

    setSource(refGapsLeft, refLeft);
    setSource(refGapsRight, refRight);
    setSource(readGapsLeft, read);
    setSource(readGapsRight, read);

    splitScore = splitAlignment(readGapsLeft, refGapsLeft, readGapsRight, refGapsRight, scoring,
                                AlignConfig<false, true, true, true>());

    SEQAN_ASSERT_EQ(splitScore, 31);
    SEQAN_ASSERT_EQ(readGapsLeft, "----------ATTTTTTTTTTTTT");
